Kit for detecting novel bunyavirus by LAMP (loop-mediated isothermal amplification) combined CRISPR / Cas12b one-step method

Abstract

The invention discloses a kit for detecting a novel bunyavirus by an LAMP (loop-mediated isothermal amplification) combined CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12b one-step method, and belongs to the technical field of gene detection. The kit mainly comprises sgRNA, an LAMP (loop-mediated isothermal amplification) primer, a mutated Cas12b protein, a single-stranded DNA (deoxyribonucleic acid) reporter molecule, an enzyme, a buffer system and a quality control product. Wherein the sequences of the LAMP primer are as shown in SEQ ID NO.1-6, and the sequence of the sgRNA is as shown in SEQ ID NO.7. The invention further discloses a detection method of the LAMP primer. According to the kit, the Cas12b-2M mutant protein is used, so that the sensitivity of a one-step method of a CRISPR technology is improved. The kit does not depend on expensive instruments, the detection time is greatly shortened, nucleic acid amplification can be completed in 30 minutes in a constant temperature device, then result interpretation is carried out under an ultraviolet lamp or under the assistance of a mobile phone APP, uncovering operation is avoided in the whole process, the kit can be used for field detection, and the novel bunyavirus can be conveniently, rapidly, efficiently and specifically detected.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a kit for detecting a novel bunyavirus by a one-step method combining LAMP with CRISPR / Cas12b. Background Art

[0002] The new Bunyavirus (Severe Fever with Thrombocytopenia Syndrome Virus, SFTSV) was first discovered in China in 2009. The clinical manifestations of infected people are mainly fever, thrombocytopenia, leukocytopenia and multiple organ dysfunction, which is called severe fever with thrombocytopenia syndrome (SFTS). SFTSV is mainly transmitted through tick bites and is more common in mountainous and hilly areas with poor medical conditions. The early clinical manifestations are similar to flu symptoms, which leads to many infected people being missed or misdiagnosed, and delayed treatment, thus increasing the incidence of severe illness and a mortality rate of up to 12% to 50%. In 2017, the World Health Organization classified SFTS as one of the top ten highly contagious diseases.

[0003] The laboratory diagnostic criteria for SFTSV infection are as follows: ① positive serum virus isolation; or ② a 4-fold increase in serum antibody titer; or ③ positive SFTSV virus RNA detection. The detection technologies involved include virus isolation and culture, immunological detection, and fluorescence quantitative PCR (qPCR). These methods all have certain shortcomings: such as the long virus isolation and culture cycle, high technical requirements for operation, insufficient accuracy and sensitivity of immunological detection, and a long window period. The qPCR method has high requirements for equipment, experimental sites, and technical personnel, and is difficult to be widely used in primary hospitals in SFTSV-endemic areas. Nucleic acid diagnostic technology has the advantages of being fast and sensitive, and can detect pathogens in the incubation period. At present, most laboratories use the qPCR method to detect the nucleic acid of SFTSV, which has good sensitivity and specificity, but it takes a long time, has high technical requirements for operators, and the instruments and equipment are expensive. It is difficult to popularize in primary hospitals, and it is impossible to achieve point-of-care testing (POCT). Therefore, it is urgent to develop a new rapid, sensitive, and convenient detection method for the early stage of SFTSV infection.

[0004] In recent years, a variety of isothermal amplification technologies have emerged. Loop-mediated isothermal amplification (LAMP) is a representative isothermal amplification technology that can simultaneously amplify the number and length of nucleic acid chains. Therefore, a large amount of nucleic acid can be amplified in a short time, which shortens the detection time and has a higher sensitivity. Because nucleic acids can be amplified at one temperature, this method does not require the use of complex and expensive instruments. A simple water bath can achieve the purpose of nucleic acid amplification. It is simple to operate and suitable for POCT. However, since the isothermal amplification method lacks the corrective effect of temperature changes, it is easy to produce non-specific amplification, resulting in a high false positive rate in this method. The addition of CRISPR / Cas detection technology can effectively solve this problem.

[0005] In 2019, the research team of Li Wei and Zhou Qi published an article in Genome biology (CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity). They developed a Cas12b-mediated DNA detection method (CDetection), combining recombinase polymerase isothermal amplification technology (Recombinase Polymerase Amplification, RPA) with Cas12b. The amplified product activates the trans-cutting activity of Cas12b, non-specifically cuts the single-stranded DNA in the system, and generates fluorescent signals, providing an efficient and highly practical platform for nucleic acid detection. In 2020, Zhang Feng's team published an article in the NEJM journal (Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing), which introduced a detection method for SARS-CoV-2: based on the CRISPR / Cas12b nucleic acid detection method STOPCovid (SHERLOCK testing in one pot), RT-LAMP and CRISPR / Cas12b are combined to detect SARS-CoV-2, which is particularly suitable for POCT scenarios. The CRISPR system has broad application potential in single nucleotide polymorphism analysis, cancer screening, bacterial and viral infection detection, and drug resistance screening. Since the target and substrate of Cas12b are both DNA and have strong stability, the system has low requirements for the experimental operating environment and can be used for rapid on-site detection. Summary of the invention

[0006] The present invention aims to provide a kit for detecting a novel bunyavirus (SFTSV) by a one-step method of LAMP combined with CRISPR / Cas12b, which can be used to detect SFTSV more conveniently, quickly, efficiently and specifically. The present invention can be used for rapid on-site detection, and will provide a new suitable detection method for SFTSV for hospitals at different levels, fully solving the high mortality rate caused by delayed diagnosis in areas with poor medical conditions, achieving early diagnosis and treatment of diseases, and preventing the spread of diseases.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A kit for detecting novel bunyaviruses by one-step method of LAMP combined with CRISPR / Cas12b, comprising sgRNA and LAMP primers.

[0009] The sgRNA is designed as follows: through multiple sequence alignment, the conserved regions of various SFTSV strains are found as the target molecular region to be detected, and the 5'-TTN-3' sequence is selected and the 20bp bases downstream thereof are selected, and the Scaffold sequence of AapCas12b is connected to the 5' end of this 20bp base sequence to construct the sgRNA sequence.

[0010] The LAMP primers were designed as follows: using PrimerExplorer v.5 (https: / / primerexplorer.jp / e / ) software, F3, FIP and Loop-F were designed within 0-200 bp of the 5' region near the 5'-TTN-3' sequence of the target molecule region to be detected, and B3, BIP and Loop-B were designed within 20-200 bp of the 3' region near the 5'-TTN-3' sequence.

[0011] The LAMP primers contain degenerate bases, and can simultaneously detect multiple SFTSV strains from different regions.

[0012] Preferably, in the kit for detecting novel bunyavirus, the LAMP primer sequence is:

[0013] S1-F3: GCCACTTYACCCGAACATCA(SEQ ID NO.1);

[0014] S1-B3: GCCTTYGGRTCCCTRATTCC (SEQ ID NO.2);

[0015] S1-FIP: YGGAGCCAGCAAGACAGAAGTTGACAGAGTTCACAGCAGCAT (SEQ ID NO.3);

[0016] S1-BIP: CTTGCCAYARAGAGTARGCCTCAACTRCRGGGGTATCTGAA (SEQ ID NO.4); S1-Loop-F: ACTCCTTCAGGGAYCCTCT (SEQ ID NO.5);

[0017] S1-Loop-B: CATMAGGGTCTTGGTYGTGG (SEQ ID NO.6).

[0018] The sgRNA sequence is as follows:

[0019] S1-sgRNA: GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUC CAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACACCAAGACUAU CAAUGUGAA (SEQ ID NO.7).

[0020]

[0021] The kit for detecting novel bunyavirus also contains single-stranded DNA reporter molecules. The single-stranded DNA reporter molecules carry FAM and BHQ1 groups respectively. Preferably, the sequence of the single-stranded DNA reporter molecules is: FAM-TT ATT-BHQ1.

[0022] The kit for detecting novel bunyavirus also comprises enzymes and a buffer system. The enzymes include BstDNA polymerase and reverse transcriptase, and the buffer system includes Tris-HCl, ammonium sulfate, magnesium sulfate, and Tween 20.

[0023] Preferably, in the kit for detecting the new bunyavirus, in the system for detecting the new bunyavirus, the reaction system is 25 to 50 μL, which comprises: 1×reaction buffer, 1×S1-LAMP primer, 25 to 100 mM taurine, 1 m M to 1.8 mM dNTP, 0.8 U / μL to 3.2 U / μL Bst DNA polymerase, 5 mM to 10 mM magnesium sulfate, 20 mM to 50 mM potassium chloride, 1 U / μL to 5 U / μL reverse transcriptase, 200 to 1000 ng Cas12b protein, 50 to 250 ng sgRNA, 0.2 μM to 0.5 μM single-stranded DNA reporter molecule, RNA to be tested and the remainder of water. Among them, the composition of 1×reaction buffer is preferably: 10mM~40mM Tris-HCl, 5mM~20mM ammonium sulfate, 1mM~4mM magnesium sulfate, 0.01%~1% T ween 20; the composition of 1×S1-LAMP primer is preferably: 0.1μM~0.4μM S1-F3 primer, 0.1μM~0.4μM S1-B3 primer, 0.8μM~3.2μM S1-FIP primer, 0.8μM~3.2μM S1-BIP primer, 0.2μM~0.8μM S1-LoopF ​​primer, 0.2μM~0.8μM S1-Loop-B primer.

[0024] Preferably, in the kit for detecting the new Bunyavirus, in the system for detecting the new Bunyavirus, the reaction system is 25 μL, which contains: 1×reaction buffer, 1×S1-LAMP primer, 50 mM taurine, 1.4 mM dNTP, 1.6 U / μL Bst DNA polymerase, 8 mM magnesium sulfate, 40 mM potassium chloride, 4 U / μL reverse transcriptase, 800 ng Cas12b protein, 200 ng sgRNA, 0.25 μM single-stranded DNA reporter molecule, RNA to be tested and the remainder of water. Among them, the composition of 1×reaction buffer is: 20mM Tris-HCl, 10mM ammonium sulfate, 2mM magnesium sulfate, 0.1% Tween 20; the composition of 1×S1-LAMP primer is: 0.2μM S1-F3 primer, 0.2μM S1-B3 primer, 1.6μM S1-FIP primer, 1.6μM S1-BIP primer, 0.4μM S1-Loop-F primer, 0.4μM S1-Loop-B primer.

[0025] The kit for detecting the novel Bunyavirus also includes a positive quality control and a negative quality control. The positive quality control includes a strong positive quality control, a medium positive quality control and a weak positive quality control. The gene copy number of the strong positive quality control is 10000 copies / μL, the gene copy number of the medium positive quality control is 100 copies / μL, and the gene copy number of the weak positive quality control is 1 copy / μL. The positive quality control is a clinical culture isolate of the novel Bunyavirus; the negative quality control is physiological saline.

[0026] The use of the above-mentioned kit for detecting novel Bunyavirus in detecting novel Bunyavirus is for non-disease diagnosis purposes.

[0027] The method for using the above-mentioned kit for detecting novel Bunyavirus comprises the following steps:

[0028] (1) Extract viral RNA from the sample to be tested.

[0029] (2) Prepare a reaction mixture containing the viral RNA of the sample to be tested, LAMP primers, sgRNA, Cas protein and single-stranded DNA reporter molecule, enzyme and buffer system, and place it in a transparent EP tube.

[0030] (3) reacting the reaction mixture at a constant temperature; the reaction conditions are preferably 60-63° C. for 30-40 min, more preferably 61° C. for 30 min.

[0031] (4) Using ultraviolet light to illuminate the reaction product and interpret the test results. In this step, after using ultraviolet light to illuminate the reaction product, a color identification device (such as a mobile phone "Palette Cam" APP) can be further used to assist in interpreting the test results.

[0032] Compared with the novel Bunyavirus detection kits based on the existing nucleic acid detection technology on the market, the novel Bunyavirus detection kit of the present invention has the following advantages:

[0033] (1) Faster detection speed: Currently, qPCR technology is mostly used to detect SFTSV. This method takes about 2 hours to detect. The entire detection process of the novel Bunyavirus detection kit of the present invention only takes 30 minutes, which improves the detection speed.

[0034] (2) More convenient operation: qPCR technology requires the use of a fluorescent quantitative PCR instrument, which has high technical requirements for operators and expensive instruments and equipment, making it difficult to popularize in grassroots hospitals. The kit of the present invention can achieve nucleic acid amplification in a simple constant temperature device, and then interpret the results under ultraviolet light or with the help of a mobile phone APP. The operation is simple, the required equipment is also cheaper, and it is easier to popularize in grassroots hospitals.

[0035] (3) Higher specificity: The present invention is based on the CRISPR system. The sgRNA guides the Cas protein to specifically recognize the target sequence and trans-cut the molecular beacon to generate fluorescence, avoiding the influence of nonspecific amplification in LAMP and improving the specificity of the method. In addition, the entire detection process is carried out in one tube without opening the lid, which reduces the false positive results caused by aerosol contamination and has higher specificity.

[0036] (4) Higher sensitivity: Compared with other CRISPR / Cas nucleic acid detection systems, the present invention uses a mutant AapCas12b protein Cas12b-2M, which can reduce the cis-cleavage of the template chain by the Cas protein without affecting the trans-cleavage of the molecular beacon, avoiding the decrease in template chain concentration caused by cis-cleavage in the one-step method, and ensuring the efficiency and sensitivity of the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is an agarose gel electrophoresis diagram of the products after LAMP amplification using S1-LAMP, S2-LAMP and S3-LAMP primers respectively in Example 1 of a specific embodiment of the present invention, wherein dsDNA of the SARS-CoV-2N gene was used as a control.

[0038] Figure 2This is a fluorescence curve diagram of LAMP amplification of 7 clinical samples using S1-LAMP and S2-LAMP primers respectively in Example 1 of the specific embodiment of the present invention.

[0039] Figure 3 This is a fluorescence curve diagram of LAMP+Cas12b-2M amplification using S1-LAMP and S2-LAMP primers respectively in Example 1 of a specific embodiment of the present invention.

[0040] Figure 4 This is a graph of LAMP+Cas12b-2M fluorescence signal detection results of three samples whose quality control products and clinical qPCR test results are negative, CT 12 and CT 26, respectively, in Example 1 of a specific embodiment of the present invention, wherein the gene copy numbers of the strongly positive, moderately positive and weakly positive quality control products are 10000 copies / μL, 100 copies / μL and 1 copy / μL, respectively.

[0041] Figure 5 This is a schematic diagram of using the "Palette Cam" APP to analyze fluorescence values ​​in Example 1 in a specific embodiment of the present invention.

[0042] Figure 6 It is the ultraviolet light excitation image and "PaletteCam" APP analysis image of the quality control product in Example 1 in the specific implementation manner of the present invention.

[0043] Figure 7 These are ultraviolet light excitation images and “Palette Cam” APP analysis images of three samples whose clinical test results are negative, CT 12 and CT26 respectively in Example 1 in the specific implementation manner of the present invention.

[0044] Figure 8 This is a schematic diagram of the detection principle for comparing the cis-cleavage activity of Cas12b-2M and Cas12b-WT in Example 2 in a specific embodiment of the present invention.

[0045] Fig. 9 This is the qPCR detection result in step (1) of Example 2 in the specific implementation manner of the present invention.

[0046] Fig.10 This is an analysis graph of the final fluorescence values ​​of samples of various concentrations detected using Cas12b-WT and Cas12b-2M in step (2) of Example 2 in a specific embodiment of the present invention.

[0047] Fig.11 This is an ultraviolet light excitation diagram of detecting samples of various concentrations using Cas12b-WT and Cas12b-2M in step (2) of Example 2 in a specific embodiment of the present invention.

[0048] Fig.12 This is a diagram of the LAMP fluorescence signal detection result after gradient dilution of the clinical sample of CT 13 in Example 3 of the specific implementation mode of the present invention.

[0049] Fig.13 This is a diagram showing the detection results of agarose gel electrophoresis of the LAMP amplification product in Example 3 in a specific embodiment of the present invention.

[0050] Fig.14 This is a graph showing the results of LAMP+Cas12b-2M fluorescence signal detection after gradient dilution of the clinical sample of CT 13 in Example 3 in a specific embodiment of the present invention.

[0051] Fig.15 This is a graph showing the detection results of agarose gel electrophoresis of the LAMP+Cas12b-2M amplification product in Example 3 in a specific embodiment of the present invention.

[0052] Fig.16 It is the ultraviolet light excitation image of 173 samples in Example 4 in the specific implementation mode of the invention. DETAILED DESCRIPTION

[0053] Sever fever with thrombocytopenia syndrome (SFTSV) is a new virus isolated and confirmed by the Chinese Center for Disease Control and Prevention in 2010. It is a segmented single-stranded negative-sense RNA virus, and the viral genome consists of three segments: large (L), medium (M), and small (S).

[0054] The most critical concept of the present invention is that the epidemiological characteristics of the new Bunyavirus require us to develop an early, rapid, sensitive and convenient detection method. Among the existing nucleic acid detection methods, the qPCR detection method requires expensive fluorescent quantitative detection instruments, high technical requirements and long detection time. The LAMP isothermal nucleic acid amplification method can amplify nucleic acids under 60-65°C, and this process can be achieved in a simple constant temperature device, thus getting rid of the dependence on a more precise PCR instrument. However, the specificity of the LAMP technology is poor, and the introduction of Cas12b can reduce the impact of nonspecific amplification on the results in the LAMP technology. The further use of mutant Cas12b can reduce the cutting of the template chain by the Cas protein in the one-step method, thereby improving the detection efficiency. In addition, the introduction of single-stranded DNA probes can realize the visualization of the results, and the results can be observed under ultraviolet light. Based on the above characteristics, the kit of the present invention can be used for rapid detection on site, which is of great significance for the rapid detection of SFTSV nucleic acid, especially for grassroots clinical tests that lack laboratory conditions. It has great value.

[0055] To further illustrate the technical means, achieved purpose and effect adopted by the present invention, the content of the present invention is further described below in conjunction with embodiment, but it should not be construed as limiting the present invention. Without departing from the spirit and essence of the present invention, the modification or replacement of the inventive method, step or condition all belong to the scope of the present invention. If not specifically indicated, the technical means used in the embodiment are conventional means well known to those skilled in the art.

[0056] Example 1: A novel Bunyavirus detection kit, mainly comprising sgRNA, LAMP primers, mutant Cas12b protein, buffer system, enzyme and single-stranded DNA reporter molecule:

[0057] (1) Selection of SFTSV characteristic nucleic acid sequences and design, synthesis and screening of corresponding LAMP primers.

[0058] The conserved regions of various SFTSV strains (JS2014-Hedgehog-02, SDLZtick12 / 2010, YNY1, AH12 / Anhui / 2010, SD4 / Shandong / 2010, HBHG29, HBMC5_human_2016, AHL / China / 2011, HNXH, JS2012-035) were searched as the target molecular region to be detected by multiple sequence alignment, and the 5'-TTN-3' sequence was searched in the target molecular region to be detected. PrimerExplorer v.5 (https: / / primerexplorer.jp / e / ) software was used to design primers F3, FIP and Loop-F within 0-200bp of the near 5' region of the sequence, and primers B3, BIP and Loop-B were designed within 20-200bp of the near 3' region. The LAMP primers contain degenerate bases, which can detect various SFTSV strains.

[0059] During the development of this kit, three sets of LAMP primers were designed for the three selected target sites, namely S1-LAMP primer, S2-LAMP primer and S3-LAMP primer. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. By performing LAMP amplification and agarose gel electrophoresis on recombinant plasmids containing the target fragment of SFTSV amplification and SFTSV-positive clinical samples, a set with good sensitivity, specificity and stability was screened for the development of this kit.

[0060] The agarose gel electrophoresis results of LAMP amplification products showed that the S3-LAMP primer was unstable in amplifying SFTSV, and the positive samples could not be amplified ( Figure 1), so the S3-LAMP primer was excluded first. Then, the amplification effect of S1-LAMP and S2-LAMP primers was detected by fluorescent LAMP using the WarmStart Fluorescent LAMP / RT-LAMP Kit (with UDG) (#E1708) from NewEngland Biolabs (NEB). The results are as follows Figure 2 The fluorescence signal of the positive samples gradually increased over time, while the fluorescence signal of the negative samples did not change over time. However, the sensitivity of the S1-LAMP primer was better than that of the S2-LAMP primer. sgRNA was subsequently introduced for further screening. The primer sequences are shown in Table 1.

[0061] Table 1. SFTSV LAMP primer sequence list

[0062]

[0063]

[0064] Figure 2 The information of the 7 clinical samples is shown in Table 2.

[0065] Table 2. CT values ​​of 7 clinical samples measured by qPCR method

[0066]

[0067] (2) Design and synthesis of sgRNA corresponding to the SFTSV amplification product.

[0068] Search for the 5'-TTN-3' sequence in the target molecule region to be detected, select a 20bp base sequence downstream of this sequence, and connect the Scaffold sequence of AapCas12b to the 5' end of this 20bp base sequence to construct the sgRNA sequence. During the development of this kit, a total of 3 target sites were selected, and 3 sgRNAs were designed according to the target sites: S1-sgRNA, S2-sgRNA and S3-sgRNA, corresponding to the amplification products of S1-LAMP primer, S2-LAMP primer and S3-LAMP primer, respectively. Through specific experiments, an sgRNA with good sensitivity and specificity was screened for the development of this kit.

[0069] Because S3-LAMP primers were excluded due to unstable amplification, their corresponding S1-sgRNA was also excluded first. Then, two other sets of LAMP primers and corresponding sgRNAs were used to perform fluorescence detection on two clinical samples: in the S2-sgRNA experiment, the fluorescence values ​​of NTC (no template control) and negative samples also increased, and positive and negative samples were not well distinguished; while when S1-sgRNA was used, positive and negative samples could be distinguished well ( Figure 3 ). Therefore, S1-LAMP primer and S1-sgRNA were selected for the development of this kit. The sgRNA selected in this embodiment is shown in Table 3 below.

[0070] Table 3. sgRNA sequences of AapCas12b

[0071]

[0072] (3) Design and synthesis of single-stranded DNA reporter molecules: A 5-base random single-stranded DNA molecule with a fluorescent group FAM and a quenching group BHQ1 at both ends was used for subsequent visual detection under ultraviolet light. The single-stranded DNA reporter molecule used in this example was synthesized by Takara, and the sequence is shown in Table 4 below.

[0073] Table 4. Single-stranded DNA reporter sequences

[0074]

[0075]

[0076] (4) Preparation of buffer system: Prepare 10× reaction buffer as shown in Table 5, and make sure to adjust the pH of the final solution to about 8.8.

[0077] Table 5.10×Reaction buffer composition

[0078]

[0079] (5) Preparation of 10×S1-LAMP primers: The 10×S1-LAMP primers shown in Table 6 were prepared, wherein the initial concentrations of primers B3, F3, FIP, BIP, Loop-F, and Loop-B were all 100 μM.

[0080] Table 6. Composition of 10×S1-LAMP primers

[0081]

[0082] (6) Extraction of novel Bunyavirus RNA

[0083] The automated magnetic bead extraction kit from Guangzhou Daan Gene Co., Ltd. was used to extract nucleic acid from the quality control products and three clinical samples. The CT values ​​of the qPCR test results of the three clinical samples were negative, 12, and 26, respectively.

[0084] (7) Take 2 μL of the viral RNA extracted in step (6) and add 10×reaction buffer, 10×S1 LAMP primer, S1-sgRNA, mutant AapCas12b protein, single-stranded DNA reporter molecule, dNTP, taurine, potassium chloride, magnesium sulfate, BstDNA polymerase and reverse transcriptase. Place the reaction mixture in a fluorescent signal detector, react at a constant temperature of 61°C, collect signals every 30 seconds, and continuously detect for 30 minutes. The results are as follows Figure 4 As shown, the fluorescence signals of the positive control and the sample gradually increase over time, while the fluorescence signals of the negative control and the sample do not change over time. The proportions of the components in the novel Bunyavirus detection kit of the present invention are shown in Table 7 below.

[0085] Table 7. Ratio of each component in the novel Bunyavirus detection kit (25 μL system)

[0086]

[0087] (8) Place each reaction mixture in Table 7 in step (7) in a constant temperature water bath at 61°C for 30 minutes, then excite the reactants with ultraviolet light and read the results by eye; take photos with a mobile phone, and use the "Palette Cam" APP on the phone to assist in the reading of the results. The software can analyze the RGB value of the image. The fluorescent group used in this method can emit green fluorescence under ultraviolet light. The Green value in the RGB value just reflects the fluorescence value of the test result, and can achieve semi-quantitative results to a certain extent. Positive samples emit green fluorescence, and the Green value is higher; negative samples do not emit green fluorescence, and the Green value is lower, which can be used to assist in judging the positive and negative results. Specific usage steps are as follows: Figure 5 As shown in the figure: ① Use the camera function on the "PaletteCam" APP to take a picture of the sample under the UV light; ② Select the sample point to be analyzed in the picture; ③ Save the selected sample point; ④ Analyze the RGB value of the selected sample point. The result is as follows Figure 6-7 As shown, the positive control and positive samples emit green fluorescence, while the negative control and negative samples have no green fluorescence.

[0088] Example 2: Comparison of the detection effects of Cas12b-2M and Cas12b-WT in the one-step method

[0089] (1) Comparison of cis-cleavage activity of Cas12b-2M and Cas12b-WT

[0090] In order to compare the cis-cleavage activity of Cas12b-2M and Cas12b-WT, the dsDNA after SFTSV reverse transcription was incubated with Cas12b-2M and Cas12b-WT. The reaction mixture included 1× reaction buffer (including 20mMTris-HCl, 10mM ammonium sulfate, 10mM magnesium sulfate and 0.1% Tween 20), dsDNA, 800ng Cas12b protein, 200ng sgRNA, and incubated at 61°C for 1min. The reaction product was then quantified by qPCR. The detection principle is as follows Figure 8 The qPCR primer sequences are shown in Table 8. Fig. 9 As shown, within this 1-minute period, the amount of uncut dsDNA in the sample treated with Cas12b-2M was significantly greater than that in Cas12b-WT, indicating that the cis-cleavage activity of Cas12b-2M interfered less with the initial step of isothermal amplification.

[0091] Table 8. qPCR primer sequence list

[0092]

[0093] (2) Comparison of sensitivity and signal-to-noise ratio between Cas12b-2M and Cas12b-WT in the one-step method

[0094] Cas12b-2M and Cas12b-WT were used to detect SFTSV nucleic acid at concentrations of 100000 copies / μL, 10000 copies / μL, 1000 copies / μL, 100 copies / μL, 10 copies / μL, 5 copies / μL, 2.5 copies / μL, and 1 copy / μL, respectively. The distribution ratio and reaction conditions of each group were the same as step (7) in Example 1. The final fluorescence value was observed on a real-time fluorescence quantifier, such as Figure 10-11 As shown, it was observed that Cas12b-2M had higher sensitivity than Cas12b-WT, and Cas12b-2M could make the one-step detection limit reach 1 copy / μL with enhanced signal-to-noise ratio.

[0095] Example 3: Comparison of the sensitivity and specificity of the novel Bunyavirus detection kit and the universal LAMP kit on the market

[0096] (1) LAMP assay after gradient dilution of SFTSV RNA from a clinical sample

[0097] The viral nucleic acid of a SFTSV-positive specimen with a clinical test result of 12100 copies / μL was diluted to 10% of the original concentration.0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 The mixture was added with 3 HCV positive samples for interference. The WarmStart Fluorescent LAMP / RT-LAMP Kit (with UDG) (#E1708) from New England Biolabs (NEB) was used for LAMP detection. The composition of each component is shown in Table 9 below. The composition of 10×LAMP primer mix is ​​the same as that in Table 6 of Example 1. The reaction mixture was placed in a fluorescent signal detector and reacted at 65°C. The signal was collected every 30 seconds and the detection was continued for 45 minutes. The results are shown in Table 9. Fig.12 As shown, it is diluted to 10 of the original concentration. 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 The fluorescence values ​​of the samples diluted to 10 of the original concentration increased. -5 The fluorescence value of the sample did not increase, but after a period of time, it was diluted to 10% of the original concentration. -6 Samples with positive HCV, samples with positive HCV, and elevated NTC fluorescence values.

[0098] Table 9. NEB's LAMP kit formulation ingredients

[0099]

[0100]

[0101] (2) Agarose gel electrophoresis of LAMP amplification products:

[0102] Prepare 2.5% agarose gel, add LAMP amplification product (including loading buffer) and DNA Marker into the sample well, set the voltage to 120V, and remove the gel after 35 minutes of electrophoresis. Then place it in the gel imaging system for imaging and take photos. The results are as follows: Fig.13 It was observed that the dilution was 10% of the original concentration. 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 The agarose gel electrophoresis bands of the amplified products of the samples diluted to 10 times the original concentration were ladder-shaped bands, which were specific bands; while non-specific amplification occurred to a greater or lesser extent in the other samples, resulting in the dilution of the samples to 10 times the original concentration in step (1) of this embodiment.-6 The fluorescence values ​​of samples with a fold increase, HCV-positive samples, and NTC increased, indicating that the fluorescence value of LAMP detection alone is easily interfered by nonspecific amplification and has poor specificity.

[0103] (3) LAMP+Cas12b-2M detection after gradient dilution of SFTSV RNA from a clinical sample

[0104] The viral nucleic acid of a SFTSV-positive specimen with a clinical test result of 12100 copies / μL was diluted to 10% of the original concentration. 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 times, and added 2 HCV positive samples for interference. The above-mentioned LAMP combined with CRISPR / Cas12b-2M one-step detection kit for new bunyavirus was used for LAMP+Cas12b-2M detection, and the ratio of each component was the same as Table 7 of Example 1. The reaction mixture was placed in a fluorescent signal detector, reacted at 61°C, and the signal was collected every 30s for 45 minutes. The results are shown in Fig.14 As shown, it is diluted to 10 of the original concentration. 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 The fluorescence values ​​of the samples diluted to 10 of the original concentration increased. -5 , 10 -6 The samples with a fold increase, HCV-positive samples, and NTC fluorescence values ​​did not increase.

[0105] (4) Agarose gel electrophoresis of the LAMP+Cas12b-2M amplification product:

[0106] Prepare 1.5% agarose gel, add LAMP+Cas12b-2M amplification product (including loading buffer) and DNA Marker to the sample well, set the voltage to 120V, take out the gel after electrophoresis for 35 minutes, and then place it in the gel imaging system for imaging and take pictures. The results are as follows Fig.15 It was observed that the dilution was 10% of the original concentration. 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4The agarose gel electrophoresis bands of the amplified products of the samples with amplification times were ladder-shaped bands, which were specific bands. Nonspecific amplification also occurred to a greater or lesser extent in other samples, but the fluorescence values ​​of these samples with nonspecific amplification did not increase in step (3) of this embodiment, indicating that the added CRISPR / Cas12b-2M system eliminated the interference of nonspecific amplification in LAMP on the results and enhanced the specificity.

[0107] Example 4: Detection of clinical samples

[0108] According to the method of Example 1, 173 clinical SFTSV nucleic acid test specimens (Department of Laboratory, Zhongnan Hospital of Wuhan University, Wuhan, Hubei) were tested. The test results were well consistent with the clinical report results (Guangzhou Daan Gene, fluorescent quantitative PCR kit). The specific results are shown in Table 10 and Fig.16 shown.

[0109] Table 10. Comparison of SFTSV nucleic acid test results

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116] The results in Table 10 show that the kit for detecting the novel bunyavirus by LAMP combined with CRISPR / Cas12b-2M one-step method of the present invention has good consistency with the qPCR method. Among the 173 clinical samples detected by CRISPR / Cas12b-2M one-step method, 172 test results were consistent with qPCR, with a consistency of 99.42%. In addition, for strongly positive specimens (i.e., SFTSV positive specimens with a concentration greater than 10000 copies / μL), this kit can detect within 15 minutes.

[0117] In summary, the present invention has developed a kit for detecting a novel bunyavirus by a one-step method of LAMP combined with CRISPR / Cas12b-2M, which can detect SFTSV more conveniently, quickly, efficiently and specifically. At the same time, after preliminary verification, the kit has good detection performance and high consistency with clinical test results. It is of great significance to the rapid detection of SFTSV nucleic acid, especially for primary clinical tests that lack laboratory conditions. It can be used for early clinical diagnosis, thereby improving the survival rate of patients infected with SFTSV.

[0118] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the protection scope of the present invention.

Claims

1. A kit for detecting novel bunyaviruses by one-step method of LAMP combined with CRISPR / Cas12b, characterized in that: Contains LAMP primers and sgRNA; The LAMP primers are as follows: S1-F3: GCCACTTYACCCGAACATCA; S1-B3: GCCTTYGGRTCCCTRATTCC; S1-FIP: YGGAGCCAGCAAGACAGAAGTTGACAGAGTTCACAGCAGCAT; S1-BIP:CTTGCCAYARAGAGTARGCCTCAACTRCRGGGGTATCTGAA; S1-Loop-F:ACTCCTTCAGGGAYCCTCT; S1-Loop-B: CATMAGGGTCTTGGTYGTGG; The sequence of the sgRNA is as follows: GUCUAGAGGACAGAAUUUUUUCAACGGGUGUGCCAAU GGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACA CCAAGACUAUCAAUGUGAA.

2. The kit for detecting novel bunyavirus according to claim 1, characterized in that: Contains Cas12b protein.

3. The kit for detecting novel bunyavirus according to claim 2, characterized in that: The Cas12b protein is an AapCas12b protein with a G478A / K396A double mutation.

4. The kit for detecting a novel bunyavirus according to claim 1, characterized in that: Contains a single-stranded DNA reporter molecule.

5. The kit for detecting a novel bunyavirus according to claim 4, characterized in that: The sequence of the single-stranded DNA reporter molecule is: FAM-TTATT-BHQ1.

6. The kit for detecting a novel bunyavirus according to claim 1, characterized in that: It comprises enzymes and a buffer system; the enzymes include Bst DNA polymerase and reverse transcriptase.

7. The kit for detecting a novel bunyavirus according to claim 1, characterized in that: Contains positive and negative controls.

8. Use of the kit for detecting a novel bunyavirus according to any one of claims 1 to 7 in detecting a novel bunyavirus, characterized in that: The application described is for non-disease diagnosis purposes.

9. The method for using the kit for detecting a novel bunyavirus according to any one of claims 1 to 8, characterized in that: The steps include: (1) Extracting viral RNA from the sample to be tested; (2) preparing a reaction mixture containing the viral RNA of the sample to be tested, LAMP primers, sgRNA, Cas protein and single-stranded DNA reporter molecule, enzyme and buffer system, and placing it in a transparent EP tube; (3) reacting the reaction mixture at a constant temperature; (4) Use ultraviolet light to irradiate the reaction product and interpret the test results.

10. The method of use according to claim 9, characterized in that: The reaction conditions in step (3) are 60-63° C. for 30-40 min.

Images