Transcription factor abhy5 for regulating the formation of colorful leaves of bromeliad aechmea'scarlett princess' and application thereof

By cloning and overexpressing the AbHY5 transcription factor of Pineapple 'Golden Edge', the lack of regulation of anthocyanin and photosynthetic pigment synthesis in plant leaves was solved, resulting in a significant promotion of colorful leaves and an improvement in photosynthetic efficiency, providing technical support for the beautification of foliage plants and the improvement of the ecological environment.

CN119876171BActive Publication Date: 2026-06-05SICHUAN AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SICHUAN AGRI UNIV
Filing Date
2023-10-23
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies rarely explore the synergistic competitive synthesis and accumulation regulation mechanism of anthocyanins and photosynthetic pigments in plant leaves, and there are few varieties of foliage plants with bright colors, which affects the beautification effect of urban ecological environment.

Method used

The light signal transcription factor AbHY5 of the golden-edged red-budded pineapple was cloned and verified. By overexpressing AbHY5 through transgenic technology, the synthesis of anthocyanins, chlorophyll, and carotenoids was promoted, and the photosynthetic efficiency and non-enzymatic ROS scavenging ability were improved.

Benefits of technology

It significantly promoted pigment synthesis in transgenic plants, improved photosynthetic rate and ROS balance, and provided a theoretical basis for breeding new varieties with colorful leaves.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876171B_ABST
    Figure CN119876171B_ABST
Patent Text Reader

Abstract

The application discloses a transcription factor AbHY5 for regulating the formation of colorful leaf color of Guzmania lingulata and application thereof. The application clones a light signal transcription factor AbHY5 from Guzmania lingulata, and the expression of the transcription factor has obvious tissue specificity and is specifically expressed in petals and red leaves. Research shows that the AbHY5 promoter responds to light induction, the expression level of AbHY5 significantly decreases under dark conditions, and the expression of AbHY5 has extremely significant positive correlation with the content of anthocyanin, flavonoids, sucrose and starch. Further research by transgenic technology shows that overexpression of AbHY5 significantly promotes the synthesis of pigments and flavonoids of the transgenic plant, the accumulation of endogenous sucrose and starch and the balance of ROS in the leaves, can increase the content of flavonoids, chlorophyll a, anthocyanin and carotenoids, and improve the photosynthetic rate of the plant leaves, thereby providing support for cultivating new Guzmania varieties with colorful leaves.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology. More specifically, it relates to a transcription factor, AbHY5, that regulates the formation of multicolored leaves in the golden-edged red-bracted bromeliad and its applications. Background Technology

[0002] The golden-edged red-bracted bromeliad (Ananas comosus var. bracteatus) has green and white striped leaves with golden edges. In spring and autumn, the white tissue along the leaf margins turns a vibrant red, creating a multicolored foliage display that is highly ornamental and economically valuable. Compared to flowering plants, foliage plants have a longer viewing period and a more significant ability to improve the urban ecological environment. However, compared to flowering plants, there are fewer varieties of brightly colored foliage plants. Therefore, researching and cultivating highly ornamental colorful foliage plants can provide strong support for the high-quality construction of urban living environments.

[0003] The golden-edged red-bracted pineapple (Pinus 'Golden Edge') boasts a rich variety of leaf colors, making it an excellent ornamental plant. The central green tissue of its leaves contains abundant chlorophyll and carotenoids, while anthocyanins constitute a very small proportion. The whitish periphery, formed by abnormal chloroplast development and inhibited chlorophyll synthesis, exhibits a "golden edge" trait. In spring and autumn, the epidermal cells of the whitish periphery accumulate large amounts of anthocyanins, turning the leaves red. The leaves of this plant can specifically synthesize and accumulate chlorophyll, carotenoids, and anthocyanins at different times and spaces, resulting in a variety of color types. The dynamic changes in color are the result of a synergistic competition between the accumulation of chlorophyll, carotenoids, and anthocyanins in time and space, making it an ideal material for studying the mechanism of synergistic competitive accumulation of pigments. Chlorophyll and carotenoids are important photosynthetic pigments in plants, possessing functions of light capture and photo-oxidative protection under high light conditions, while anthocyanins are important antioxidants and stress response signals in plants. The formation and changes in plant leaf color are determined by the changes in the content and relative proportions of these three pigments, and also represent an adaptation to environmental factors. In the chimeric leaves of the golden-edged red-bracted pineapple, the central green tissue and the peripheral white tissue exhibit different tissue structures and physiological characteristics, and their pigment distribution patterns are also distinctly different. The dynamic balance of the three major pigment classes is crucial for the growth, development, and phenotypic expression of leaves and plants. Therefore, identifying the common key regulatory factors upstream of the accumulation of the three major pigment metabolisms and exploring the functions of these key regulatory factors in regulating pigment synthesis and accumulation is of great significance for revealing the regulatory mechanism of pigment synthesis and accumulation and for the targeted breeding of new leaf color varieties.

[0004] The light signaling factor HY5 is central to plant signal transduction, and its regulatory function in the metabolic accumulation of the three major pigments has been extensively reported. However, these studies have mainly focused on fruits, and there are few reports on HY5 simultaneously regulating the synthesis of two or more pigments in plants. Since plant leaves accumulate less anthocyanin, research on the synergistic and competitive regulatory mechanisms of photosynthetic pigments and anthocyanins in leaf synthesis and accumulation is still rare. Summary of the Invention

[0005] This invention provides a transcription factor AbHY5 that regulates the formation of multicolored leaves in the golden-edged red-bracted pineapple and its application.

[0006] The purpose of this invention is to provide a transcription factor AbHY5 and its encoded protein that regulates the formation of multicolored leaves in the golden-edged red-bracted pineapple.

[0007] Another object of the present invention is to provide the application of the transcription factor AbHY5 or its expression promoters, or the encoded protein.

[0008] Another objective of this invention is to provide a recombinant expression vector and a genetically engineered bacterium.

[0009] Another objective of this invention is to provide a product that improves the photosynthetic efficiency of plants.

[0010] Another objective of this invention is to provide a method for promoting pigment synthesis in plant leaves or improving plant photosynthetic efficiency.

[0011] The above-mentioned objective of this invention is achieved through the following technical solution:

[0012] This invention provides the first clone of a light-signaling transcription factor, AbHY5, from the transcriptome data of *Pinus 'Aureomarginata' (Golden-edged Red-bracted Pineapple). Its nucleic acid sequence is shown in SEQ ID NO.1, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2. Studies show that AbHY5 expression exhibits significant tissue specificity, specifically expressed in petals and red leaves. Furthermore, the expression level of AbHY5 is significantly positively correlated with the content of anthocyanins, flavonoids, sucrose, and starch. In addition, this invention reveals the influence of pigment synthesis and accumulation on leaf color formation. The expression level of AbHY5 in both tissues of deep red leaves is significantly higher than that in non-red and light red leaves, and the expression level in the whitish edge tissue is significantly higher than that in the corresponding central green tissue, consistent with the finding that the anthocyanin content in the whitish edge tissue is significantly higher than that in the central green tissue. The promoter activity characteristics of AbHY5 were also analyzed, showing that the AbHY5 promoter responds to light induction, while the expression level of AbHY5 decreases significantly under dark conditions.

[0013] Meanwhile, the function of AbHY5 in regulating the synthesis of the three major pigment classes was verified through transgenic technology. Overexpression of AbHY5 not only reduced the yellowing of transgenic tobacco leaves, but also significantly promoted the synthesis rate of flavonoids in Nicotiana benthamiana, the accumulation of endogenous sucrose and starch, and increased the content of pigments such as flavonoids, chlorophyll a, anthocyanins, and carotenoids. It also enhanced the photosynthetic rate of tobacco leaves and the ability of the non-enzymatic system of transgenic tobacco to scavenge ROS, thereby promoting ROS balance within tobacco leaves. In summary, the results of this invention show that the light signaling transcription factor AbHY5 of Pineapple 'Golden Edge' can be used to regulate the synthesis of anthocyanins, chlorophyll, and carotenoids in Pineapple 'Golden Edge' leaves, providing support for elucidating the synergistic competition relationship and regulatory mechanism of the three major pigments in Pineapple 'Golden Edge', and providing a theoretical basis for breeding new leaf color varieties.

[0014] Therefore, the present invention provides the following applications of the transcription factor AbHY5 of the golden-edged red pineapple or its expression promoter, or the protein encoded therein:

[0015] Applications in promoting pigment synthesis in plant leaves and the expression of structural genes related to pigment synthesis.

[0016] Furthermore, the pigment synthesis-related structural genes are anthocyanin synthesis structural genes, preferably AbCHS, AbCHI, AbDFR, AbF3'5'H, etc.

[0017] Applications in improving plant photosynthetic efficiency.

[0018] Applications in promoting the synthesis of plant flavonoids or increasing the content of plant flavonoids.

[0019] Application in increasing the pigment, sucrose, and / or starch content of plant leaves.

[0020] Applications in enhancing the ability of non-enzymatic systems to scavenge ROS in plants or in promoting ROS balance in plant leaves.

[0021] Application in the cultivation of new plant varieties with multiple leaf colors.

[0022] Application in the construction of transgenic plants with altered leaf color.

[0023] Furthermore, the plants mentioned are golden-edged red-bracted pineapple and tobacco.

[0024] This invention provides a recombinant expression vector containing the above-mentioned transcription factor AbHY5.

[0025] This invention provides a genetically engineered bacterium containing the above-mentioned recombinant expression vector.

[0026] This invention also provides a product that enhances plant photosynthetic efficiency, containing an expression promoter for the transcription factor AbHY5, which regulates the formation of multicolored leaves in the golden-edged red-bracted pineapple.

[0027] This invention also provides a method for promoting pigment synthesis in plant leaves or improving plant photosynthetic efficiency, by transforming the above-mentioned recombinant vector or genetically engineered bacteria into plants, or by treating plants with an expression promoter of the transcription factor AbHY5 that regulates the formation of multicolored leaves in the golden-edged red-bracted pineapple.

[0028] Preferably, an AbHY5 plant overexpression vector is constructed and stably genetically transformed into plants.

[0029] The present invention has the following beneficial effects:

[0030] This invention marks the first cloning of the phototransmission factor AbHY5 in *Pinus 'Aureomarginata'*, a pineapple plant with golden variegation and red bracts. AbHY5 is associated with the formation of multicolored leaves in this plant and is specifically expressed in petals and red leaves. The study showed that the AbHY5 promoter responds to light induction, while its expression level significantly decreases under dark conditions. Furthermore, AbHY5 expression levels are significantly positively correlated with anthocyanin, flavonoid, sucrose, and starch content. Simultaneously, transgenic studies revealed that overexpression of AbHY5 significantly promotes the synthesis of pigments and flavonoids, the accumulation of endogenous sucrose and starch in transgenic plants, increases the content of pigments such as flavonoids, chlorophyll a, anthocyanins, and carotenoids, enhances the photosynthetic rate of tobacco leaves, and improves the non-enzymatic ROS scavenging ability of transgenic tobacco, thereby promoting ROS balance in tobacco leaves and increasing the photosynthetic rate of plant leaves. This provides support for the breeding of new multicolored pineapple varieties. Attached Figure Description

[0031] Figure 1 Phenotypic diagrams of different tissues of Phyllostachys nigra 'Red-bracted'.

[0032] Figure 2 The image shows the electrophoresis results of the full-length CDS amplified fragment of AbHY5 (Note: M: 2000 Maker, 1-6: AbHY5).

[0033] Figure 3 This is a diagram showing the subcellular localization of the AbHY5 protein.

[0034] Figure 4 The results of anthocyanin content (A) and AbHY5 expression level (B) in different tissues of the golden-edged red bract pineapple (RG is the green tissue in the center of the dark red leaf; RW is the white tissue at the edge of the dark red leaf; FL is the petal; BR is the bract; FR is the pulp).

[0035] Figure 5The graph shows the expression levels of AbHY5 and related genes in leaves of different color types (Ur represents non-red leaves, Cr represents dark red leaves, Lr represents light red leaves; CG represents central green tissue, MW represents peripheral white tissue, and so on).

[0036] Figure 6 For P AbHY5 GUS staining diagram of transiently converted tobacco.

[0037] Figure 7 P under dark processing AbHY5 Figure 1: GUS staining and activity analysis results of transiently transformed tobacco leaves (A: GUS staining analysis under darkness and hormone treatment, ABA is abscisic acid, GA3 is gibberellin; B: GUS enzyme activity analysis under darkness and hormone treatment).

[0038] Figure 8 Images of leaves of the golden-edged red-bracted bromeliad under different light treatments (A: 15 days of light; B: 15 days of darkness; C: 15 days of darkness followed by 15 days of light restoration).

[0039] Figure 9 The results of pigment content in leaves of the golden-edged red-bracted pineapple under dark treatment (A: chlorophyll content; B: carotenoid content; C: anthocyanin content).

[0040] Figure 10 The image shows the expression level of AbHY5 under dark conditions.

[0041] Figure 11 Electrophoresis results of AbHY5 overexpression vector construction (M: 5000 Maker; 1: plasmid after double enzyme digestion; 2: recombinant plasmid).

[0042] Figure 12 The image shows the identification results of transgenic tobacco (M: 2000Maker; a: negative control; b: standard plasmid positive control; 1, 3, 6: transgenic plants; 2, 4, 5, 7, 8: negative plants).

[0043] Figure 13 Phenotypic diagram of transgenic tobacco plants (left: wild-type plant CK, right: transgenic tobacco plant OE-AbHY5).

[0044] Figure 14 The graph shows the results of pigment content determination in genetically modified tobacco (A: chlorophyll content; B: carotenoid content; C: anthocyanin content; D: flavonoid content).

[0045] Figure 15 The graph shows the results of sugar content determination in genetically modified tobacco (A: fructose content; B: sucrose content; C: starch content).

[0046] Figure 16 The graph shows the results of photosynthetic index measurements in transgenic tobacco (A: net photosynthetic rate; B: stomatal conductance; C: intercellular CO2 concentration; D: transpiration rate).

[0047] Figure 17 The image shows the results of DAB staining (A) and H2O2 content detection in genetically modified tobacco (B).

[0048] Figure 18 The graph shows the expression levels of AbHY5 and pigment synthesis-related genes in transgenic tobacco (A: AbHY5; B: NbDVR; C: NbPSY; D: NbCHS; E: NbDFR; F: NbF3'H).

[0049] Figure 19 The graph shows the content of enzymes encoded by NbDVR(A), NbPSY(B), and NbCHS(C) in transgenic tobacco. Detailed Implementation

[0050] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0051] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0052] Seeds of Nicotiana benthamiana were purchased from Beijing Huayueyang Biotechnology Co., Ltd.; DH5α Escherichia coli competent cells were purchased from Beijing Qingke Biotechnology Co., Ltd.; GV3101 Agrobacterium competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; and the pCAMBIA-2300-eGFP vector was stored in our research group's -80℃ freezer. The quantitative PCR kit used was the SYBR Green Premix Pro Taq HS Qpcr Kit (Aikerui, Nanjing).

[0053] Nucleic acid sequence SEQ ID of light signaling transcription factor AbHY5 NO.1: ATGCAGGATCAAGGTACGAACTCACTTCCATCGAGCAGCGAGAGATCGTCGAGCTCGGCTCCTCAGATGGAAGTCAAAGAAGGAATGACGAGTGACGAGGAAATAGGAAGGGTGCCGG AGCTTGGGCCGTCGGAGGTAGGCGGGCCGTCGACGTCGGGCCGGGATGGTGGGCCGGCTGCTGGGCCGTCCGGCCAGGCCGGGGCCCAGCGTAGGCAGCGCTCCGGGAGGAGCTCCGCCGACAA AGAACACAAGCGGCTCAAAAGGTTGCTGAGGAATCGGGTGTCGGCGCAGCAGGCGAGGGAGAGGAAGAAGGCGTATCTGAACGAGTTGGAGGCCAGAGTGAAGGAGTTGGAGACCAAGAACTCC GAGCTGGAGGAGAGGGTCTCCACCTTGCAGAATGAGAACCAGATGCTCAGACAAATACTGAAGAATACGACAGTTAGCAGAAGAGGATCAAGTAGCAGTGCCAATGTTGGAGAAGGTCCATAG;

[0054] The amino acid sequence of the protein encoded by AbHY5 is SEQ ID NO.2: MQDQGTNSLPSSSERSSSSAPQMEVKEGMTSDEEIGRVPELGPSEVGGPSTSGRDGGPAAGPSGQAGAQRRQRSGRSSADKEHKRLKRLLRNRVSAQQARERKKAYLNELEARVKELETKNSELEERVSTLQNENQMLRQILKNTTVSRRGSSSSANVGEGP.

[0055] Example 1: Phenotypic Differences and Patterns of Different Color Types of Golden-edged Red-bracted Pineapple

[0056] Anthocyanins typically appear red in plants, while chlorophyll and carotenoids usually appear green and orange-yellow. The content and ratio of various pigments directly affect leaf color. To understand the phenotypic differences and patterns of different leaf color types (dark red leaves, non-red leaves, and light red leaves) in *Pinus 'Golden Edge'*, this example studies and analyzes the different color traits of *Pinus 'Golden Edge'*, detecting the content of pigments, sugars, and flavonoids in the leaf tissues of different colors.

[0057] The results showed that in leaves of different colors, chlorophyll was the dominant pigment in the central green tissue, accounting for 79.4%-80.9%, carotenoids accounted for 11.3%-15.9%, and anthocyanins accounted for only 4%-9%. In the peripheral albinism tissue, anthocyanins were the dominant pigment, accounting for 53.5%-92.4%, chlorophyll accounted for 5%-27%, and carotenoids accounted for 2.9%-19.5%. Dark red leaves had the highest content of the three major pigment categories. The chlorophyll content in the central green tissue was more than 1.4 times that of non-red leaves, the carotenoid content was about 1.3 times that of non-red leaves, and the anthocyanin content was about 6 times that of non-red leaves. Chlorophyll a and chlorophyll b together accounted for 80% of the total content of the three pigment categories, masking the color of carotenoids and anthocyanins, making the leaves appear green. The chlorophyll and carotenoid content in the leucoplasmic tissue at the edge of dark red leaves is lower than that in non-red and light red leaves. The anthocyanin content is the highest, at 0.32 mg / g, accounting for 92.4% of the total three pigments in the leucoplasmic tissue at the edge, which makes the leaves appear red.

[0058] Meanwhile, the deep red leaves had the highest content of sugars and flavonoids. The sucrose content in the white tissue at the leaf margin increased significantly with the deepening of red color, and was significantly higher than that in the central green tissue. Moreover, the flavonoid content in the central green tissue was significantly lower than that in the white tissue at the margin, which is consistent with the accumulation of anthocyanins.

[0059] Example 2: Cloning and Expression Analysis of AbHY5

[0060] 1. Cloning and identification of AbHY5

[0061] The plant material used in the experiment, *Pinus 'Golden Edge Red Bract'*, was introduced from Zhanjiang, Guangdong, and cultivated in a greenhouse at the Chengdu campus of Sichuan Agricultural University, where it was regularly watered and fertilized. Deep red leaves, pulp, bracts, and petals of *Pinus 'Golden Edge Red Bract'* were cut. Figure 1 The samples were flash-frozen at -80℃ and stored for tissue-specific gene expression assays. RNA was extracted from different tissue samples of *Pinus sylvestris 'Golden Edge'* and reverse transcribed into cDNA, followed by PCR amplification and gel electrophoresis detection. The amplified cDNA was obtained as shown in the image. Figure 2 The band shown is approximately 500 bp long, clearly defined, with no nonspecific amplification, and similar in length to the reference sequence. The amplification results were then sequenced and assembled on DNAMAN, yielding a 489 bp sequence, the nucleotide sequence of which is shown in SEQ ID NO:1. This sequence was imported into the NCBI website for Nucleotide BLAST search and alignment. The alignment analysis showed that this sequence had 94% homology with pineapple AcHY5, and it was named AbHY5.

[0062] 2. Protein sequence analysis of AbHY5

[0063] Analysis using NCBI's ORF Finder and Expasy online tools revealed that AbHY5 encodes 162 amino acids, with serine being the most abundant at 24 residues (14.8%). There are 22 negatively charged amino acid residues and 27 positively charged amino acid residues. The AbHY5 protein has a total of 2441 atoms, and its predicted molecular formula is: C 719 H 1214 N 246 O 258 S4 has a molecular weight of 1.76 kDa and a theoretical isoelectric point (PI) of 9.80. Its protein instability index is calculated to be 67.13, indicating that AbHY5 is an unstable protein. The overall average hydrophilicity of the protein is -0.6733, classifying it as a hydrophilic protein. The amino acid sequence of AbHY5 is shown in SEQ ID NO:2.

[0064] 3. Subcellular localization analysis of AbHY5 protein

[0065] To understand the localization of the AbHY5 transcription factor in the cells of *Pinus roxburghii* 'Golden Edge', an Agrobacterium-mediated transient transformation experiment of *Tobacco Benzoinus* leaves was conducted. Leaves infected for 48 hours were cut, and temporary water slides were prepared. The distribution of fluorescence signals in the tobacco leaves was observed under a laser confocal microscope to determine the site where AbHY5 functions.

[0066] The measurement results are as follows Figure 3 As shown, the AbHY5 protein with a green fluorescent label is distributed in the cell nucleus, overlapping with the red fluorescence of the nuclear localization marker, while the control's fluorescence signal is distributed throughout the cell. This indicates that the AbHY5 protein is localized in the cell nucleus to further perform its function.

[0067] 4. Analysis of the expression patterns of AbHY5 and related genes

[0068] Expression in different tissues: Using the central green and marginal whitening tissues of red leaves, petals, bracts, and fruits of *Pinus 'Golden Edge'* as materials, the expression level of the AbHY5 gene in different tissues of *Pinus 'Golden Edge'* was studied using qRT-PCR technology to understand its tissue specificity. The specific methods were as follows:

[0069] RNA was extracted from different tissue samples using a kit and reverse transcribed into cDNA. AbHY5 primers (F: CTCCACCTTGCAGAATGAGAACCAG, R: AC ATTGGCACTGCTACTTGATCCTC) were designed and synthesized according to SEQ ID NO:1. The housekeeping gene Unigene16454 of *Pinus rubrum* was used as an internal reference gene (F: TCTCACGCCCTCTTTCTTCCA, R: GCTCTAACTCGCCACGCCT TT). Using cDNA from different tissues as templates, the fluorescence quantitative PCR components were added according to the system shown in Table 1 under light-protected conditions. After addition, the mixture was gently aspirated and mixed. Three technical replicates were set up for each biological replicate. Detection was then performed according to the procedure shown in Table 2. Finally, 2... –ΔΔCT The relative expression level of AbHY5 in different tissues of Phyllostachys nigra was calculated.

[0070] Table 1. Detection system for quantitative real-time PCR

[0071]

[0072] Table 2. Detection Procedure for Quantitative Real-Time PCR

[0073]

[0074] Test results as follows Figure 4 As shown, compared with the central green tissue, the expression level of AbHY5 in the peripheral albinism tissue was significantly higher than that in the central green tissue, being twice the expression level, which is consistent with the result that the anthocyanin content in the peripheral albinism tissue was significantly higher than that in the central green tissue. Figure 4 A). AbHY5 was highly expressed in petals, at levels approximately 15 times higher than in the central chlorotic tissue of leaves. Figure 4 (B) This is consistent with the finding that petals have the highest anthocyanin content. AbHY5 is hardly expressed in bracts and fruits, indicating that AbHY5 expression has significant tissue specificity, specifically expressed in petals and red leaves. Furthermore, while red bracts have a high anthocyanin content, AbHY5 expression levels are low in bracts, inconsistent with anthocyanin content, suggesting that bracts may have a different anthocyanin synthesis and accumulation regulatory mechanism than petals and leaves.

[0075] Expression of different leaf color types: Using leaves of three color types (deep red, non-red, and light red) from the golden-edged red-bracted pineapple as materials, the expression of the central green tissue and the edge white tissue of the leaves was detected. The expression of AbHY5 and pigment synthesis-related structural genes was studied using qRT-PCR technology. The pigment synthesis-related structural genes were anthocyanin synthesis structural genes such as AbCHS, AbCHI, AbDFR, and AbF3'5'H. The gene sequences used are shown in Table 3 below. The qRT-PCR detection method was the same as above.

[0076] Table 3 Sequences of structural genes related to pigment synthesis

[0077]

[0078] The results are as follows Figure 5 As shown, the expression level of AbHY5 in the marginal albinism tissue was significantly higher than that in the green tissue. The expression level of AbHY5 in both tissues of dark red leaves was significantly higher than that in non-red and light red leaves, and the expression level in the marginal albinism tissue was significantly higher than that in the corresponding central green tissue. The expression levels of anthocyanin synthesis structural genes such as AbCHS, AbCHI, and AbDFR were relatively low and showed no significant changes in the central green tissue of the three leaf types, but significantly increased with deepening redness in the marginal albinism tissue, especially AbCHS and AbDFR, whose expression levels were 3 and 4 times higher than those in non-red leaves, respectively. The expression level of AbF3'5'H was highest in non-red leaves, and decreased with deepening redness.

[0079] 5. Correlation analysis

[0080] Further Pearson correlation analysis was performed on the gene expression levels and physiological indicators using IBM SPSS Statistics 27 software. The results are shown in Table 4. In the central green tissue, the expression level of AbHY5 was significantly positively correlated with the content of chlorophyll and anthocyanins, and significantly positively correlated with the content of carotenoids. In the peripheral albinism tissue, the expression level of AbHY5 was significantly positively correlated with the content of anthocyanins, flavonoids, sucrose, and starch. Simultaneously, the content of sucrose and starch was also significantly positively correlated with the content of anthocyanins and flavonoids. The expression level of AbHY5 was negatively correlated with the content of chlorophyll and carotenoids, but not significantly, and was significantly positively correlated with the expression levels of the anthocyanin synthesis structural genes AbCHS and AbDFR.

[0081] Table 4. Pearson correlation analysis of different detection indicators for leaves of different color types.

[0082]

[0083] Note: Tables with a green background show the correlation coefficients of various indicators in the central green tissue of the leaf, while tables with a yellow background show the correlation coefficients of various indicators in the leaf margin whitish tissue. * indicates a significant correlation at the 0.05 level, and ** indicates a highly significant correlation at the 0.01 level. Flavonoids, Cane: sucrose.

[0084] Example 3: Analysis of the response conditions of the AbHY5 gene and its promoter

[0085] 1. Identification of plant expression vectors for promoters

[0086] The extracted PBI121 vector plasmid was double-digested with restriction endonucleases Xba I and BamHI, and then ligated with the purified product containing the restriction sites of the promoter for recombination. Single colonies of 3 mm were picked and identified as positive clones by PCR. The positive bacterial cultures were sent to Sangon Biotech for sequencing. The clones were found to be the same size as the target fragment, and PBI121 was obtained. AbHY5 -gus recombinant vector plasmid.

[0087] 2. P AbHY5 GUS tissue staining analysis of -gus transiently converted tobacco

[0088] pBI121 empty plasmid and P AbHY5 The -gus recombinant plasmid was transformed into Agrobacterium GV3101. Different tissues of tobacco, including roots, stems, and leaves, were transiently transformed using a vacuum permeation method. After 48 hours of culture, GUS histochemical staining was performed.

[0089] Staining results as follows Figure 6 As shown, the negative control CK did not stain blue, while the positive control 35S::GUS and the experimental group P... AbHY5::GUS The sample was stained blue, with the positive control showing the deepest blue. GUS enzyme activity assays revealed that the negative control (CK) had almost no activity, while the positive control (35S::GUS) showed significantly higher GUS activity than the experimental group, consistent with the staining results. These results indicate that endogenous GUS activity in tobacco did not interfere with the experimental results. P AbHY5::GUS It can drive the expression of the GUS reporter gene and has promoter-initiating transcriptional activity. The similar blue staining of tobacco root, stem, and leaf tissues indicates that P... AbHY5::GUS The promoter did not show significant tissue specificity in the three tissues of tobacco: root, stem, and leaf.

[0090] 3. P under dark conditions AbHY5 GUS activity analysis of transiently converted tobacco

[0091] Previous predictions of the main cis-acting elements of the AbHY5 promoter showed that the AbHY5 promoter has a light-responsive element G-box, an abscisic acid-responsive element ABRE, and a gibberellin-responsive element P-box. Deep red leaves of *Pinus 'Golden Edge'* were selected as the plant material for dark treatment, while non-red leaves were selected as the plant material for hormone treatment. Tobacco leaves with transient expression were subjected to 48 hours of dark treatment, and GUS enzyme activity was measured. After 15 days of dark treatment, light was restored for another 15 days, and the changes in pigmentation in *Pinus 'Golden Edge'* leaves under dark conditions were analyzed.

[0092] The results are as follows Figure 7 As shown, the instantaneous transformation P without any processing AbHY5 Compared to tobacco leaves, the blue color of the dark-treated leaves is lighter. Figure 7 A), GUS enzyme activity was also significantly reduced ( Figure 7 B) indicates that the AbHY5 promoter responds to light induction, and darkness inhibits its activity. Abscisic acid (ABA) treatment resulted in a deeper blue stain, and significantly increased GUS protease activity, approaching that of the positive control 35S::GUS, suggesting that ABA can positively regulate the activity of the AbHY5 promoter. Gibberellin (GA3) treatment showed almost no blue staining, with only weak expression of GUS protein in a few locations, and significantly decreased GUS protease activity, indicating that gibberellin can negatively regulate the activity of the AbHY5 promoter.

[0093] 4. Analysis of AbHY5 gene expression in darkness

[0094] Given P AbHY5::GUS The activity of GUS in transiently converted tobacco changed significantly under dark conditions. We shaded the leaves of variegated red bract pineapple to investigate whether shading would affect leaf color and AbHY5 gene expression.

[0095] After treating the leaf growth of *Pinus 'Golden Edge'* with different light conditions, the results are as follows: Figure 8 As shown, compared to illumination processing ( Figure 8 A) After 15 days of dark treatment, the leaves of the golden-edged red-bracted pineapple showed obvious curling, and the central green tissue turned yellow. Figure 8 B); Further testing of pigment content in the leaves of the golden-edged red-bracted pineapple under darkness yielded the following results. Figure 9 As shown, the chlorophyll content decreased significantly by 70%. Figure 9 A), carotenoids decreased significantly by 22% ( Figure 9 B), the anthocyanin content did not change significantly. Figure 9 C). The red color of the leukoplakia at the edges faded, and the anthocyanin content decreased significantly by 71%, while the chlorophyll and carotenoid contents showed no significant changes. After 15 days of darkness followed by 15 days of restored light, the leaf color changed significantly. Figure 8C). The chlorophyll content in the central green tissue increased significantly by 50%, but was still much lower than before the dark treatment; the carotenoid and anthocyanin contents did not change significantly. The marginal leucoplasm showed signs of re-reddening, but the red was lighter compared to the leaves before the dark treatment. The anthocyanin content increased significantly, but was still lower than before the dark treatment; the chlorophyll and carotenoid contents did not change significantly.

[0096] This indicates that pigment synthesis in the leaves of the golden-edged red-bracted pineapple depends on light. Dark treatment significantly inhibits pigment synthesis, leading to changes in leaf color. After the restoration of light, pigment accumulation increases, but remains below the pigment levels observed under normal light conditions.

[0097] In addition, the results of AbHY5 gene expression analysis under darkness are as follows: Figure 10 As shown, in *Pinus 'Aureomarginata'*, after 15 days of darkness treatment, the expression level of AbHY5 in the central green tissue decreased, but not significantly; after 15 days of restored light, the expression level of AbHY5 significantly increased, reaching the level before darkness treatment. After 15 days of darkness treatment, the expression level of AbHY5 in the peripheral whitened tissue decreased significantly by 90%; after 15 days of restored light, the expression level of AbHY5 significantly increased, but remained lower than the level before darkness treatment. These results indicate that AbHY5 responds to light, and its expression level significantly decreases under darkness conditions.

[0098] Example 4: AbHY5 gene overexpression transgenic material

[0099] The analysis of AbHY5 expression patterns in leaves revealed a close relationship between AbHY5 expression and physiological indicators such as leaf color changes, suggesting its potential involvement in pigment synthesis and accumulation. To further investigate the function of AbHY5 in regulating pigments, we constructed an AbHY5 plant expression vector and stably genetically transformed it into *Nicotiana benthamiana*. Analysis of the physiological and biochemical indicators and gene expression levels of the transgenic plants explored its function in regulating pigment synthesis and accumulation and determining leaf color formation, providing theoretical support for studying the cooperative and competitive accumulation of pigments in *Pinus 'Golden Edge'*.

[0100] 1. Identification of the pCAMBIA2300-AbHY5-eGFP plant expression vector

[0101] The CDS sequence of the AbHY5 gene with the stop codon removed was constructed into the vector pCAMBIA-2300-eGFP. The vector plasmid was digested with enzymes, followed by gel electrophoresis. The linearized vector and the target gene were recombinantly ligated using T4 ligase. The recombinant plasmid was transformed into DH5α competent E. coli cells and cultured overnight. Positive clones were identified, and the cells were expanded in liquid culture before being sent to the company for sequencing.

[0102] The obtained sequencing results were compared and analyzed, and the results are as follows: Figure 11 As shown, the recombinant plasmid was correctly constructed and the overexpression vector plasmid of AbHY5 was successfully obtained. It was named pCAMBIA2300-AbHY5-eGFP and used for subsequent genetic transformation experiments.

[0103] 2. Identification of Agrobacterium-mediated transformation by overexpression vector

[0104] The recombinant overexpression vector pCAMBIA2300-AbHY5-eGFP plasmid was transformed into Agrobacterium GV3101 competent cells using a freeze-thaw method. After colonies grew at 28°C, single clones were selected for propagation. Specific primers containing the vector and target gene sequences were designed for colony PCR to screen for positive clones. The results showed that the recombinant plasmid containing the AbHY5 gene was successfully inserted into Agrobacterium GV3101 competent cells.

[0105] 3. Identification of genetically modified tobacco

[0106] The obtained pCAMBIA2300-AbHY5-eGFP positive bacterial culture was genetically transformed into Nicotiana benthamiana using the leaf disc method. After callus induction and shoot induction, the transformed plants that survived and rooted on the selection medium were tested. DNA was extracted from leaves of wild-type plants and transformed plants. Primers were designed using the GFP tag specific to the vector plasmid, and PCR-positive seedlings were identified using the vector plasmid as a positive control.

[0107] Gel electrophoresis results as follows Figure 12 As shown, among the 8 randomly selected seedlings, 3 had PCR amplification products with bands of the same length as the positive control, while the negative control had no band. This indicates that plants 1, 3, and 6 of these 8 tobacco plants are transgenic positive plants and will be used for subsequent experiments.

[0108] Example 5: Functional study of the AbHY5 gene

[0109] 1. Phenotypic and Pigment Content Analysis of Genetically Modified Tobacco

[0110] Analysis of the transgenic positive plants obtained above revealed, through visual observation, that... Figure 13 As shown in the right figure, the transgenic plants grew vigorously, and their leaves were darker than those of the wild-type plants. The chromaticity values ​​of the leaves of the negative-type plants and the transgenic plants were measured using a colorimeter. The results are shown in Table 5. The L* value of the transgenic tobacco leaves was significantly lower, indicating a decrease in leaf brightness. While the a* value showed no significant change, the b* value decreased significantly, indicating that the yellowing of the transgenic tobacco leaves lessened with the decrease in L* value.

[0111] Table 5. Color value analysis of transgenic tobacco leaves

[0112]

[0113] To understand the reasons for the changes in leaf color values ​​in transgenic plants, we measured the pigment and flavonoid content of tobacco leaves. The results are as follows: Figure 14 As shown, the chlorophyll a of the transgenic plant ( Figure 14 A) Carotenoids ( Figure 14 B), anthocyanins ( Figure 14 C) and flavonoids Figure 14 D) The contents of all pigments increased significantly, while the chlorophyll b content showed no significant difference. Chlorophyll accounts for approximately 83% of the total content of the three types of pigments, making it the dominant pigment in leaves. The significant increase in chlorophyll a content is the main reason for the significant decrease in L* and b* values, leading to a reduction in leaf brightness. The transgenic plants had the highest carotenoid content, reaching 0.12 mg / g, significantly lower than the chlorophyll content. The flavonoid content showed the largest increase, reaching approximately 3.4 mg / g, indicating that AbHY5 significantly promoted the flavonoid synthesis rate in Nicotiana benthamiana. However, the anthocyanin content was extremely low and did not increase significantly despite the high flavonoid content, indicating that the anthocyanin synthesis pathway was not fully activated, and more flavonoids flowed to other downstream branches.

[0114] 2. Analysis of carbohydrate content in genetically modified tobacco

[0115] Carbohydrates provide the carbon skeleton for the biosynthesis of flavonoids and are also important basic substances for glycosylation modification. To investigate the effects of AbHY5 on carbohydrate metabolism, we measured the contents of sucrose, fructose, and starch in transgenic plants.

[0116] The results are as follows Figure 15 As shown, the fructose content of the transgenic plants was significantly reduced ( Figure 15 A), while the content of sucrose and starch increased significantly ( Figure 15 (B and C) showed the largest increase in starch content, indicating that AbHY5 can significantly promote the accumulation of endogenous sucrose and starch in tobacco leaves.

[0117] 3. Analysis of photosynthetic indicators in genetically modified tobacco

[0118] Given the significant increase in photosynthetic pigments and sugars in transgenic tobacco, we speculated whether AbHY5 had an impact on tobacco photosynthesis. We used a portable photosynthesis meter to measure the photosynthetic indicators of transgenic plants and shade-negative plants.

[0119] The results are as follows Figure 16 As shown, compared with the negative-affected plants, the net photosynthetic rate of transgenic tobacco leaves increased from 12.94 μmol CO2 m -2 s-1 Significantly increased to 16.85 μmol CO2 m -2 s -1 ( Figure 16 A) Pore conductance from 0.15H2O m -2 s -1 Significantly increased to 0.28 mol H2O m -2 s -1 ( Figure 16 B) The intercellular CO2 concentration decreased from 235.76 μmol CO2 mol -1 Significantly increased to 259.96 μmol CO2 mol -1 ( Figure 16 C) The transpiration rate decreased from 2.07 mmol H2O m -2 s -1 Significantly increased to 2.95 mmol H2O m -2 s -1 ( Figure 16 D).

[0120] The above results indicate that several indicators of photosynthesis interact and promote each other. The significantly increased stomatal conductance in transgenic tobacco enhanced the leaves' ability to absorb water and CO2, leading to a significant increase in intercellular CO2 concentration, but without exceeding the photosynthetic capacity of the leaves. This provided more abundant substrate for energy conversion in photosynthesis, significantly increasing the photosynthetic rate and resulting in the production of more sugars and other energy substances in the leaves. Furthermore, chlorophyll, an important light-harvesting pigment, can absorb and transfer light energy, thus promoting energy conversion during photosynthesis. The significantly increased chlorophyll content in transgenic tobacco promoted the photosynthetic rate of the leaves. The significantly increased photosynthetic rate led to the generation of more heat within the plant, and the increased stomatal conductance significantly increased the transpiration rate, which in turn promoted photosynthetic efficiency. When the intercellular CO2 concentration is too high, it causes rapid stomatal closure, affecting the plant's photosynthetic rate. Therefore, overexpression of AbHY5 reasonably increased the photosynthetic rate of tobacco leaves.

[0121] 4. Oxidative stress analysis of genetically modified tobacco

[0122] Non-enzymatic components such as carotenoids, flavonoids, and phenolic substances have the function of scavenging ROS. To investigate the effect of AbHY5 overexpression on ROS balance in tobacco plants, we measured the hydrogen peroxide content in transgenic tobacco leaves and prepared 3,3'-diaminobenzidine tetrahydrochloride (DAB) solution to stain the transgenic tobacco leaves with DAB. The darker the staining, the higher the peroxide content in the leaves.

[0123] The results are as follows Figure 17As shown, compared with negative plants, tobacco leaves overexpressing AbHY5 showed lighter staining ( Figure 17 A), the hydrogen peroxide content also decreased significantly ( Figure 17 B) indicates that overexpression of AbHY5 significantly increases the content of flavonoids and carotenoids, thereby enhancing the ability of the non-enzymatic system in transgenic tobacco to scavenge ROS and thus promoting ROS balance in tobacco leaves.

[0124] 5. Analysis of AbHY5 and related gene expression in transgenic tobacco

[0125] To investigate the underlying mechanism by which overexpression of AbHY5 affects the physiological metabolism of transgenic tobacco, we extracted RNA from leaves of transgenic tobacco plants and negative control plants, reverse transcribed it into cDNA, and then performed RT-qPCR detection. The results are as follows: Figure 18 As shown, AbHY5 expression was not detected in wild-type tobacco plants, and the highest expression level of AbHY5 was observed in the transgenic tobacco OE2 line. Figure 18 A).

[0126] Given the significant increase in pigment and flavonoid content in transgenic tobacco, to investigate whether the overexpression of AbHY5 affected the expression levels of related structural genes in the pigment synthesis pathway, and also to explore potential downstream target genes of AbHY5, we performed RT-qPCR detection on the following genes involved in pigment synthesis in transgenic plants: chlorophyll synthesis-related structural gene NbDVR, carotenoid synthesis-related structural gene NbPSY, anthocyanin synthesis-related structural genes NbCHS and NbF3'H.

[0127] The results are as follows Figure 18 As shown in Figure BF, the expression levels of chlorophyll synthesis-related structural genes NbDVR, carotenoid synthesis-related structural genes NbPSY, anthocyanin synthesis-related structural genes NbCHS, and NbF3'H were all significantly increased, reaching a maximum increase of 2-fold, 2.5-fold, 32-fold, and 3.8-fold, respectively, compared to negative-negative plants. The expression level of NbCHS showed the highest increase, consistent with the finding that the transgenic plant leaves showed the greatest increase in flavonoid content. This indicates that AbHY5 significantly promotes the expression levels of pigment synthesis-related genes, affecting the synthesis and accumulation of pigments in leaves.

[0128] 6. Analysis of enzyme content encoded by genes related to pigment synthesis in transgenic tobacco

[0129] Given the significant changes in the expression levels of pigment synthesis-related genes in transgenic tobacco, we determined whether there were any changes in the content of the enzymes encoded by these genes in the transgenic plants.

[0130] The results are as follows Figure 19As shown, overexpression of AbHY5 significantly increased the expression level and encoding enzyme content of NbDVR in tobacco, indicating that AbHY5 can promote chlorophyll synthesis by affecting the expression of the NbDVR gene. Figure 19 A). PSY is considered a key rate-limiting enzyme in the carotenoid synthesis pathway. Overexpression of AbHY5 significantly increased the expression level of NbPSY in tobacco and the content of its encoded enzyme, indicating that AbHY5 can affect the expression of NbPSY in tobacco and promote carotenoid synthesis. Figure 19 B). Overexpression of AbHY5 significantly increased the expression level of NbCHS in tobacco and the content of its encoded enzyme, indicating that AbHY5 can promote significant NbCHS expression and thus promote the synthesis of tobacco flavonoids and anthocyanins. Figure 19 C).

[0131] In summary, based on transcriptome data, this invention cloned a light signal transcription factor, AbHY5, for the first time in *Pinus 'Golden Edge'*. Analysis of the pigment synthesis and accumulation patterns in the central green tissue and the whitened peripheral tissue of *Pinus 'Golden Edge'* leaves, along with the expression characteristics of AbHY5, showed that AbHY5 expression exhibits significant tissue specificity, specifically expressed in petals and red leaves. Furthermore, the expression level of AbHY5 showed a highly significant positive correlation with the content of anthocyanins, flavonoids, sucrose, and starch.

[0132] Furthermore, this invention reveals the influence of pigment synthesis and accumulation on leaf color formation. The expression level of AbHY5 in both tissues of deep red leaves was significantly higher than in non-red and light red leaves, and its expression level in the marginal whitening tissue was significantly higher than in the corresponding central green tissue. The promoter activity characteristics of AbHY5 were also analyzed; the AbHY5 promoter responds to light induction, while its expression level significantly decreases under dark conditions. Simultaneously, the function of AbHY5 in regulating the synthesis of the three major pigment classes was verified through transgenic studies. The results show that overexpression of AbHY5 not only reduces the yellowing of transgenic tobacco leaves but also significantly promotes the synthesis rate of flavonoids, the accumulation of endogenous sucrose and starch in transgenic plants, and increases the content of pigments such as flavonoids, chlorophyll a, anthocyanins, and carotenoids. This enhances the photosynthetic rate of tobacco leaves and the ability of the non-enzymatic system to scavenge ROS in transgenic tobacco, thereby promoting ROS balance within tobacco leaves. This indicates that the AbHY5 gene can also serve as a candidate gene for molecular breeding of pineapple resistance to improve its stress resistance. This invention explores the mechanism by which AbHY5 regulates the synthesis and accumulation of three major pigments, which will provide support for elucidating the synergistic competition relationship and regulatory mechanism of the three major pigments in golden-edged red-bracted pineapple, and provide a theoretical basis for cultivating new leaf color varieties.

[0133] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A transcription factor regulating the formation of multicolored leaves in the golden-edged red-bracted bromeliad. AbHY5 Its characteristics are, Its nucleic acid sequence is shown in SEQ ID NO.

1.

2. The transcription factor of claim 1 AbHY5 The encoded protein , Its features are, Its amino acid sequence is shown in SEQ ID NO.

2.

3. The transcription factor of claim 1 AbHY5 The application of its expression promoter or the protein encoded by claim 2 in promoting pigment synthesis in plant leaves, characterized in that... The expression promoter is AbHY5 Plant overexpression vector; the plants are variegated red-bracted pineapple and tobacco.

4. The transcription factor of claim 1 AbHY5 The application of its expression promoter or the protein encoded by claim 2 in enhancing plant photosynthetic efficiency, characterized in that... The expression promoter is AbHY5 Plant overexpression vector; the plants are variegated red-bracted pineapple and tobacco.

5. The transcription factor of claim 1 AbHY5 The application of its expression promoter or the protein encoded by claim 2 in promoting the synthesis of plant flavonoids, or in increasing the content of plant flavonoids, is characterized in that... The expression promoter is AbHY5 Plant overexpression vector; the plants are variegated red-bracted pineapple and tobacco.

6. The transcription factor of claim 1 AbHY5 The application of its expression promoter or the protein encoded by claim 2 in the cultivation of new multi-leafed varieties of plants, characterized in that, The expression promoter is AbHY5 Plant overexpression vector; the plants are variegated red-bracted pineapple and tobacco.

7. A recombinant expression vector, characterized in that, Contains the transcription factor of claim 1 AbHY5 .

8. A genetically engineered bacterium, characterized in that, It contains the recombinant expression vector as described in claim 7.

9. A product for improving plant photosynthetic efficiency, characterized in that, Contains the transcription factor of claim 1 AbHY5 The expression promoter is... AbHY5 Plant overexpression vector; the plants are variegated red-bracted pineapple and tobacco.

10. A method for promoting pigment synthesis in plant leaves or enhancing photosynthetic efficiency in plants, characterized in that, Transform the recombinant expression vector of claim 7 or the genetically engineered bacteria of claim 8 into plants, or use transcription factors that regulate the formation of multicolored leaves in golden-edged red-bracted pineapples. AbHY5 The expression promoter is used to treat plants; the expression promoter is... AbHY5 Plant overexpression vector; the plants are variegated red-bracted pineapple and tobacco.