Monoclonal antibody specifically combined with Brucella Bp26 recombinant protein and application thereof

Abstract

The invention belongs to the technical field of cell engineering, and discloses a novel dominant monoclonal antibody specifically combined with Bp26 recombinant protein and application of the monoclonal antibody, the sequence of an epitope is ASPDMAILNL, the epitope is the most dominant epitope of Brucella Bp26 protein, and the Bp26 protein is the Brucella Bp26 protein. A hybridoma cell strain 6E8 for secreting the monoclonal antibody specifically combined with the Bp26 recombinant protein is preserved in the China Center for Type Culture Collection on January 7, 2025, and the preservation number is CCTCC NO: C202543. The monoclonal antibody aiming at the Bp26 recombinant protein of the Brucella can be specifically combined with the Bp26 protein and has a relatively good blocking effect. The blocking ELISA method for detecting the Brucella serum antibody is established by taking Bp26 recombinant protein as an antigen and a monoclonal antibody specifically combined with Brucella recombinant protein as a detection antibody. Compared with an indirect hemagglutination kit for detecting the Brucella serum antibody, the blocking ELISA antibody detection method disclosed by the invention has higher specificity and sensitivity.

Description

Technical Field

[0001] The invention belongs to the technical field of cell engineering, and in particular relates to a novel Brucella Bp26 recombinant protein monoclonal antibody hybridoma cell and application thereof. Background Art

[0002] Brucellosis (Brucellosis, referred to as brucellosis) is one of the most serious and harmful zoonoses in the world and even in my country. Brucellosis in animals is mainly characterized by invasion of the reproductive system, and female animals are more susceptible than male animals. The main clinical symptoms of brucellosis in female animals are infertility, miscarriage, stillbirth, weak fetus, mastitis, and endometritis; the main clinical symptoms of brucellosis in male animals are orchitis and epididymitis. The clinical symptoms of human infection with Brucella are weakness, fever, arthritis, and osteomyelitis, and severe cases can cause endocarditis or meningoencephalitis. Brucella is highly invasive and can be infected through direct contact with damaged skin and mucous membranes, and can also be transmitted through the respiratory tract and digestive tract. Sheep that survive the disease can also spread pathogens, and their secretions can continue to excrete bacteria for months or even years. There is no specific drug to treat brucellosis in cattle and sheep. When cattle and sheep are sick, they are generally not treated, and all sick and positive animals must be killed. At present, it has caused significant economic losses to the breeding industry at home and abroad. Therefore, the prevention and control of this disease is of great significance.

[0003] Brucellosis currently lacks specific and effective treatments, and vaccination and elimination of infected hosts are the main means of prevention and control. Brucella vaccine research has never stopped, and has gone through a development process from inactivated vaccines, attenuated live vaccines, rough attenuated live vaccines to genetically engineered vaccines.

[0004] The M5-90-ΔBp26 vaccine strain is a Bp26 gene deletion strain constructed by experts from the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences using the M5-90 strain as a parent. Studies have shown that the Bp26 gene deletion has little effect on the biological characteristics of the parent strain, and the residual virulence of mice and the protection against the 544 strain and the M28 strain are not significantly different from those of the M5-90 strain. For sheep with severe abortion, the pregnancy rate of the sheep reached 100% after the use of the M5-90-Δbp26 vaccine, reducing abortion caused by brucellosis. At present, the Brucella attenuated live vaccine (M5-90△bp26) is the most effective means to control and prevent animal brucellosis. Therefore, by preparing monoclonal antibodies against the bp26 protein, the monoclonal antibody blocking ELISA method and its diagnostic reagent can be established, thereby solving the technical problem of differential diagnosis between brucellosis vaccine immunity and natural infection. Summary of the invention

[0005] The purpose of the present invention is to provide a monoclonal antibody specifically binding to Brucella Bp26 recombinant protein and its application, and in particular to a monoclonal antibody specifically binding to Brucella Bp26 recombinant protein, a hybridoma cell line secreting the monoclonal antibody and the application of the monoclonal antibody.

[0006] The present invention first provides a hybridoma cell line 6E8 for preparing a monoclonal antibody, which was deposited in the China Center for Type Culture Collection on January 7, 2025, with a deposit number of CCTCC NO: C202543

[0007] The hybridoma cell line 6E8 provided by the present invention is used to prepare a monoclonal antibody capable of detecting Brucella;

[0008] The Brucella Bp26 recombinant protein is prepared by obtaining the Bp26 gene sequence from NCBI, using the Pcold I plasmid as an expression vector, using Escherichia coli BL21 (DE3) as an expression bacterium, and inducing the expression of the target protein with 0.1 mM IPTG; then the bacteria are ultrasonically disrupted, centrifuged, and the supernatant is taken to obtain the soluble expressed Bp26 recombinant protein; and purified using a Ni-NTAAgarose column;

[0009] The sequence of the monoclonal antibody epitope provided by the present invention is ASPDMAILNL, which is the most dominant epitope of Brucella Bp26 protein.

[0010] The monoclonal antibody and Bp26 recombinant protein provided by the present invention are used to establish a blocking ELISA method capable of differentially diagnosing and detecting Brucella vaccine immunity and natural infection;

[0011] The Brucella blocking ELISA method provided by the present invention does not cross-react with other common pathogenic bacteria of cattle and sheep (such as Escherichia coli, Salmonella, Listeria monocytogenes, and Yersinia intestinalis), thereby ensuring the specificity of the detection.

[0012] The advantages and positive effects of the technical solution to be protected by the present invention are:

[0013] The Brucella Bp26 recombinant protein of the present invention has a sequence-deficient vaccine strain, and after immunizing sheep, it cannot induce the production of antibodies against the epitope, thereby achieving differential diagnosis between natural infection and vaccination immunity.

[0014] The monoclonal antibody of the present invention has good specific recognition ability for Bp26 protein and can accurately recognize the epitope of Brucella.

[0015] The Brucella Bp26 recombinant protein and monoclonal antibody of the present invention can be used to detect brucellosis in sheep serum, and a blocking ELISA detection method is established, which can well identify whether the animal is naturally infected with brucellosis or immunized by vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a flow chart of a method for preparing a monoclonal antibody that specifically binds to Brucella Bp26 recombinant protein provided by an embodiment of the present invention;

[0017] Figure 2A Schematic diagram of the expression of the Bp26 recombinant protein provided in an embodiment of the present invention; M: protein marker relative molecular mass standard; 1: before PCold1 empty load induction; 2: after PCold1 empty load induction; 3: before PCold1-Bp26 induction; 4: after PCold1-Bp26 induction; 5: supernatant after PCold1-Bp26 induction; 6: precipitate after PCold1-Bp26 induction;

[0018] Figure 2B Schematic diagram of screening the final concentration of IPTG inducer provided in an embodiment of the present invention; M: protein marker relative molecular mass standard; 1: PCold1 before empty load induction; 2: PCold1-Bp26 before induction; 3-10: the final concentrations of IPTG inducer are 0mM, 0.01mM, 0.1mM, 0.2mM, 0.4mM, 0.6mM, 0.8mM, 1.0mM, respectively;

[0019] Figure 2C It is a schematic diagram of screening the optimal induction time provided in an embodiment of the present invention; M: protein marker relative molecular mass standard; 1: PCold1 before empty load induction; 2: PCold1-Bp26 before induction; 3-10: supernatant at 22h, 24h, 26h, 28h, 30h, and 32h of induction.

[0020] Figure 2D Schematic diagram of purification of recombinant Bp26 protein provided in an embodiment of the present invention; M: PM2510 relative molecular mass standard; 1-9: flow-through, 20mM imidazole eluent, 30mM imidazole eluent, 40mM imidazole eluent, 60mM imidazole eluent, 80mM imidazole eluent, 100mM imidazole eluent, 200mM imidazole eluent, 300mM imidazole eluent, 400mM imidazole eluent;

[0021] Figure 3 Schematic diagram of purification of Bp26 recombinant protein monoclonal antibody provided in an embodiment of the present invention; M: protein marker relative molecular mass standard; 1: purified Bp26 recombinant protein monoclonal antibody;

[0022] Figure 4 It is a schematic diagram of the dotblot epitope identification diagram of the Bp26 recombinant protein monoclonal antibody provided in an embodiment of the present invention; P01-P22: 22 epitopes of the Bp26 protein; positive control; negative control. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with the embodiments.

[0024] In view of the problems existing in the prior art, the present invention provides a novel monoclonal antibody specifically binding to Bp26 recombinant protein and its application. The present invention is described in detail below in conjunction with the accompanying drawings.

[0025] Example 1: Preparation of Brucella Bp26 recombinant protein

[0026] The accession number of the Bp26 gene sequence is NC_017246, the nucleotide sequence of the Bp26 gene is SEQ ID NO:1, and the nucleotide sequence of the S2 gene is SEQ ID NO:2.

[0027] The preparation method of Bp26 recombinant protein includes: obtaining the Bp26 gene sequence from NCBI, the gene sequence accession number is NC_017246, the Bp26 gene is located at 1450678bp-1451430bp, the full length of the gene sequence is 753bp, and it is marked as S1. The signal peptide in the Bp26 gene sequence is removed, the signal peptide is located at the 0-28 amino acid site, the full length of the gene sequence is 672bp, and it is marked as S2. The S2 gene sequence is synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd., cloned into the PcoldⅠ plasmid using SacI and SaII restriction endonucleases, and the positive recombinant plasmid is transformed into competent Escherichia coli BL21 (DE3) to obtain the recombinant expression bacteria BL21-PcoldⅠ-Bp26. The BL21-PcoldⅠ-Bp26 strain is cultured at 37°C and 200r / min until the OD 600 The value was 0.6-0.8, and 0.1 mM IPTG was used for induction for 24 h. The induced bacterial solution was centrifuged and precipitated, and the precipitate was washed with pH 7.4 PBS and resuspended; the bacterial cells were ultrasonically broken, centrifuged, and the supernatant was taken to obtain the soluble expressed Bp26 recombinant protein; the purified Bp26 recombinant protein was obtained by purification using Ni-NTAAgarose column (see Figure 2D ).

[0028] The nucleotide sequence of S1 provided in the embodiment of the present invention is:

[0029] atgaacactcgtgctagcaattttctcgcagcctcattttccacaatcatgctcgtcggcgctttcagcctgcccgctttcgcacaggagaatcagatgacgacgcagcccgcgcgcatcgccgtcaccggggaaggcatgatgacggcctcgcccgatatggccattctcaatctctcggtgctacgccaggcaaagaccgcgcgcgaagccatgaccgcgaataatgaagccatgacaaaagtgctcgatgccatgaagaaggccggcatcgaagatcgcgatctccagacaggcggcatcaatatccagccgatttatgtctatcctgacgacaagaacaacctgaaagagcctaccatcaccggctattctgtatccaccagtctcacggttcgcgtgcgcgaactggccaatgttggaaaaattttggatgaatccgtcacgctcggtgttaatcagggcggtgatttgaacctggtcaatgataatccctccgccgtgatcaacgaggcgcgcaagcgcgcagtggccaatgccattgccaaggcgaagacgcttgccgacgctgcaggcgtggggcttggccgtgtggtggaaatcagtgaactgagccgcccgcccatgccgatgccaattgcgcgcggacagttcagaaccatgctagcagccgcaccggacaattccgtgccgattgccgcaggcgaaaacagctataacgtatcggtcaatgtcgtttttgaaatcaagtaa

[0030] The nucleotide sequence of S2 provided in the embodiment of the present invention is:

[0031] atgcaggagaatcagatgacgacgcagcccgcgcgcatcgccgtcaccggggaaggcatgatgacggcctcgcccgatatggccattctcaatctctcggtgctacgccaggcaaagaccgcgcgcgaagccatgaccgcgaataatgaagccatgacaaaagtgctc gatgccatgaagaaggccggcatcgaagatcgcgatctccagacaggcggcatcaatatccagccgatttatgtctatcctgacgacaagaacaacctgaaagagcctaccatcaccggctattctgtatccaccagtctcacggttcgcgtgcgcgaactggccaat gttggaaaaattttggatgaatccgtcacgctcggtgttaatcagggcggtgatttgaacctggtcaatgataatccctccgccgtgatcaacgaggcgcgcaagcgcgcagtggccaatgccattgccaaggcgaagacgcttgccgacgctgcaggcgtggggctt ggccgtgtggtggaaatcagtgaactgagccgcccgcccatgccgatgccaattgcgcgcggacagttcagaaccatgctagcagccgcaccggacaattccgtgccgattgccgcaggcgaaaacagctataacgtatcggtcaatgtcgtttttgaaatcaagtaa

[0032] Example 2: Preparation of hybridoma cells expressing recombinant membrane protein Bp26

[0033] 1) Mouse immunization

[0034] The Bp26 recombinant protein and 201VG adjuvant were mixed at a volume ratio of 1:1 for the first mouse immunization; the immunization was performed once every week, and the volume ratio of Bp26 recombinant protein to 201VG adjuvant was 1:1; a total of 4 immunizations were performed, and the antigen dose was 100 μg / mouse / time; the mouse serum was obtained on the 3rd day after the 4th immunization, and the titer of the mouse serum was detected by indirect ELISA using Bp26 recombinant protein as antigen, and P / N ≥ 2.1 was judged as positive, and the titer reached 1:50000 or above, which was qualified for immunization; three days before collecting spleen cells of qualified immunized mice, the Bp26 recombinant protein was intraperitoneally injected for booster immunization, and the dose was 100ug / mouse / time;

[0035] 2) Cell fusion

[0036] The immunized BALB / c mice were killed by cervical dislocation, and the spleen cells of the mice were taken and fused with SP2 / 0 myeloma cells in 50% PEG4000 fusion agent at a ratio of 5:1. After fusion, the cells were plated with HAT selection medium and cultured at 37°C 5% CO2. The positive cell lines were frozen in a liquid nitrogen tank.

[0037] 3) Positive clone screening and cloning

[0038] The fused cells were half-changed and fully changed on the 7th and 10th days after fusion, respectively. On the third day after the full change of the medium, the purified recombinant Bp26 protein was used to screen the positive hybridoma cell line that can secrete anti-Bp26 protein antibodies by indirect ELISA method, and the positive wells obtained in the first screening were fully changed for a second screening. The wells that were still positive in the second screening were expanded and cultured and frozen, and subcloning was performed continuously for 3 to 5 times until the positive rate was 100%. After the positive wells were expanded and cultured, a cell line Bp26-6E8 that could stably pass and secrete specific monoclonal antibodies against Bp26 protein was obtained.

[0039] 4) Identification of monoclonal antibody subclasses

[0040] The hybridoma cell Bp26-6E8 was identified according to the instructions of the mouse antibody typing kit of Proteintech Group. The heavy chain of Bp26-6E8 was identified as IgG1, and the light chain was K chain.

[0041] Example 3: Preparation of monoclonal antibodies

[0042] BALB / C mice were sensitized by intraperitoneal injection of 1 mL of autoclaved liquid paraffin. Seven days later, 1.0 × 10 6 A positive hybridoma cell line CCTCC NO: C202543 with good growth was obtained. Changes in the abdominal cavity of the mice were observed every day. When the abdominal cavity was swollen to the point of difficulty in movement, ascites was collected and centrifuged to collect the middle layer of light yellow ascites. The ascites obtained by the present invention was purified by a ThermoProtein G purification column and then subjected to SDS-PAGE to observe the purity (see Figure 3 ), and measure the concentration, and store at -80℃ for future use.

[0043] Example 4: Monoclonal Antibody Epitope Identification

[0044] According to the sequencing results of BL21-PcoldI-Bp26 (see the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2), 22 overlapping peptides with a length of 8-15 amino acids were designed and synthesized (see Table 1).

[0045] Dotblot was used to verify the monoclonal antibody epitope. Peptides were synthesized by Shanghai New Spectrum Biotechnology Co., Ltd. Different peptides were spotted on PVDF membranes. The PVDF membranes were blocked with TBST containing 5% skim milk powder, and then incubated with monoclonal antibody supernatant at a dilution of 1:1000 for 1 hour. The membranes were washed with TBST three times, each for 10 minutes. Horseradish peroxidase-labeled goat anti-mouse IgG was used as the secondary antibody for incubation for 1 hour. After washing with TBST, the membranes were developed by luminescence (see Figure 4 ).

[0046] The polypeptide epitopes provided in the embodiments of the present invention are:

[0047] Table 1 Peptide sequence list

[0048]

[0049]

[0050] Example 5: Blocking ELISA method for detecting Brucella serum antibodies

[0051] 1) Through the chessboard titration test, the optimal coating concentration of Bp26 recombinant protein was determined to be 300ng / mL, 100μL / well; serum was original, 100μL / well; the dilution of monoclonal antibody was 1:2000, 100μL / well, incubation time 1h; the dilution of HRP-labeled goat anti-mouse antibody was 1:10000, 100μL / well, incubation time 1h. The substrate solution TMB was 100μL / well, incubation time 10min; the stop solution was 50μL / well, and the OD was detected immediately after addition. 450 value.

[0052] 2) Antigen coating procedure: thaw the antigen frozen at -80℃, dilute with pH 7.4 PBS to 300ng / mL, add to the ELISA plate, 100μL / well, transfer to 4℃ overnight. The next day, discard the antigen solution, wash and block with 3% BSA, 200μL / well, incubate at 37℃ for 1h, and wash again.

[0053] 3) Result determination

[0054] ① Calculate the OD of the negative and positive control wells and each serum well to be tested on the same ELISA plate 450 The blocking rate (PI) of the standard positive serum, negative serum and serum to be tested was calculated according to the following formula: PI = (OD 450 Average value - sample OD 450 Average value / standard negative serum OD 450 Average value)×100%.

[0055] ②PI of standard positive serum>50%, OD of standard negative serum450 >1.0, the test is established, otherwise the test result is invalid.

[0056] ③ For serum samples to be tested, PI ≥ 35% is positive; PI < 35% is negative

[0057] Blocking ELISA methods for detecting Brucella serum antibodies include:

[0058] (1) Coating: dilute the coating solution to a specific concentration of antigen, 100uL / well, and incubate at 4°C overnight;

[0059] (2) Washing: 200uL / well of washing solution, wash 3 to 4 times, 3 minutes each time;

[0060] (3) Blocking: 200uL / well of blocking solution, incubate at 37°C for 1h;

[0061] (4) Washing: 200uL / well of washing solution, wash 4 to 5 times, 3 minutes each time;

[0062] (5) Standard positive and negative serum and serum to be tested: dilute the standard positive and negative serum and serum to be tested to appropriate concentrations, 100uL / well, incubate at 37°C for 1h. Note the setting of duplicate wells;

[0063] (6)Same as (4);

[0064] (7) Monoclonal antibody: dilute the monoclonal antibody to an appropriate concentration, 100 uL / well, and incubate at 37°C for 1 h.

[0065] (8)Same as (4);

[0066] (9) Enzyme-labeled secondary antibody: dilute the enzyme-labeled secondary antibody to an appropriate concentration, 100 ul / well, incubate at 37°C for 1 h.

[0067] (10)Same as (4)

[0068] (11) Color development: 100 uL / well of substrate solution, incubate at 37°C for 15 min;

[0069] (12) Stop: 50uL / well of stop solution;

[0070] (13) Reading: Read the value at OD450nm using an ELISA reader.

Claims

1. A hybridoma cell line for preparing a monoclonal antibody, characterized in that: The hybridoma cell line is hybridoma cell line 6E8, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCCNO: C202543.

2. The hybridoma cell line according to claim 1, characterized in that The hybridoma cell line is prepared by immunizing mice with Brucella Bp26 recombinant protein as an antigen.

3. The hybridoma cell line according to claim 1, characterized in that The epitope is a new dominant antigenic epitope of Brucella membrane protein Bp26, and the sequence is: ASPDMAILNL.

4. The hybridoma cell line according to claim 2, characterized in that The preparation method of the Brucella Bp26 recombinant protein comprises the following steps: obtaining the Bp26 gene sequence from NCBI, using the PcoldⅠ plasmid as an expression vector, using Escherichia coli BL21 (DE3) as an expression bacterium, inducing the expression of the target protein with 0.1 mM IPTG; then ultrasonically disrupting the bacterial cells, centrifuging, taking the supernatant, and obtaining the soluble expressed Bp26 recombinant protein; and purifying the protein using a Ni-NTAAgarose column.

5. Use of the hybridoma cell line according to claim 1 in preparing monoclonal antibodies.

6. A monoclonal antibody that specifically binds to Brucella Bp26 recombinant protein, characterized in that: The monoclonal antibody is secreted by the hybridoma cell line according to claim 1.

7. Use of the monoclonal antibody according to claim 6 and the Bp26 recombinant protein according to claim 4 in the preparation of products for detecting Brucella.

8. A blocking ELISA method for detecting Brucella serum antibodies, characterized in that, The blocking ELISA method for detecting Brucella serum antibodies is prepared using the Bp26 recombinant protein described in claim 4 as an antigen and the monoclonal antibody that specifically binds to the Brucella Bp26 recombinant protein described in claim 6 as a detection antibody.

9. The monoclonal antibody according to claim 6, characterized in that This monoclonal antibody does not produce any immune reaction with Escherichia coli, Salmonella, Listeria monocytogenes, and Yersinia intestinalis.

10. The blocking ELISA method for detecting Brucella serum antibodies according to claim 8, characterized in that, The steps include: (1) Coating: dilute the coating solution to a specific concentration of antigen, 100uL / well, and incubate at 4°C overnight; (2) Washing: 200uL / well of washing solution, wash 3 to 4 times, 3 minutes each time; (3) Blocking: 200uL / well of blocking solution, incubate at 37°C for 1h; (4) Washing: 200uL / well of washing solution, wash 4 to 5 times, 3 minutes each time; (5) Standard positive and negative serum and serum to be tested: dilute the standard positive and negative serum and serum to be tested to appropriate concentrations, 100uL / well, incubate at 37°C for 1h. Note the setting of duplicate wells; (6) Washing: 200uL / well of washing solution, wash 4 to 5 times, 3 minutes each time; (7) Monoclonal antibody: dilute the monoclonal antibody to an appropriate concentration, 100 uL / well, and incubate at 37°C for 1 h. (8) Washing: 200uL / well of washing solution, wash 4 to 5 times, 3 minutes each time; (9) Enzyme-labeled secondary antibody: dilute the enzyme-labeled secondary antibody to an appropriate concentration, 100 ul / well, incubate at 37°C for 1 h. (10) Washing: 200 uL / well of washing solution, wash 4 to 5 times, 3 min each time; (11) Color development: 100 uL / well of substrate solution, incubate at 37°C for 15 min; (12) Stop: 50uL / well of stop solution; (13) Reading: Read the value at OD450nm using an ELISA reader.

Images