Rice grain weight and zinc content synergistic regulation gene gz and application thereof
By cloning and overexpressing the rice grain weight and zinc content co-regulating gene GZ, the problem of increasing rice grain weight and zinc content has been solved, enabling the cultivation of high-yield and high-quality rice, solving the problem of nutritional imbalance, and promoting food security and health protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHINA NAT RICE RES INST
- Filing Date
- 2025-01-28
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies cannot simultaneously increase rice grain weight and zinc content, resulting in a sacrifice of biomass when increasing nutrient content, thus failing to effectively solve the problem of "hidden hunger".
The gene GZ, which co-regulates rice grain weight and zinc content, was cloned and utilized. Through genetic engineering, this gene was overexpressed or mutated in rice to enhance the function of zinc-dependent metalloenzyme proteins, thereby increasing grain weight and zinc content.
This has led to a synergistic increase in rice grain weight and zinc content, resulting in the cultivation of high-yield and nutrient-rich rice varieties. It has also solved the problem of "hidden hunger" caused by nutritional imbalances and promoted the healthy and sustainable development of grain production.
Smart Images

Figure CN119876191B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically involving the gene GZ that synergistically regulates rice grain weight and zinc content and its application. Background Technology
[0002] A segment of the global population faces the threat of "hidden hunger," meaning that while people are well-fed, they suffer from various deficiencies due to nutritional imbalances, such as stunted growth and weakened immunity caused by zinc or iron deficiency. Rice, as a staple food, primarily provides most of the required calories through carbohydrates, but its content of essential micronutrients like zinc and iron is low, failing to meet comprehensive nutritional needs. Biofortification of rice by regulating plant absorption and transport processes can increase the content of essential micronutrients like zinc and iron, thereby enriching these nutrients in the grain. Overexpression of ZRT and IRT-like protein 9 (OsZIP9) significantly increases zinc content in brown rice and other tissues. Overexpression of OsIRT1, which encodes the ferrous ion transporter, simultaneously increases both zinc and iron content in the grain. The synthesis of nicotinamide (NA), a metal ion chelator that helps maintain metal homeostasis, plays a crucial role in increasing mineral content; overexpression of NA synthase increases iron and zinc content in brown rice. Furthermore, the rice NA aminotransferase mutant naat1 enhances Fe(II) absorption by blocking the biosynthesis of xylan-based siderophores, leading to increased iron content in both brown and polished rice. However, improving the nutritional level of rice often comes at the cost of biomass; therefore, balancing grain nutrition and weight is an effective strategy for developing high-yielding, nutrient-rich rice varieties. Grain weight is a key factor affecting yield, mainly determined by grain width, length, and thickness. GS3 encodes the γ subunit of a G protein, which negatively regulates grain length and thousand-grain weight. The qGL3.3 / qTGW3 gene, encoding a glycogen synthase kinase 3-like protein kinase, also negatively regulates these traits. RING-type E3 ubiquitin ligases encoded by GW2, WLG, and CLG1 regulate rice grain size / weight. In addition, high-yielding and high-quality rice varieties can be bred by combining quantitative trait loci / genes such as gw8 and GW7TFA with gs3. Currently, there are few reports on how to simultaneously control essential micronutrients and grain weight, and how to easily obtain energy and nutrients at the same time remains a major challenge.
[0003] Rice (Oryza sativa) is the staple food source for a large portion of the world's population, and its importance is self-evident. To address the widespread problem of "hidden hunger" globally, identifying genes that synergistically regulate zinc content and grain weight, and breeding new rice varieties that are both high-yielding and nutrient-rich, has become a key task and urgent need in current agricultural scientific research. Achieving this goal will not only bring about a revolutionary change in global food production but also provide strong support for solving health problems caused by nutritional imbalances.
[0004] The Os01g0142100 genome has accession number 34833 in the gene bank (its nucleotide sequence is shown in SEQ ID NO: 4), but its function is currently unknown. Summary of the Invention
[0005] The technical problem to be solved by this invention is to provide the gene GZ that synergistically regulates rice grain weight and zinc content and its application.
[0006] To address the aforementioned technical problems, this invention provides a rice grain weight and zinc content co-regulating gene GZ, the nucleotide sequence of which is shown in SEQ ID NO: 1. The cDNA sequence of the gene GZ is shown in SEQ ID NO: 2.
[0007] As an improvement to the gene of the present invention: the nucleotide sequence further includes mutants, alleles or derivatives generated by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO: 1.
[0008] The present invention also provides a protein encoded by the gene GZ, which is used to coordinate the regulation of rice grain weight and zinc content as described above, and the amino acid sequence of the protein is as shown in SEQ ID NO: 3.
[0009] As an improvement to the protein of the present invention: the amino acid sequence further includes an amino acid sequence or derivative generated by adding, substituting, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID NO: 3.
[0010] The present invention also provides plasmids, plant expression vectors, recombinant vectors and transformants containing the above-mentioned genes.
[0011] This invention also provides the application of the gene GZ, which synergistically regulates rice grain weight and zinc content: increasing rice grain weight and zinc content.
[0012] An improvement to the use of the rice grain weight and zinc content co-regulatory gene GZ in this invention: Rice is a grass family plant, and this invention increases the thousand-grain weight and zinc content of rice grains, thereby improving rice yield and nutritional quality.
[0013] This invention also provides a method for synergistic regulation of grain morphology and quality in grasses: including transforming grass (e.g., rice) cells with the above-mentioned gene GZ, and then cultivating the transformed grass cells into plants, wherein the grains of the plants increase in weight and zinc content.
[0014] As an improvement to the method of synergistic regulation of grain morphology and quality of grass plants in this invention, the size of the grain and the zinc content are increased.
[0015] The present invention also provides plasmids containing the above-mentioned genes, as well as engineered bacteria or host cells containing the genes or the vector.
[0016] The engineered bacteria and host cells mentioned can be understood as the engineered bacteria or host cells used by those skilled in the art in the process of transgenic technology. However, with the development of technology, the selection of engineered bacteria and host cells may change, or the use of vectors and engineered bacteria may also be involved in non-transgenic applications. However, as long as they contain the gene or vector described in this invention, they are within the scope of protection of this invention.
[0017] Furthermore, the present invention also provides a host cell containing a gene sequence, wherein the cell is an Escherichia coli cell, an Agrobacterium cell, or a plant cell.
[0018] Another object of the present invention is to provide the use of the above-mentioned gene for transgenic improved crops.
[0019] This invention also provides a method for influencing rice grain weight and zinc content by transforming plant cells using a plant expression vector. Specifically, it involves using a plant expression vector to transform plant cells to influence rice yield and nutritional quality.
[0020] The preparation of transgenic rice is a conventional technique in this field, and this invention does not limit it further. All technical solutions for transgenic rice using the genes described in this invention are within the protection scope of this invention.
[0021] Specifically, this invention relates to a gene in rice that simultaneously positively regulates grain weight and zinc content, isolated using map-based cloning technology. G RAIN WEIGHT AND Z The study also explored the use of INC CONTENT (GZ) and the identification of its function through transgenic complementation and overexpression experiments. Furthermore, it investigated the molecular mechanism of synergistic regulation of rice grain size and zinc content using this gene, aiming to improve rice yield and nutritional quality, thereby addressing the "hidden hunger" caused by nutritional imbalances and providing a new zinc biofortification strategy to ensure food safety and health.
[0022] The specific technical steps for implementing this invention are as follows:
[0023] I. Segregation and genetic analysis of mutant gz:
[0024] The rice grain weight mutant gz of this invention is derived from an EMS (Ethyl Methyl Sulfonate) mutagenesis of the indica rice variety Taichung Native 1 (TN1). Reciprocal cross experiments with the wild type demonstrated that this mutant is controlled by a recessive single gene, such as... Figure 1 and Figure 2 As shown.
[0025] II. Comparison of mutant gz with wild-type seeds
[0026] At maturity, the grain size of the mutant gz and the wild type were observed. Compared with the wild type, the grain length, grain width, and thousand-grain weight of the mutant gz were significantly reduced (e.g., Figure 1 (As shown).
[0027] III. Map-based cloning of the GZ gene:
[0028] 1) Preliminary localization of the GZ gene
[0029] To isolate the GZ gene, this invention first constructed a mapping population, which was formed by crossing gz with the japonica rice variety Wuyunjing 7 (W7) to create the F2 mapping population. Then, using map-based cloning, molecular markers were used to preliminarily locate the GZ locus, initially positioning it on chromosome 1 between markers B1-2 and B1-3. Figure 2 (As shown).
[0030] 2) Fine mapping of the GZ gene
[0031] By analyzing the sequences between the two markers B1-2 and B1-3, developing new polymorphic markers will ultimately pinpoint the GZ gene precisely to within approximately 39 kb of the markers D1-5 and 1D-4. Figure 2 Candidate genes are predicted by analyzing the open reading frame (ORF) of this region.
[0032] 3) GZ gene functional analysis
[0033] Through transgenic technology, the results show that the present invention has obtained transgenic rice that restores the normal phenotype of mutant grain size and zinc content. Figure 2 and Figure 4 This demonstrates that the present invention correctly cloned the GZ gene. Amino acid sequence analysis and enzyme activity experiments show that GZ encodes a zinc-dependent metalloenzyme protein. Figure 4And SEQ ID No: 3). Simultaneously, overexpression was performed on wild-type plants, and it was found that the transgenic positive plants had significantly increased grain weight and zinc content (and SEQ ID No: 3). Figure 4 ).
[0034] In summary, the phenomenon of "hidden hunger" is severe globally, and nutritional imbalances are becoming increasingly prominent. Rice, as a staple food, suffers from a deficiency of key micronutrients such as zinc and iron, which has become a bottleneck restricting comprehensive nutrition. To address this challenge, this invention actively seeks genes that can simultaneously regulate rice grain weight and zinc content, aiming to cultivate new rice varieties that are both high-yielding and nutrient-rich. Against this backdrop, a significant breakthrough has emerged: this invention successfully cloned the GZ gene using a rice grain weight mutant and map-based cloning technology. The GZ gene uniquely encodes a zinc-dependent metalloenzyme protein that promotes increased grain weight while effectively enhancing the zinc content in rice. This discovery not only opens up new avenues for rice variety improvement but also contributes valuable scientific resources to global food security and nutritional health, driving the food production system towards a healthier and more sustainable direction.
[0035] Therefore, to address the "hidden hunger" caused by nutritional imbalances, this invention provides a novel zinc biofortification strategy to ensure food and health safety. Specifically, this invention provides a gene and its protein that can simultaneously positively regulate rice grain weight and zinc content, thereby obtaining transgenic plant cells. Simultaneously, this gene is used through marker-assisted selection or transgenic methods to synergistically improve rice yield and nutritional quality. Attached Figure Description
[0036] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0037] Figure 1 It is the phenotype of wild-type and gz mutant seeds;
[0038] Figure 1 In the diagram: A is the phenotypic graph of grain length (left) and grain width (right) for TN1 and gz; BD are the statistical graphs of grain length, grain width and thousand-grain weight, respectively; t-test, P<0.05 is *, P<0.01 is **.
[0039] Figure 2 It involves the cloning and verification of the GZ gene;
[0040] Figure 2 In the diagram: A is a map-based cloning diagram of the GZ gene; B is a phenotypic diagram of grain length (left) and grain width (right) of TN1, gz, and the complementary plant GZ-CO1 / 2; C and D are statistical graphs of grain length, grain width, and thousand-grain weight, respectively. t-tests are used, with P < 0.05 as * and P < 0.01 as **.
[0041] Figure 3 This analysis focuses on the seed size of plants overexpressing the GZ gene.
[0042] Figure 3 In the diagram: A is the phenotypic graph of grain length (left) and grain width (right) of TN1 and overexpressing plant GZ-OE1 / 2; B and D are statistical graphs of grain length, grain width and thousand-grain weight, respectively; t test, P<0.05 is *, P<0.01 is **.
[0043] Figure 4 The analysis included GZ protease activity and zinc content in the seeds of overexpressing plants.
[0044] Figure 4 In the diagram: A represents the GZ metalloproteinase activity analysis; B represents the zinc content statistics in the seeds of TN1, gz, and overexpressing plants GZ-OE1 / 2; Lane 1, before incubation (1.25 μM Zn-Ac); Lanes 2-6, incubated with Zn-Ac (0-5 μM) for 1 hour; Lane 7, incubated without GST-ZG for 1 hour; t-test, P<0.05 is *, P<0.01 is **. Detailed Implementation
[0045] The nucleotide sequence of TN1 (Os01g0142100 genome) is shown in SEQ ID NO: 4; the cDNA of TN1 is shown in SEQ ID NO: 5.
[0046] Example 1:
[0047] 1. Rice material:
[0048] The rice (Oryza sativa L.) mutant gz originated from the indica rice variety TN1, which is a wild-type material. The gz mutant is a mutation induced by EMS (Ethyl Methyl Sulfonate) mutagenesis of TN1. Figure 1 ).
[0049] The mutagenesis process is as follows: First, TN1 seeds were soaked in deionized water for 5 hours, then the water was drained. The soaked seeds were then treated with 0.8%–1% EMS for 10–12 hours, after which the EMS treatment solution was discarded. The seeds were then rinsed with tap water for 8–10 hours, followed by germination and sowing. The gz mutant was obtained through progeny selection.
[0050] At maturity, the grain size of the mutant gz and the wild type (TN1) was observed. Compared with the wild type, the grain length, grain width, and thousand-grain weight of the mutant gz were significantly reduced. Figure 1 ).
[0051] 2. Analyze and define the target audience:
[0052] Reciprocal crosses between the gz mutant and W7 rice variety showed that the mutant is controlled by a recessive single gene. The homozygous gz mutant was crossed with the japonica rice variety W7, and the F1 generation was self-crossed. From the F2 population, 583 individuals with the small-grain phenotype were selected as the localization population. Approximately 1 gram of young leaves from each plant was collected at the heading stage for total DNA extraction.
[0053] 3. DNA extraction
[0054] A rapid method for extracting trace amounts of rice DNA was used to extract genomic DNA for gene mapping from rice leaves. Approximately 0.5 g of rice leaves were flash-frozen in liquid nitrogen, ground into powder in a 5 cm diameter mortar, and transferred to a 2.0 ml centrifuge tube to extract DNA. The obtained DNA precipitate was dissolved in 600 μl of ultrapure water. 1.0 μl of DNA sample was used for each PCR reaction.
[0055] 4. Preliminary localization of the GZ gene
[0056] From the F2 population of 583 recessive individuals obtained from the cross between the gz mutant and W7, 96 recessive individuals were randomly selected to form a small population for polymorphism analysis. Linkage analysis was performed using primers evenly distributed across the 12 chromosomes in our laboratory, following known reaction conditions. The PCR amplification conditions were as follows: The total PCR reaction volume was 10 μl: 1 μl of 100 ng / μl rice genomic DNA, 1 μl of 10×PCR Buffer, 1 μl of 2 mM dNTPs, 2 μl of 10 μM primers, 0.05 μl of 5 U / μl rTaq, and 4.95 μl of ddH2O. The specific PCR amplification conditions were: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles. The PCR products were separated by 4% agarose gel electrophoresis and stained with Gelred nucleic acid dye to detect polymorphism. The GZ gene was preliminarily located on chromosome 1 between markers B1-2 and B1-3. Figure 2 ).
[0057] 5. Fine mapping of the GZ gene
[0058] Using the remaining 487 recessive individuals in the F2 population of the gz mutant combined with W7, molecular markers were designed based on the initial mapping, ultimately pinpointing the GZ gene to an approximately 39kb interval between markers D1-5 and 1D-4. Figure 2 The primer sequences are shown in Table 1:
[0059] Table 1. Localization marker sequences of the LGS1 gene
[0060] Tag Name Pre-primer (5'-3') Back primer (5'-3') B1-2 TTCTCAGCTGCTTGTGCATC CCTCCAAGGTAAAGGGGTTC B1-3 ATCCCAACTCTAAGCCACCC CTACCCGTCACCAACTCACC D1-5 TTGAACAAGTTAACAAAAGGTAGCTC TTGGGAGAACGTGACAAGGT 1D-4 AACCTGTGGTACCAAAACATGTAA CCACCCAGCTTCTTTCCTAA
[0061] 6. Gene prediction and comparative analysis:
[0062] Based on the fine mapping results, 13 candidate genes were identified within a 39kb range according to predictions from the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ). Sequencing primers were designed, and PCR was used to amplify the candidate genes from the gz mutant and wild-type TN1 genomes for sequencing. A single-base mutation was found in the Os01g0142100 genome (SEQ ID NO: 4) of the gz mutant, resulting in a glycine to aspartic acid mutation. The results were validated three times, yielding the same outcome each time, demonstrating the accuracy of the method (e.g., ...). Figure 2 (As shown). Based on the gene annotation information (NCBI) of the sequence, this gene is predicted to encode an expressed protein. The GZ gene has the nucleotide sequence shown in SEQ ID NO: 1, the cDNA sequence shown in SEQ ID NO: 2, and the protein it encodes has the amino acid sequence shown in SEQ ID NO: 3.
[0063] The PCR reaction system consisted of 100 ng / μl rice genomic DNA and 2 μl of other genomic DNA. GXL Buffer 10μl, 2.5mM dNTP 4μl, 10μM primer 4μl, 4 μl of GXL DNA Polymerase and 26 μl of ddH2O were used, bringing the total volume to 50 μl. PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 15 seconds, and 68℃ extension for 70 seconds, for 30 cycles. After 1% agarose gel electrophoresis, the gel was excised and recovered, and the cells were transformed into *E. coli*. Positive single clones were selected for sequencing. The GZ gene sequencing primers were as follows: GZCX-1F: GCAGGTCGACTCTAGAGCTTCTTGCTTTGCATGGTCG and GZCX-1R: ATTCGAGCTCGGTACCGACTCGCCCAACTGCCTT. The sequencing results showed that Os01g0142100 in the mutant was mutated from glycine to aspartic acid, thus proving that Os01g0142100 is a candidate gene for GZ.
[0064] 7. Enzyme activity and zinc content analysis:
[0065] The proteolytic activity of ZG was tested using β-casein as a substrate. The method was as follows: GZ-GST recombinant protein was expressed in *E. coli* and purified using a GST affinity column. Protease activity was measured at 37°C in a reaction buffer containing 50 mM Tris-acetate (pH 8.0), 80 mM NaCl, 5 mM magnesium acetate, 12.5 μM zinc acetate, and 100 μg / ml bovine serum albumin (BSA). Two protease inhibitors were used in the reaction: o-phenanthroline (10 mM, Sigma) and Complete (EDTA-free). After the reaction, samples were analyzed by SDS-PAGE using 12%–20% acrylamide gel electrophoresis, followed by staining with Coomassie Brilliant Blue R-250. Finally, β-casein was quantified using ImageJ.
[0066] In the absence of zinc ions, the metalloproteinase activity of ZG protein is significantly reduced. Figure 4 Simultaneously, this invention determined the zinc content in the seeds of TN1, zg, and the overexpression plant GZ-OE1 / 2. The zinc content in GZ-OE1 / 2 seeds was significantly increased, while the zinc content in zg seeds was lower than that in the wild type. Figure 4 ).
[0067] Example 2
[0068] Plant transformation:
[0069] Homologous recombination and PCR techniques were used to introduce Xba1 and Kpn1 restriction sites into amplification primers. The primers were: GZcom-1F: GCAGGTCGACTCTAGAGCTTCTTGCTTTGCATGGTCG, GZcom-1R: ATTCGAGCTCGGTACCGACTCGCCCAACTGCCTT, with an annealing temperature of 60℃. The first primer contained a HindIII restriction site, and the second primer contained an EcoRI restriction site. TN1 DNA (SEQ ID NO: 4) was amplified by PCR using these primers. After electrophoresis, a 9982 bp fragment was recovered and purified. Simultaneously, the pCAMBIA1300 vector was digested with both Xba1 and Kpn1. The purified fragment of the correct size was then ligated into the digested vector for E. coli transformation, and positive single clones were selected for sequencing. The correct transformation vector pCA1300-GZ was obtained and transformed into the rice gz mutant in Agrobacterium tumefaciens strain LBA4404 via electroporation. Callus induced from mutant seeds was cultured on induction medium for 3 weeks, and vigorous callus was selected as recipients for transformation. Rice callus was infected with LBA4404 strain containing the recombinant plasmid vector and co-cultured in the dark at 25°C for 3 days, followed by culture on selection medium containing 300 mg / L G418. Resistant callus was screened and cultured on pre-differentiation medium containing 250 mg / L G418 for approximately 10 days. The pre-differentiated callus was then transferred to differentiation medium and cultured under light and at 25°C. Resistant transgenic plants (complementary plants GZ-CO1 and GZ-CO2) were obtained after about one month and transplanted into the field for further growth. Phenotypic identification and observation of the plants at the heading and maturity stages showed that abnormal seed size returned to normal. The above-mentioned transgenic results indicate that this invention has obtained transgenic rice that restores the normal phenotype of the gz mutant. A comparison of seeds obtained from GZ-CO1 and GZ-CO2 with TN1 is shown below. Figure 2 As shown.
[0070] Simultaneously, homologous recombination and PCR techniques were used to introduce Kpn1 single-restriction sites into the amplification primers. The amplification primers were: GZOE-1F: ACTTCTGCAGGGATCCATGCAATTACCCGCCATGAGT, GZOE-1R: GCCTCACGTGGGATCCCAAGTCAAAATCAGTTAGTTGTG, with an annealing temperature of 60℃. Both primers contained Kpn1 restriction sites. The cDNA of TN1 (SEQ ID NO: 5) was amplified by PCR using these primers. After electrophoresis, a 1641 bp fragment was recovered and purified. Simultaneously, the pCAMBIA1301 vector was digested with Kpn1. The correctly sized fragment was then ligated into the digested vector and transformed into *E. coli*. Positive single clones were selected for sequencing. The correctly transformed vector pCA1301-GZOE was obtained and transformed into wild-type rice TN1 in *Agrobacterium tumefaciens* strain LBA4404 using electroporation. Callus tissue induced by mutant seeds was cultured on an induction medium for 3 weeks, and vigorous callus was selected as recipients for transformation. Rice callus was infected with the LBA4404 strain containing a recombinant plasmid vector and co-cultured at 25°C in the dark for 3 days, followed by cultivation on a selection medium containing 300 mg / L G418. Resistant callus was screened and cultured on a pre-differentiation medium containing 250 mg / L G418 for approximately 10 days. The pre-differentiated callus was then transferred to a differentiation medium and cultured under light and at 25°C. Resistant transgenic plants (overexpression plants GZ-OE1 and GZ-OE2) were obtained after about one month and transplanted into the field for continued growth. Phenotypic identification and observation of the plants at the heading and maturity stages revealed larger grains, increased thousand-grain weight, and increased zinc content; specifically, the comparison between seeds obtained from GZ-OE1 and GZ-OE2 and TN1 showed... Figure 3 As shown, the zinc content of seeds obtained from GZ-OE1 and GZ-OE2 is compared with that of TN1. Figure 4 As shown.
[0071] The above-mentioned transgenic results indicate that the present invention has obtained transgenic rice that synergistically increases grain weight and zinc content (e.g., ...). Figure 3-4 (As shown). The above research provides important genes and germplasm for increasing rice yield and enhancing the functional qualities of rice.
[0072] The above examples are merely some specific embodiments of the present invention. It should be noted that the present invention is not limited to the above embodiments, and all modifications that can be directly derived or conceived by those skilled in the art from the content disclosed in the present invention should be considered within the scope of protection of the present invention.
Claims
1. Genes GZ Its uses are characterized by: Positive synergistic regulation of rice grain weight and zinc content; genes GZ The cDNA is shown in SEQ ID NO:
5.
2. A method for synergistically regulating rice grain weight and zinc content, characterized in that: Genes GZ Transgenic rice plants were obtained by overexpression vector transformation, which positively and synergistically regulated rice grain weight and zinc content; Gene GZ The cDNA is shown in SEQ ID NO: 5.