Rhamsantransferase for catalyzing yunzhang saponin biosynthesis and its coding gene and application

Abstract

The application clones full-length of rhamnose transferase TtUGT39 gene in Trillium tschonoskii by polymerase chain reaction, and successfully expresses the recombinant protein in Escherichia coli, and for the first time, identifies and confirms that the rhamnose transferase TtUGT39 can catalyze the extension of the C-4 position sugar chain of Chonglou saponin III and Pinno saponin genin-3-O-beta-chacotriose, and the generated products are Chonglou saponin II and Chonglou saponin VII respectively, and the application also relates to a variant of the TtUGT39 enzyme, which also has good catalytic activity, and has very high economic value and application prospect.

Description

Technical Field

[0001] The present invention relates to the fields of proteins and genetic engineering. More specifically, the present invention relates to a glycosyltransferase and a gene encoding the enzyme. The glycosyltransferase can catalyze the biosynthesis of Paris polyphylla saponins in vitro. Background Art

[0002] Paris polyphylla saponins are steroidal saponins with a cyclopentanepolyhydrophenanthrene structure as their core structure. They primarily include isospirostane-type diosgenin and pentosan-type saponins. Research has shown that Paris polyphylla saponins not only have resistance to tumors and myocardial ischemia, but also exhibit antioxidant, antibacterial, anti-inflammatory, sedative, analgesic, hemostatic, immunomodulatory, and organ protective effects, thus possessing extremely high medicinal value.

[0003] Based on the theory of medicinal plant phylogeny, the closely related Paris polyphylla and Trillium species both contain paridis saponins. Paris polyphylla plants are primarily found in southwestern provinces such as Yunnan and Guizhou. Studies have shown that they can produce a variety of benefits, such as clearing heat and detoxifying, dispersing stagnation and reducing swelling, cooling the liver and calming nerves, and are often used to relieve ailments such as sore throats and snake bites. Among them, monomeric components such as Paris polyphylla saponins I, II, and III have excellent in vitro antitumor activity, while monomeric components such as Paris polyphylla saponins H, VI, and VII have stronger hemostatic activity than their corresponding dioscins. Modern pharmacological studies have demonstrated their important roles in inhibiting cancer cell growth and metastasis, and regulating cell apoptosis. Paris polyphylla plants are primarily found in Sichuan, Yunnan, and Guizhou, and have a long history of medicinal use. They are commonly used by the public to treat uterine bleeding, promoting blood circulation, and removing blood stasis. There are three main types of steroidal sapogenins in Trillium plants: diosgenin, pyranosapogenin, and furostanol sapogenins, which are the same as the main sapogenins in Paris. Saponins are not abundant in plants, and the isolation of monomeric compounds is difficult, making large-scale production difficult. This cannot meet market demand. Furthermore, the complex structure of Paris saponins makes chemical synthesis difficult, severely restricting the development and application of this natural product.

[0004] Glycosylation plays a key role in the structural diversity of Paris saponins, a process that relies on glycosyltransferases. Glycosyltransferases are widely present in animals, plants, and microorganisms, catalyzing the transfer of sugar groups from donor molecules to acceptor molecules to form various glycoside compounds. These enzymes play a crucial role in their biological activity, solubility, stability, and secondary metabolite diversity. The formation of Paris saponins requires multiple glycosyltransferases that specifically recognize different aglycones, glycosyl groups, and glycosylation sites. Currently, only 3-O-β-glucosyltransferases and 2'-O-rhamnosyltransferases for diosgenin and diosgenin have been identified. The key rhamnosyltransferases that catalyze the formation of other key active ingredients, Paris saponin III, diosgenin-3-O-β-chacotriosaccharide, Paris saponin V, and Paris saponin VI, remain unidentified. Therefore, the identification of glycosyltransferases related to the downstream pathway of the biosynthesis of Paris saponins is of great significance for the exploration of the biosynthetic pathway of Paris saponins and the realization of heterologous synthesis of Paris saponins. Summary of the Invention

[0005] The object of the present invention is to provide a rhamnosyltransferase (hereinafter referred to as TtUGT39), which includes the amino acid sequence shown in SEQ ID NO: 1, or a mutant in which at least one amino acid of the amino acid sequence shown in SEQ ID NO: 1 is substituted, deleted or inserted but the activity of the protein is retained, and has the biological function of catalyzing the extension of the sugar chain of parisopside III to parisopside II, and can catalyze the conversion of parisopside-3-O-β-chacotriosaccharide to parisopside VII.

[0006] In a specific embodiment of the present invention, the mutant is selected from at least one of the following sites in the amino acid sequence shown in SEQ ID NO: 1: A158T, S377V, T370A, S376A, G23A, P355A, H22A, F100A, Y152A, F154A, H104A, Y421, I91A, R203A, N296A or a combination thereof, and these mutants have at least a certain biological function of catalyzing the extension of the sugar chain of parisopsides, and can catalyze parisopside III to produce parisopside II, and catalyze the conversion of parisopside-3-O-β-chacotrisaccharide to parisopside VII.

[0007] In a preferred embodiment of the present invention, the mutant is an A158T mutant or an S377V mutant.

[0008] The present invention also provides a polynucleotide encoding the enzyme TtUGT39 of the present invention (or encoding gene, hereinafter referred to as TtUGT39). A representative example is that the polynucleotide sequence is shown in SEQ ID NO: 2.

[0009] The present invention also provides an expression vector comprising the polynucleotide of the present invention. The expression vector may be selected from the pET series of expression vectors and the pEASY series of expression vectors.

[0010] In the present invention, various vectors known in the art, such as commercially available vectors, including plasmids and cosmids, can be used. When producing the rhamnosyltransferase TtUGT39 described in the present invention, the nucleotide sequence of the rhamnosyltransferase TtUGT39 encoding gene can be operably linked to an expression control sequence, thereby forming an expression vector for synthesizing Parisopsin II and / or Parisopsin VII. The term "operably linked" when referring to DNA segments means that these segments are arranged in a certain manner so that they can coordinately function for their intended purpose, such as initiating transcription in a promoter and proceeding through the coding segment to the terminator. It also refers to a situation where certain parts of a linear DNA sequence can affect the activity of other parts of the same linear DNA sequence. For example, if signal peptide DNA is expressed as a prerequisite and participates in the secretion of a polypeptide, then the signal peptide (secretion leader) DNA is operably linked to the polypeptide DNA; if the promoter controls the transcription of the sequence, then it is operably linked to the coding sequence; if the ribosome binding site is placed in a position that enables its translation, then it is operably linked to the coding sequence. Generally, "operably linked" means contiguous, and, with respect to a secretory leader, contiguous and in reading frame.

[0011] In a fourth aspect, the present invention provides a recombinant host bacterium comprising the polynucleotide according to the second aspect of the present invention or the expression vector according to the third aspect of the present invention, wherein the host bacterium is Escherichia coli, such as DE3 Escherichia coli.

[0012] The host bacteria of the present invention contain a polynucleotide molecule encoding the rhamnosyltransferase TtUGT39 of the present invention, or a nucleotide molecule that hybridizes to the polynucleotide molecule under stringent conditions, or contain the expression vector described above. The host cell is selected from bacteria, prokaryotic cells (such as Escherichia coli), fungal cells, yeast cells, insect cells, mammalian cells, or plant cells, preferably Escherichia coli.

[0013] The transformed or transfected host cells are cultured in a culture medium of conventional composition (e.g., any of a wide variety of media known to those of skill in the art) containing nutrients and other ingredients required for the growth of the selected host cell. A wide variety of suitable culture media, including known defined media and complex media, are known in the art, and generally include a carbon source, a nitrogen source, essential amino acids, vitamins, and minerals. If desired, the culture medium can also contain ingredients such as growth factors or serum. Cells containing the exogenously added DNA are selected from the growth medium, generally by virtue of their ability to grow in the presence of a selective agent, e.g., a drug or by their ability to complement an essential nutrient deficiency in the growth medium, which can be supplied by a selection marker carried on the expression vector or co-transfected into the host cell. Liquid cultures are provided with adequate air by conventional means, e.g., shaking of Erlenmeyer flasks or sparging of fermentors.

[0014] In the present application, the polynucleotide encoding the rhamnose transferase TtUGT39 can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed according to the nucleotide sequences disclosed in the present application, especially the open reading frame sequences, and a commercially available cDNA library or a cDNA library prepared according to conventional methods known to those skilled in the art is used as a template for amplification. When the sequence is long, two or more PCR amplifications are often required, and then the fragments amplified in each amplification are spliced together in the correct order. Once the relevant sequence is obtained, the recombination method can be used to obtain the relevant sequence in large quantities. This is usually achieved by cloning the sequence into a vector, transforming into cells, and then isolating the relevant sequence from the proliferated host cells by conventional methods. In addition, mutants can be introduced into the protein sequences of the present application by chemical synthesis. In addition to being produced by recombination, fragments of the proteins of the present application can also be produced by direct synthesis of peptides using solid-phase technology (Stewart et al., Solid-Phase Pedtide Synthesis, J. Am. Chem. Soc. 85:2149-2154, 1963). Protein synthesis in vitro can be performed manually or automatically. For example, the peptide can be automatically synthesized using a peptide synthesizer model 431A of Applied Biosystems (Foster City, CA). Each fragment of the protein of the present application can be chemically synthesized separately, and then chemically linked to produce a full-length molecule.

[0015] The TtUGT39 gene cloned in the present application is constructed into an expression vector and integrated into E. coli using synthetic biology technology, and it is confirmed by catalytic experiments that it has the biological functions of catalyzing the generation of Paris saponin II from Paris saponin III, and the generation of Paris saponin VII from pennogenin-3-O-β-chacotrioside.

[0016] Therefore, in another aspect, the present invention provides the use of rhamnosyltransferase TtUGT39, or the rhamnosyltransferase TtUGT39 encoding gene TtUGT39, or an expression vector comprising the encoding gene TtUGT39, and a host bacteria comprising the expression vector in regulating and / or synthesizing Parisopside II and / or Parisopside VII.

[0017] The Paris polyphylla saponin II and / or VII of the present invention can be prepared by the following method, i.e., by adopting a biosynthesis method, which comprises: introducing the gene encoding rhamnosyltransferase TtUGT39 TtUGT39 into Escherichia coli to obtain recombinant Escherichia coli, fermenting the recombinant bacteria, adding the reaction substrate to the fermentation broth, and reacting to obtain Paris polyphylla saponin II and / or VII.

[0018] The present invention has important theoretical and practical significance for cultivating high-quality medicinal plant varieties, especially cultivating Paris polyphylla varieties with high yield of Paris polyphylla saponin II and / or VII. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0020] Figure 1 This is the agarose gel electrophoresis diagram of the ORF amplification product of TtUGT39, where the marker is

[0021] PlusⅡDNA Marker, lane 2 is the target band (1488bp).

[0022] Figure 2 This is a gel image of the pET28a-TtUGT39 recombinant protein, where the marker is Blue ⅡProteinMarker (14-120kDa), lane 2 is TtUGT39 protein, and lane 3 is pET28a empty protein.

[0023] Figure 3LC-MS detection results of enzymatic reaction products of Paris saponin Ⅲ and pinocembrin-3-O-β-chacotrioside catalyzed by rhamnose transferase TtUGT39, A. LC / MS TIC chromatogram of enzymatic reaction (a. Enzymatic reaction of Paris saponin Ⅲ catalyzed by TtUGT39, in which TtUGT39 is the enzymatic reaction and pET28a is the empty control. The retention time of the enzymatic product of TtUGT39 is 8.50 min, which is consistent with the retention time of the standard Paris saponin Ⅱ b. Enzymatic reaction of pinocembrin-3-O-β-chacotrioside catalyzed by TtUGT39, in which TtUGT39 is the enzymatic reaction and pET28a is the empty control. The retention time of the enzymatic product of TtUGT39 is 5.71 min, which is consistent with the retention time of the standard Paris saponin Ⅶ), B. Mass spectrum of the enzymatic product Paris saponin Ⅱ, C. Mass spectrum of the enzymatic product Paris saponin Ⅶ.

[0024] Figure 4 Reaction formula for rhamnose transferase TtUGT39 catalyzing Paris saponin Ⅲ and pinocembrin-3-O-β-chacotrioside to generate Paris saponin Ⅱ and Paris saponin Ⅶ, respectively.

[0025] Figure 5 Gene expression analysis of TtUGT39 in different tissue parts of Trillium plants.

[0026] Figure 6 Results of molecular docking of TtUGT39 protein and sugar acceptor Paris saponin Ⅲ and UDP-Rha

[0027] Figure 7 Conversion rate of the mutant catalyzing Paris saponin Ⅲ and pinocembrin-3-O-β-chacotrioside to generate Paris saponin Ⅱ and Paris saponin Ⅶ, respectively.

[0028] Materials and sources of the experiment

[0029] 1.1 Plant samples

[0030] The Trillium plant samples were collected from Baoxing County, Ya'an City, Sichuan Province, and divided into rhizome, fibrous root, stem, leaf, and flower five parts. After being washed with clean water and distilled water, the samples were dried with filter paper, frozen in liquid nitrogen, and stored in a -80℃ refrigerator.

[0031] 1.2 Materials and reagents

[0032] Super Total RNA Extraction Kit was purchased from Promega Biotechnology Co., Ltd. (Beijing); 2×PhantaTM Master Mix High-fidelity Enzyme, 6×Protein Loading Buffer, Blue Ⅱ Protein Marker was purchased from Novizen Biotechnology Co., Ltd. Blunt Zero was purchased from Beijing Zoben Biotech Co., Ltd.; Trans1-T1 competent cells, Transetta (DE3) expression competent cells were purchased from ABclonal Biotech Co., Ltd.; pET28a vector (laboratory reserved); Thermo Scientfic GeneJET Gel Extraction Kit was purchased from Thermo Fisher Scientific; Isopropyl thiogalactoside (IPTG) was purchased from Shanghai Yuan Ye Biotechnology Co., Ltd.; Primers were synthesized by Beijing Tianyihuiyuan Biotechnology Co., Ltd. DETAILED DESCRIPTION

[0033] The preferred embodiments of the present application are described below in conjunction with the accompanying drawings, it should be understood that the preferred embodiments described herein are only used to illustrate and explain the present application, and are not used to limit the present application.

[0034] Example 1 Cloning of Full-length cDNA Sequence of Trillium tschonoskii Gene TtUGT39

[0035] 1.1 Extraction of total RNA of Trillium tschonoskii and obtaining of cDNA first strand

[0036] Fresh Trillium tschonoskii plants were collected from Baoxing County, Ya'an City, Sichuan Province, and divided into rhizome, fibrous root, stem, leaf and flower. After being washed with water and distilled water, they were wiped dry with filter paper, frozen in liquid nitrogen and stored in a -80°C refrigerator. According to the operation manual of Super Total RNA Extraction Kit, the RNA of Trillium tschonoskii plant tissue stored in a -80°C refrigerator was extracted, and the extracted total RNA with good quality was reversely converted into cDNA using Fast Quant cDNA First Strand Synthesis Kit (Beijing Tiangen Biotech Co., Ltd.) according to the manual. The cDNA was stored in a -20°C refrigerator for standby use.

[0037] 1.2 Cloning of full-length sequence of the gene

[0038] (1) Designing primers and PCR amplifying the target gene

[0039] According to the TtUGT39 open reading frame (ORF) sequence fragment obtained by screening the genomic data annotation information of Trillium tschonoskii, 5' and 3' specific primers were designed at both ends of the ORF using Primer premier 5.0 software, and the cDNA first strand obtained by reverse transcription was used as a template to perform PCR amplification using 2x Phanta Master Mix high-fidelity enzyme, so as to obtain the full-length gene. The primer sequences are as follows: TM TtUGT39-F: ATGGGGAGCGCTCCTCCT

[0040] TtUGT39-F: ATGGGGAGCGCTCCTCCT ​

[0041] TtUGT39-R: TTAGTCACCACCACCATTCTCGGT

[0042] Reaction system (50 μL):

[0043]

[0044] PCR program (35 cycles):

[0045]

[0046]

[0047] The PCR product was detected by 1.0% agarose gel electrophoresis at 180 V for 10 min, and observed on a gel imaging instrument. If a band with the same size as the target gene appeared, the following steps were continued.

[0048] (2) Recovery of amplified fragments

[0049] The Thermo Scientfic GeneJET gel recovery kit was selected to recover the DNA, and the operation method was as follows.

[0050] ① The gel containing the DNA fragment was carefully cut with a scalpel, placed in a 1.5 mL EP tube and weighed, and the weight of the gel block was recorded;

[0051] ② Binding Buffer was added to the 1.5 mL EP tube at a volume to weight ratio of 1:1 (the amount was calculated by weight, that is, 100 μL of Binding Buffer was added for every 100 mg of agarose gel);

[0052] ③ The above gel mixture was incubated at 55-60°C for 10 min, and after the gel was completely dissolved, it was transferred to the adsorption tube, centrifuged at 12 000 x g for 1 min, and the waste liquid was discarded;

[0053] ⑤ 700 μL of Wash Buffer was added to the adsorption tube, centrifuged at 12 000 x g for 1 min, and the waste liquid was discarded; repeat twice;

[0054] ⑥ The empty column was centrifuged at 12 000 x g for 2 min, the purification column was transferred to a new 1.5 mL centrifuge tube, 30-50 μL of ddH2O was added to the purification column membrane, after 5 min, centrifuged at 12 000 x g for 1 min, and the purified DNA was directly used for subsequent experiments or stored at -20°C.

[0055] (3) Construction of cloning vector and transformation of competent cells

[0056] The following methods were used -Blunt Zero Cloning Kit, take 4.5 μL gel recovery DNA solution, 0.5 μL -Blunt Zero vector, under the condition of 25℃, connect for 15 min; add the connection product to 50 μL Trans1-T1 competent cells, place in ice for 30 min, immediately put into ice for 2 min after 42℃ heat shock for 45 s, add 500 μL LB medium, 37℃, 180 rpm, recover for 1 h, take 100 μL to spread on LB solid medium containing 50 mg·L -1 Kana, 37℃, invert culture overnight. Pick single colony to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. to complete sequencing.

[0057] The sequencing result shows that the gene of the PCR amplification product is named TtUGT39, which encodes a protein consisting of 495 amino acid residues, and the amino acid sequence is shown as SEQ ID NO. 1. The cloning vector is named pEASY-Blunt-TtUGT39 plasmid, which is stored in a-80℃ refrigerator.

[0058] Example 2, biological function research of Trillium tschonoskii TtUGT39

[0059] 1. Construction of prokaryotic expression vector

[0060] Inoculate the strain with correct sequencing result and pET28a vector strain into LB liquid medium containing 50 mg·L -1 Kana, 37℃, 250 rpm, and culture for 12-16 h, and extract the plasmid by using plasmid extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.).

[0061] (1) Design primers specific to the target gene with homologous arms.

[0062] pET28a-TtUGT39-F: tgttccaggggcccgaattc ATGGGGAGCGCTCCTCCTGT

[0063] pET28a-TtUGT39-R: tggtgctcgagtgcggccgc TTAGTCACCACCACCATTCT

[0064] (2) Linearization of empty vector preparation: The extracted pET28a(His-MBP) empty vector was double-digested with NEB restriction enzymes Not I and EcoR I, incubated at 37°C for 2h, and then detected after staining with 6xDNA Loading Buffer and electrophoresis on a 1.0% agarose gel at 180V for 10min. The product was recovered using a Thermo Scientfic GeneJET Gel Recovery Kit.

[0065] Enzyme digestion reaction system (50uL):

[0066]

[0067] Enzyme digestion reaction conditions: 37°C, incubation for 2h.

[0068] (3) Preparation of PCR product (target gene) with homologous arms: The pET28a-TtUGT39-F / R primers were used to amplify the coding region of the gene using the 2xPhanta Master Mix high-fidelity enzyme and the pEASY-Blunt-TtUGT39 plasmid containing the full-length cDNA of the TtUGT39 gene as the template. The PCR reaction program was as follows: 98°C for 30s; 98°C for 10s, 59°C for 5s, 72°C for 20s, 35 cycles; 72°C for 5min; 4°C for maintenance. The PCR product was detected after staining with 6xDNA Loading Buffer and electrophoresis on a 1.0% agarose gel at 180V for 10min, and then recovered using a Thermo Scientfic GeneJET Gel Recovery Kit. TM

[0069] (4) Establishment of ligation system according to seamless assembly kit

[0070] Reaction system (10μL):

[0071]

[0072] The amount of the vector and each insert in the 10μL reaction system was 0.01-0.25pmols, and the optimal molar ratio of the vector to each fragment was 1:2, with ligation at 50°C for 15min.

[0073] ​(5) Add the ligation product to 50 μL Transl-Tl competent cells, place in ice for 30 min, heat shock at 42°C for 45 s, then immediately place in ice for 2 min, add 500 μL LB medium, recover at 37°C, 180 rpm for 1 h, take 100 μL to coat on LB + Kana solid medium, cultivate at 37°C overnight. Pick single colonies to Beijing Tianyihuiyuan Biotechnology Co., Ltd. for sequencing. The strain with correct sequencing result is inoculated into 5 mL LB liquid medium containing 50 mg·L -1 Kana and cultivated overnight, plasmid is extracted by plasmid extraction kit (Beijing Tiangen Biochemical Technology Co., Ltd.), and stored in -20°C refrigerator.

[0074] (6) Transformation of expression competent cells: the extracted pET28a-TtUGT39 (Trans-Tl) plasmid is transformed into Transetta (DE3) expression competent cells, and cultivated on LB solid medium containing 50 mg·L -1 Kana at 37°C overnight, pick single colonies to Tianyihuiyuan Biotechnology Co., Ltd. for sequencing. The strain with correct sequencing result is added with 20% volume of glycerol after cultivation, and stored in -80°C refrigerator.

[0075] 2. Induction of recombinant protein expression

[0076] (1) The positive single colony of pET28a-TtUGT39 transformed into expression vector is cultivated at 37°C and 250 rpm overnight, and then expanded to 500 mL liquid medium containing 50 mg·L -1 Kana at 37°C, and cultivated until OD 600 is 0.6-0.8, then isopropyl thiogalactoside (IPTG) is added to a final concentration of 0.5 mM, and expression is induced at 16°C for 16-20 h;

[0077] (2) The bacterial liquid induced at low temperature is centrifuged at 4°C, 10000 x g for 1 min to collect bacterial cells, buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 5% glycerol) is added to resuspend the bacterial cells, the concentration is 0.2 g·mL -1 , and the bacterial cells are broken by ultrasonic crusher, and centrifuged at 4°C, 12000 x g for 45 min.

[0078] (3) 20 μL of supernatant is added with 4 μL of 6 x Protein Loading Buffer, boiled at 99°C for 8 min, and then detected by SDS-PAGE gel electrophoresis, and compared with Marker [Blue Ⅱ Protein Marker (14-120kDa)] control, the molecular weight of the pET28a-TtUGT39 recombinant protein is about 100kDa, and it is a soluble protein.

[0079] 3. Enzymatic reaction

[0080] To a 200 μL reaction system, 4 μL UDP-rhamnose (1 mM), 8 μL Paris polyphylla saponin III, 100 μM parsenoside-3-O-β-chacotriosaccharide, and 188 μL crude enzyme were added. The recombinant protein expressed by the recombinant plasmid pET28a-TtUGT39 was used as the experimental group, and the protein expressed by the empty plasmid pET28a was used as the control group. After reacting in a 30°C incubator for 12 h, 200 μL ice methanol was added to terminate the reaction, and the mixture was filtered through a 0.22 μm filter membrane. The reaction results were analyzed by LC-MS (SYNAPT G2 ultra-performance liquid chromatography / ion mobility / quadrupole-time-of-flight mass spectrometry).

[0081] Liquid chromatography (LC) detection methods and conditions: A BEH-C18 reversed-phase column (1.7 μm, 2.1 mm × 100 mm, Waters) was used, with an injection volume of 3 μL. The mobile phases were: water (phase A), acetonitrile (phase B), and elution gradient: 30% to 60% B (0–9 min); 60% B (9–11 min); 60% to 70% B (11–13 min); and 70% to 100% B (13–16 min). The flow rate was 0.3 mL / min, the injection volume was 5 μL, and the column temperature was 30°C. Full-MS was performed in positive ion mode, with a scan range of 100–1000 Da and a scan time of 0.2 s.

[0082] The reaction results are as follows Figure 3 As shown, TtUGT39 can catalyze the extension of the C-4 sugar chain of paridisapogenin III and paridisapogenin-3-O-β-chacotriosaccharide to generate polysaccharides paridisapogenin II and paridisapogenin VII, respectively.

[0083] 4. Molecular docking and in vitro enzymatic reaction of mutants

[0084] According to the molecular docking results, Figure 6 As shown, alanine scanning was performed on key amino acids within the 5A range of the binding site and the substrate channel. The TtUGT39 gene sequence was aligned with the transcriptome database and the homologous sequences of known functional Rha, and the differential amino acids were cross-mutated. The preparation of mutants and in vitro enzymatic experiments were carried out according to the method of Example 2.

[0085] Reaction results showed that the A158T mutant had a 1-fold increase in the conversion rate of Rhizoma Polygoniside III compared to the wild type, and a 0.8-fold increase in the conversion rate of Rhizoma Polygoniside-3-O-β-chalcogenin trisaccharide compared to the wild type. The S377V mutant also slightly improved the conversion rate of Rhizoma Polygoniside III compared to the wild type. Furthermore, mutations to alanine in key conserved amino acids for the catalytic reaction resulted in loss of activity, such as 370A, S376A, G23A, P355A, H22A, F100A, Y152A, F154A, H104A, Y421, I91A, R203A, and N296A.

[0086] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. An isolated protein, the amino acid sequence of which is shown in SEQ ID NO:

1.

2. A variant of the protein according to claim 1, wherein the variant is a site mutation based on the amino acid sequence of SEQ ID NO: 1, wherein any of the following mutations are performed: A158T, S377V, S255A, L132A, I159A, A158C, A158N, A158D, A158S, or A158T_S377V.

3. A polynucleotide encoding the protein according to claim 1 or the protein variant according to claim 2. The polynucleotide according to claim 3 , wherein the polynucleotide sequence is shown in SEQ ID NO:

2.

5. An expression vector comprising the polynucleotide according to claim 3 or 4.

6. An engineered bacterium comprising the polynucleotide according to claim 3 or 4, or the expression vector according to claim 5.

7. The engineered bacterium according to claim 6, wherein the engineered bacterium is Escherichia coli.

8. Use of the protein according to claim 1 or the protein variant according to claim 2, or the polynucleotide according to claim 3 or 4, or the expression vector according to claim 5, or the engineered bacteria according to claim 6 or 7 in catalyzing the production of paridis saponin II and paridis saponin VII from paridis saponin III and sapogenin-3-O-β-chacotriosaccharide.

9. The use according to claim 8, wherein the use is to catalyze the C-4 sugar chain extension of Parisopsenoside III and Parinosapogenin-3-O-β-chacotriosaccharide.

10. Use of the protein according to claim 1 or the protein variant according to claim 2, or the polynucleotide according to claim 3 or 4, or the expression vector according to claim 5, or the engineered bacteria according to claim 6 or 7 in Paris polyphylla breeding.

Images