Degradation enzyme gene cluster expressed in escherichia coli and capable of completely degrading 4-hydroxyacetophenone and application of degradation enzyme gene cluster

Abstract

The invention discloses a degrading enzyme gene cluster expressed in escherichia coli and capable of completely degrading 4-hydroxyacetophenone and application of the degrading enzyme gene cluster. The degrading enzyme gene cluster comprises genes HapAS, HapBS, PnpCS, PnpDS and PnpES which are derived from pseudomonas and subjected to structure optimization. The nucleotide sequence of the optimized gene is shown as SEQ ID No.1-5, the optimized gene is fused with a T7 promoter and a terminator to form a corresponding gene expression box, the gene expression box is connected with an expression vector and is transferred into escherichia coli, and a positive clone with good expression can completely degrade 4-hydroxyacetophenone with the concentration of 3 mM within 12 hours. According to the invention, a complete heterologous metabolic pathway derived from pseudomonas is introduced into Escherichia coli, so that the Escherichia coli is endowed with the capability of degrading 4-hydroxyacetophenone, which is not possessed by the Escherichia coli, thereby enriching an industrial degrading bacterium resource library.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to the application of a 4-hydroxyacetophenone degrading enzyme gene cluster, an overexpression vector and a recombinant strain thereof in degrading organic pollutants. Background Art

[0002] o-m-hydroxyacetophenone compounds are widely used in the pesticide field, with reports of their development as plant fungicides. Among them, 4-hydroxyacetophenone, also known as p-hydroxyacetophenone, is an important fine organic chemical with applications in medicine, agronomy, dyes, liquid crystal materials, and other fields. p-hydroxyacetophenone is ubiquitous in the natural environment, primarily as an intermediate product generated by urban waste discharge, industrial wastewater pollution, microbial degradation of pollutants, and secondary metabolites produced by some plants.

[0003] Several studies have shown that p-hydroxyacetophenone (PHA) inhibits the growth of Norway spruce seedlings. It synergizes with organic acids to further inhibit root growth and accelerate spruce senescence. PHA also exhibits certain biotoxicity, inhibiting several plant fungi, such as Colletotrichum gloeosporioides, Alternaria solani, and Fusarium oxysporum. At higher concentrations, PHA can inhibit the growth of bacteria, including Escherichia coli, Staphylococcus aureus, and Bacillus subtilis. Furthermore, PHA is toxic not only to microorganisms but also to aphids at high concentrations. Repeated exposure to PHA can also cause significant irritation to the human respiratory tract, eyes, and skin, leading to coughing, sputum production, conjunctival lesions, skin diseases, and, in severe cases, blood diseases such as leukemia. In addition, many aromatic pollutants such as bisphenol A, nonylphenol and 4-acetylphenol will produce p-hydroxyacetophenone during the process of microbial degradation. Due to the characteristics of incomplete degradation, p-hydroxyacetophenone often accumulates in the environment in large quantities.

[0004] With the increasing research on the degradation pathway of p-hydroxyacetophenone and related genes, the complete catabolic pathway has been largely clarified. With the intermediate product hydroquinone as the critical point, the metabolic pathway is mainly divided into two major parts: upstream and downstream. In the upstream pathway, p-hydroxyacetophenone first forms an ester under the action of oxygenases, which is then hydrolyzed to hydroquinone by hydrolases. Hydroquinone serves as the initial substrate in the downstream pathway and the final substrate of ring cleavage. Its mineralization to inorganic compounds under the action of dioxygenases is the most important step in the entire catabolic pathway. Currently, multiple hydroquinone dioxygenase genes have been reported. They vary in stability and metabolic efficiency, but ultimately all catalyze hydroquinone to produce 4-hydroxyxylan semialdehyde, which is then converted to the final product β-ketoadipate through the action of dehydrogenases and reductases.

[0005] How to reduce the accumulation of p-hydroxyacetophenone in the environment is an important issue. Currently, there are relatively few studies on the remediation of environmental pollution caused by p-hydroxyacetophenone. Compared with chemical remediation and physical remediation, bioremediation is a low-cost, environmentally friendly, and in-situ remediation method. Although many microorganisms have evolved the ability to degrade p-hydroxyacetophenone under natural conditions, there are still many problems when it comes to environmental remediation. First, natural strains that have evolved degradation capabilities cannot become dominant strains in complex environments, have poor genetic stability, and are less efficient in degrading p-hydroxyacetophenone. Second, most microorganisms that have evolved degradation capabilities cannot completely mineralize p-hydroxyacetophenone, resulting in the production and accumulation of more toxic intermediates, such as hydroquinone, which is even more harmful to environmental pollution remediation. In addition, the degradation pathway of p-hydroxyacetophenone is relatively complex, and the genome of a single strain is limited, and it is often impossible to evolve the most efficient catabolic pathway. Therefore, the evolved natural bacteria with degradation capabilities discovered so far cannot meet the needs of environmental remediation. The use of synthetic biology technology can optimize the key genes in the pathway and integrate the dominant metabolic pathways in multiple strains to construct strains with stable genetics, good environmental adaptability and high degradation efficiency to meet the needs of environmental remediation. Summary of the Invention

[0006] The present invention aims to provide a group of 4-hydroxyacetophenone degrading enzyme gene clusters, overexpression vectors and recombinant strains thereof for use in degrading organic pollution. Using synthetic biology techniques, five gene fragments, HapA and HapB from Pseudomonas fluorescens and PnpC, PnpD and PnpE from Pseudomonas putida, are modified, optimized and introduced into Escherichia coli. These fragments are successfully expressed in Escherichia coli. The positive strains can completely degrade 4-hydroxyacetophenone and significantly improve the tolerance to 4-hydroxyacetophenone, thereby enriching the microbial degradation resource library.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a 4-hydroxyacetophenone degrading enzyme gene cluster, comprising a HapAS gene, a HapBS gene, a PnpCS gene, a PnpDS gene, and a PnpES gene derived from Pseudomonas, which have been subjected to gene structure optimization and sequentially connected. The nucleotide sequences of the HapAS gene, HapBS gene, PnpCS gene, PnpDS gene, and PnpES gene are shown in SEQ ID No. 1 to SEQ ID No. 5, respectively.

[0009] The present invention provides application of the 4-hydroxyacetophenone degrading enzyme gene cluster in Escherichia coli.

[0010] A multi-gene Escherichia coli expression vector comprises an initial expression vector and a 4-hydroxyacetophenone degrading enzyme gene cluster; the 5' ends of the HapAS gene, HapBS gene, PnpCS gene, PnpDS gene and PnpES gene in the 4-hydroxyacetophenone degrading enzyme gene cluster are respectively fused with a T7 promoter, and the 3' ends are respectively fused with a T7 terminator.

[0011] Preferably, the initial expression vector comprises the expression vector pET-28a.

[0012] The present invention provides a method for constructing a transgenic Escherichia coli capable of completely degrading 4-hydroxyacetophenone, comprising the following steps:

[0013] (1) Linearize the initial expression vector;

[0014] (2) Based on the characteristics of E. coli, the gene structures of Pseudomonas genes HapA, HapB, PnpC, PnpD, and PnpE were optimized to make them more suitable for expression in E. coli. After optimization, the genes HapAS, HapBS, PnpCS, PnpDS, and PnpES were obtained.

[0015] (3) The 5' end of each optimized gene was fused to the T7 promoter, and the 3' end was fused to the T7 terminator, and the genes HapAS, HapBS, PnpCS, PnpDS, and PnpES were connected in the order of gene HapAS, HapBS, PnpCS, PnpDS, and PnpES to form a 4-hydroxyacetophenone degrading enzyme gene cluster;

[0016] (4) The 4-hydroxyacetophenone degrading enzyme gene cluster was double-digested with EcoRⅠ and HindⅢ, and then connected to the above-mentioned linearized initial expression vector to form a ring, thereby obtaining the expression vector pET-Hap that overexpresses the 4-hydroxyacetophenone degrading enzyme gene cluster.

[0017] The present invention provides a recombinant strain expressing the 4-hydroxyacetophenone degrading enzyme gene cluster. The expression vector is transformed into Escherichia coli to obtain the recombinant strain.

[0018] Preferably, the Escherichia coli includes Escherichia coli BL21 (DE3).

[0019] The present invention provides the use of the recombinant strain in degrading organic pollutants.

[0020] Preferably, the organic pollutant comprises 4-hydroxyacetophenone.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This study optimized and synthesized a 4-hydroxyacetophenone dioxygenase gene cluster containing five related genes and successfully expressed it in Escherichia coli. The positive strain was able to effectively remove 3 mM 4-hydroxyacetophenone from liquid culture medium. The optimized gene cluster can be used to prepare engineered microorganisms that can completely degrade 4-hydroxyacetophenone, showing potential applications in bioremediation. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 PCR identification of the expression vector pET-Hap in E. coli;

[0024] Figure 2 This is the degradation effect of the positive recombinant strain on 4-hydroxyacetophenone. DETAILED DESCRIPTION

[0025] The present invention provides a 4-hydroxyacetophenone degrading enzyme gene cluster, including a sequentially linked HapAS gene, a HapBS gene, a PnpCS gene, a PnpDS gene, and a PnpES gene. The HapAS and HapBS genes are obtained by optimizing and recombining the gene structure of HapA (EC 1.14.13.84) and HapB (EC 3.1.1.2) in the original sequence of Pseudomonas fluorescens (AF355751.3); and the PnpCS, PnpDS, and PnpES genes are obtained by optimizing and recombining the gene structure of PnpC, PnpD, and PnpE in the original sequence of Pseudomonas putida (FJ376608.2). The nucleotide sequences of the HapAS, HapBS, PnpCS, PnpDS, and PnpES genes of the present invention are as follows:

[0026]

[0027] HapBS gene (SEQ ID No. 2): atgactcttgatgtggagtctgcacaactgcttggacaacttgctgaacgtggtgctaagccattccatctgctggaccctgcacaagcacgtgagttgattgctggactgcgtccacaggcacatggacctgcaatgcagcacgttgagaacatgaagctgggacttgcacgtctgcgtatccttcgtccatctgcatctgttcgtggtgcaatcctgtatcttcatggtggtggatgggttgttggtggactggatgacttcgacttcttcgcacgtcagctggcacagcgtactcagtgcactgttgttcttgtggactaccgtcttgcacctgagttcccattccctgctgcactggacgatgttgagtctgctgcacagtggcttgttgagcatcgtactgaacttgctggtgctgctgatggtgcactcatcgttgctggtgactctgctggtggcaacctggcagctgtgttctcacagcgtgctgcactgcgtggtgatcgtcactgggcactccaggtgttgatctatcctgcaactcaggctgatctggatggacctgcataccgtgatccacaacgtcagctgctgctgtcacgtgaggacatggcatggttctggggacactacatcgctgacatcgatcagcgtcaacagtctgacgcatcaccactggctgccaaggatctgggtggtgttccacctgctgtcgtcctgactgctgagttcgacgtcttgcgtgaagagggacaggcatacgctgatcgtcttgcacaagcaggaatcactgtgatcgagcgttgcttctctggacagatgcatggcttcgtgactctgcctgcactgcgtgcatctggtgatgcactggattggctgtctgatcagatcaagccttggctgaagccattctaa。

[0028] PnpCS gene (SEQ ID No.3): atgactgatcattacaaggctgtggaggcactgatctctgatcaggctgttgactcattcgaaacttcaccaaacccacgtttcaagcagatcatgcagtcactggttcgtcatctgcacgatttcgtgtctgaggttgaactgactgaacaggagtggttcgagggtatccgtttcctgactgcaactggtcagaagtgtgatggtaaggttcgtcaggagttcatcctgctgtctgatactctgggtgtgtcaatgctggtggatgcaatcaaccatcgtcagtcaactaacgcaactgagactactgtgttcggtccattcttcatcgaaggtatgcctgatcgtggttatggtgagaacatggcactgactgatggtgtgcctgcactggtgtacggtcgtgtgcttgatgtgcaaggtcgtccagtggttggtgcagtgcttgatgtgtggcagactgctgacaacggtatgtactctggtcaagaccctgatcaaccattcggtaatctgcgtggtcgttaccgttctgacaacgatggttgcttcgcaatccaaactactgtgcctgtgtgctatccaatccctactgatggtcctgttggtgagatgcttgatgctgcaaaccgtcatgcatggcgtccagcacatctgcacttcatgattcaagcaccaggctaccgtaagctggtgactcacctgttcaactctgatgacccatacctggactctgatgctgtgttcggtgtgaagggttcactgcaagtgaagtacgaagaccgtcctgcacacgatgaagatgcaggtggtctggacatgccatacccatacaagtctgcatactacgagttcgtgatggaggcagagtaa。

[0029]

[0030]

[0031] The present invention provides an expression vector for overexpressing the above-mentioned 4-hydroxyacetophenone degrading enzyme gene cluster, comprising an initial expression vector and a 4-hydroxyacetophenone degrading enzyme gene cluster;

[0032] The present invention provides an expression vector for overexpressing the above-mentioned 4-hydroxyacetophenone degrading enzyme gene cluster, comprising an initial expression vector and a 4-hydroxyacetophenone degrading enzyme gene cluster; the 4-hydroxyacetophenone degrading enzyme gene cluster comprises a HapAS gene, a HapBS gene, a PnpCS gene, a PnpDS gene and a PnpES gene derived from Pseudomonas and having an optimized gene structure, wherein the 5' end of each gene is fused to a T7 promoter, and the 3' end is fused to a T7 terminator, and the genes are sequentially connected.

[0033] In the present invention, the initial expression vector includes the expression vector pET-28a.

[0034] The present invention provides a method for constructing the above-mentioned expression vector, comprising the following steps:

[0035] (1) Linearize the initial expression vector;

[0036] (2) Based on the characteristics of E. coli, the gene structures of Pseudomonas genes HapA, HapB, PnpC, PnpD, and PnpE were optimized to make them more suitable for expression in E. coli. After optimization, the genes HapAS, HapBS, PnpCS, PnpDS, and PnpES were obtained.

[0037] (3) The 5' end of each optimized gene was fused to the T7 promoter, and the 3' end was fused to the T7 terminator, and the genes HapAS, HapBS, PnpCS, PnpDS, and PnpES were connected in the order of gene HapAS, HapBS, PnpCS, PnpDS, and PnpES to form a 4-hydroxyacetophenone degrading enzyme gene cluster;

[0038] (4) The 4-hydroxyacetophenone degrading enzyme gene cluster was double-digested with EcoRⅠ and HindⅢ, and then connected to the above-mentioned linearized initial expression vector to form a ring, thereby obtaining the expression vector pET-Hap that overexpresses the 4-hydroxyacetophenone degrading enzyme gene cluster.

[0039] The present invention provides a recombinant strain expressing the 4-hydroxyacetophenone degrading enzyme gene cluster. The expression vector is transformed into Escherichia coli to obtain the recombinant strain.

[0040] In the present invention, the Escherichia coli includes Escherichia coli BL21 (DE3).

[0041] The present invention provides the use of the recombinant strain in degrading organic pollutants.

[0042] In the present invention, the organic pollutants include 4-hydroxyacetophenone.

[0043] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] This example provides the construction and transformation of an Escherichia coli expression vector for a naphthalene dioxygenase gene cluster, comprising the following steps:

[0046] (1) Two genes HapA (EC 1.14.13.84) and HapB (EC 3.1.1.2) from the original sequence of Pseudomonas fluorescens (AF355751.3) and the original sequence of Pseudomonas putida (FJ376608.2) The three genes PnpC, PnpD and PnpE in the gene were used as templates, and the structures of the above five genes were optimized according to the following principles: (1) Codon optimization: without basically changing the amino acid sequence of the gene, the gene was modified according to the codon preference of Escherichia coli to improve the translation efficiency; (2) EcoRI and HindIII restriction enzyme sites within the gene were eliminated respectively to facilitate the construction of multi-gene expression vectors; (3) inverse repeat sequences between genes were eliminated, and possible stem-loop structures and terminator sequences other than T7 terminator in the gene expression cassette were eliminated; (4) the GC / AT ratio of the gene was balanced to make it as close as possible to the GC / AT ratio of Escherichia coli to improve the stability of RNA; (5) the free energy of the mRNA secondary structure was optimized to improve the gene expression efficiency.

[0047] (2) The optimized genes HapAS (SEQ ID No.1), HapBS (SEQ ID No.2), PnpCS (SEQID No.3), PnpDS (SEQ ID No.4) and PnpES (SEQ ID No.5) were synthesized. The homology of the optimized five genes with the original sequences was 78.78%, 79.96%, 80.64%, 80.60% and 79.21%, respectively.

[0048] (3) The 5' ends of the optimized HapAS, HapBS, PnpCS, PnpDS, and PnpES genes were fused with the T7 promoter and the 3' ends were fused with the T7 terminator to form independent gene expression cassettes. These genes were then connected in the order of HapAS, HapBS, PnpCS, PnpDS, and PnpES to form a gene cluster. The two ends of the complete sequence were then connected to the EcoRⅠ and HindⅢ restriction sites, respectively. The full-length sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0049] (4) The synthesized gene fragment was digested with EcoRI and HindIII and recovered. It was then mixed with the pET-28a expression vector that had been digested with the same endonucleases EcoRI and HindIII. The total reaction volume was 30 μL. The fragment was ligated on an enzyme digester at 22°C for 2 h and then inactivated at 72°C for 10 min. The recombinant expression vector pET-Hap was finally obtained.

[0050] (5) The recombinant expression vector pET-Hap was transformed into Escherichia coli BL21 (DE3) (purchased from the Institute of Biotechnology, Shanghai Academy of Agricultural Sciences) by heat shock, and spread on a solid 2YT resistance plate with a final kanamycin concentration of 50 μg / mL. After overnight culture at 37°C, positive clone strains were screened. The plasmids in the positive clone strains were digested by enzymes and DNA sequenced to determine the integrity and correctness of the gene sequence. The expression vector pET-Hap in the positive clone strains was identified by PCR. The results are shown in Figure 1 ,Depend on Figure 1 It was found that recombinant Escherichia coli overexpressing the 4-hydroxyacetophenone-degrading enzyme gene cluster was obtained.

[0051] Example 2

[0052] This example provides the degradation of 4-hydroxyacetophenone by the recombinant E. coli. The specific steps are as follows:

[0053] The recombinant Escherichia coli was inoculated into 100 mL of M9 liquid culture (containing 1% glycerol and 50 μg / mL kanamycin), shaken at 150 rpm and 37°C for 24 h, and the supernatant was removed by centrifugation. The bacteria were washed once with sterile distilled water and then resuspended in 10 mL of M9 liquid culture medium (containing 1% glycerol, 0.2% arabinose, 50 μg / mL kanamycin and 1 mM IPTG). Escherichia coli transformed with an empty plasmid was used as a control. 1 mM 4-hydroxyacetophenone was added to each of the two groups of Escherichia coli and shaken at 37°C. The bacterial solution was collected at different times, and the residual 4-hydroxyacetophenone content in the culture medium was detected by HPLC. The detection method for residual 4-hydroxyacetophenone was as follows: 500 μL of the bacterial solution was collected at different times, centrifuged at 12,000 rpm for 1 min, and the supernatant was removed. The supernatant was passed through a sterilizing filter membrane and then detected by HPLC. HPLC detection parameters were: Agilent 1100 high-performance liquid chromatography system; C18 column (120Å, 4.6×150mm, 5μm); mobile phase: methanol:water (volume ratio 70:30), flow rate 1 mL / min; column temperature 30°C; detection wavelength 286 nm; injection volume 20 μL. Figure 2 ,Depend on Figure 2 It can be seen that the positive strain can completely degrade 3 mM 4-hydroxyacetophenone within 12 hours.

[0054] As can be seen from the above examples, the present invention provides a 4-hydroxyacetophenone degrading enzyme gene cluster, an overexpression vector and a recombinant strain thereof for use in degrading organic pollutants. The 4-hydroxyacetophenone degrading enzyme gene cluster can be successfully expressed in Escherichia coli, and the positive strain can effectively degrade 4-hydroxyacetophenone, showing potential for application in fields such as environmental remediation.

[0055] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A 4-hydroxyacetophenone degrading enzyme gene cluster expressed in Escherichia coli, characterized in that: The invention comprises genes HapAS, HapBS, PnpCS, PnpDS and PnpES derived from Pseudomonas and after structural optimization, and the nucleotide sequences thereof are shown as SEQ ID No. 1-5 respectively.

2. According to the 4-hydroxyacetophenone degrading enzyme gene cluster described in claim 1, the 5' end of each optimized gene is fused with the T7 promoter, and the 3' end is fused with the T7 terminator to form an independent gene expression cassette, and the cassettes are connected in the order of HapAS, HapBS, PnpCS, PnpDS and PnpES to construct a recombinant expression vector.

3. The recombinant expression vector according to claim 2, characterized in that: The invention comprises a 4-hydroxyacetophenone degrading enzyme gene cluster and an initial expression vector pET-28a.

4. A recombinant strain expressing the 4-hydroxyacetophenone degrading enzyme gene cluster according to claim 1, characterized in that: The recombinant expression vector described in claim 2 or 3 is transformed into Escherichia coli BL21 (DE3) to obtain a recombinant strain.

5. Use of the recombinant strain according to claim 4 in degrading organic pollutants, characterized in that: The organic pollutants include 4-hydroxyacetophenone.

Images