New application of squamocin

Abstract

The invention discloses a novel application of squamocin, and finds that the squamocin can effectively degrade histone methyltransferase EZH2 and MYC in head and neck squamous cell carcinoma (HNSCC), stomach cancer (GC) and colorectal cancer (CRC) cells and inhibit the cancer promoting transcriptional activity of the MYC. Compared with a medicine EPZ6438 which is sold on the market, the squimocin has higher capability of inhibiting the growth of HNSCC, GC and CRC (Cyclic Redundancy Chromatography). In mechanism, the squamocin enhances ubiquitination degradation related to endoplasmic reticulum stress, ubiquitin is triggered through E1 activating enzyme UBA6, ubiquitin is promoted to be transferred to E2 binding enzyme UBE2Z, and then degradation of EZH2 and MYC by E3 ligase FBXW7 is enhanced. The invention provides a novel application of the squamocin in clinical treatment of neck squamous cell carcinoma / gastric cancer / colorectum.

Description

Technical Field

[0001] The invention belongs to the field of biopharmaceuticals, and specifically relates to a new application of squamocin. Background Art

[0002] Head and neck squamous cell carcinoma (HNSCC) is an aggressive malignancy with high proliferation, high recurrence rate and poor prognosis. Despite advances in surgical methods and chemoradiotherapy in recent decades, the clinical treatment effect is still unsatisfactory, and more than 50% of patients will relapse or metastasize within 3 years after treatment, resulting in poor prognosis. Given the limited efficacy of chemotherapy in the treatment of recurrent or metastatic HNSCC (R / M HNSCC), recent clinical treatment has turned to the study of immune checkpoint inhibitors (ICIs); however, only 15-20% of HNSCC patients have benefited. To date, the mechanism of resistance of R / MHNSCC to ICIs remains poorly understood; however, MYC activation has been shown to contribute to the resistance of R / MHNSCC and esophageal squamous cell carcinoma to ICIs treatment. Therefore, it is an urgent clinical need to analyze the potential mechanism by which MYC activation may cause ICI resistance and develop inhibitors that directly target MYC activation.

[0003] MYC is encoded by the proto-oncogene MYC, and in up to 70% of human cancers, MYC is dysregulated through copy number gain, upstream signaling aberrations, and altered protein stability, and is involved in all aspects of tumorigenesis. To date, many therapeutic agents that directly inhibit MYC activity are in development; however, their clinical efficacy has not been established, suggesting that alternative strategies targeting MYC activity may require further exploration. Epigenetic proteins are key regulators of MYC, and these druggable epigenetic proteins represent an attractive drug development strategy to inhibit MYC activity.

[0004] Histone methyltransferase (EZH2) catalyzes histone H3K27me3 and maintains transcriptional repression of key genes. In a range of human tumors including HNSCC, GC, and CRC, high EZH2 expression is associated with tumor proliferation, metastasis, and poor prognosis. Notably, EZH2 can also exert its oncogenic effects by promoting the stabilization of MYC. However, current EZH2 inhibitors, including EPZ-6438, GSK126, and UNC1999, often induce slow and / or partial tumor cell inhibitory responses. Therefore, effectively inhibiting the stabilization of EZH2 and its partner MYC is an attractive strategy for cancer treatment.

[0005] In human cancers, MYC-activated tumor cells further stimulate endoplasmic reticulum (ER) stress and unfolded protein response (UPR) in cells, which in turn promote tumor cell proliferation, survival, metastasis, chemoresistance, and immune escape. However, unresolved or extreme UPR can trigger tumor cell apoptosis.

[0006] Annonaceous acetogenins (ACGs) are a class of unique and structurally homogeneous polyketides extracted from plants of the Annonaceae family, which show potent antiproliferative effects in a variety of cancers. Squamocin is one of the most potent active ingredients in ACGs, showing potent cytotoxicity against a range of tumor cells and chemotherapy-resistant tumor cells. For example, the cytotoxicity of squamocin against MCF-7 cells is approximately 100 times that of doxorubicin. Therefore, it is still unclear whether squamocin, as a cytotoxic drug and inhibitor of mitochondrial respiratory complex I, can inhibit the proliferation of tumor cells with high MYC activity and its mechanism of action.

[0007] In the present invention, we found for the first time that squamocin significantly inhibited the proliferation of HNSCC, GC and CRC by inhibiting the activities of EZH2 and its MYC, emphasizing the therapeutic significance of squamocin for these MYC-driven tumors. Summary of the invention

[0008] One of the purposes of the present invention is to provide a new application of squamocin in pharmaceutical manufacturing.

[0009] The technical solution for achieving the above-mentioned purpose is as follows.

[0010] Use of the annona lactone compound squamocin in the preparation of a drug for preventing and / or treating tumors, wherein the tumor is head and neck squamous cell carcinoma (HNSCC), gastric cancer (GC), and / or colorectal cancer (CRC).

[0011] In some of these embodiments, the tumor is head and neck squamous cell carcinoma.

[0012] In some of these embodiments, the tumor is gastric cancer.

[0013] In some of these embodiments, the tumor is colorectal cancer.

[0014] In some embodiments, the drug is in the form of tablets, capsules, granules, solutions, pills, suspensions, enteric-coated tablets, sustained-release preparations, or effervescent tablets.

[0015] In some of these embodiments, the use includes squamocin as an inhibitor targeting the UBA6-UBE2Z-FBXW7 ubiquitin cascade to degrade EZH2 and MYC pathways.

[0016] In some embodiments, the use includes squamocin as an inhibitor targeting heat shock protein Hsp90α.

[0017] In some embodiments, the drug is administered to a mammal.

[0018] In some embodiments, the mammal is a human.

[0019] Another object of the present invention is to provide a drug for treating head and neck squamous cell carcinoma, gastric cancer, and / or colorectal cancer.

[0020] A drug for treating head and neck squamous cell carcinoma, gastric cancer, and / or colorectal cancer, wherein the active ingredient of the drug comprises squamosin.

[0021] The present invention presents suqamocin, a single component isolated from ACG, and finds that suqamocin can promote the degradation of histone methyltransferases EZH2 and MYC and inhibit MYC transcriptional activity in HNSCC, GC and CRC. In a mouse tumor model, suqamocin has a stronger tumor inhibition rate than the marketed EPZ6438. Mechanistically, suqamocin enhances the endoplasmic reticulum (ER) stress response to activate the UBA6-UBE2Z-FBXW7 ubiquitin degradation system, promoting the degradation of EZH2 and MYC in the above tumors. Our research results clarify the role of squamocin in promoting the degradation of tumor proteins EZH2 and MYC and its molecular mechanism, providing a method for accelerating the development of tumor drugs driven by the EZH2 / MYC axis. Through the above research, it was found that squamocin can be used to prevent and treat head and neck squamous cell carcinoma / gastric cancer / colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Squamocin inhibits the proliferation of HNSCC cell lines with high MYC expression; A: Western blot analysis of MYC expression in the specified cell lines (left); cells were treated with squamocin for 24 hours, and CCK8 was used to detect cell survival (right); B: SCC15 and SCC25 cells were treated with squamocin at specified concentrations for 12, 24 and 48 hours, and cell survival was detected by CCK8; C: cells were treated with squamocin at specified concentrations for 24 hours, and cell cycle was analyzed by PI staining.

[0023] Figure 2 Results of the experiment on squamocin inhibiting mitochondrial respiratory complex I; A: SCC15 and SCC25 cells were treated with 10 μg / mL squamocin for 24 h, and the activity of mitochondrial respiratory chain complex I was analyzed (mean ± SEM; n = 3, Student's t test); B: SCC15 and SCC25 cells were pretreated with mito-TEMPO (10 μM) for 6 h, and then treated with squamocin (10 μg / mL) for 24 h; after treatment, the cells completed the following tests: extracellular ATP level analysis (B), intracellular ROS analysis (C), Annexin V staining analysis of cell apoptosis (D).

[0024] Figure 3 Results of direct binding target experiments of Squamocin; A: target fishing analysis of direct target proteins of squamosin was performed using the SwissTargetPrediction database, and then protein-protein interaction analysis of potential targets was performed; BC: computational docking showed the binding mode (B) and interaction map (C) of HSP90α and squamosin; D: DSF analysis of squamosin binding to HSP90α protein (mean ± SEM; n = 3, Student's t test); E: SPR analysis of squamosin binding to HSP90α protein.

[0025] Figure 4Experimental results of squamocin inhibiting tumor growth in HNSCC in an ezh2-dependent manner; A: 293T cells were transfected with pcDNA3.1-3×Flag-C-HSP90αWT / HSP90α mutant plasmids, and the binding of squamocin to HSP90α was analyzed by CETSA. The intensity of the grayscale analysis band was referenced to the starting temperature (40°C), and the curve was fitted using Prism (mean±SEM; n=3); B: SCC15 cells were transfected with two (#1 and #2) siHSP90AA1 for 48h and then treated with squamocin for 24h. Cell viability was determined by CCK8 (mean±SEM; n=4, Student's t test). C: SCC15 and SCC25 cells were treated with corresponding concentrations of squamocin for 24 hours, and the expression of EZH2 mRNA was analyzed by qRT-PCR (left panel, mean ± SEM; n = 2, Student's t test) and immunoblot analysis of the indicated proteins (right panel); D: Western blot analysis of the indicated proteins in the cytoplasm and nucleus of cells treated with 10 μg / mL squamocin for 24 hours; E: Cell proliferation curves of SCC15 and SCC25 cells overexpressing EZH2 under the action of squamocin (mean ± SEM; n = 4, two-way ANOVA test); F: Representative images of clonal assays and quantification of the number of clones per well of SCC15 and SCC25 cells overexpressing EZH2 after being treated with squamocin (10 μg / mL) for 10 days (mean ± SEM; n = 3, Student's t test), *p<0.05, **p<0.01, ***p<0.001.

[0026] Figure 5 Experimental results of the role of EZH2 and MYC in the progression of HNSCC; A: Immunofluorescence staining analysis of EZH2 and MYC subcellular localization in the indicated cells, scale bar: 50 μm; B: Lysates of SCC15 and SCC25 cells were immunoprecipitated with anti-EZH2 or anti-MYC, and Western blot was performed; C: Schematic diagram of the domain organization of MYC and EZH2, NTD, CD and CTD indicate the amino-terminal, central and carboxyl-terminal domains, respectively, DNMT BR: DNA methyltransferase binding region, CDYL BR: chromosome domain y-like protein binding region, CXC: cysteine-rich domain, SET: Su(var)3-9, enhancer of zeste, trithorax domain; D E: 293T cells were transfected with plasmids expressing HA-tagged EZH2, flag-tagged MYC or deletion (Δ) mutants, and the binding of EZH2 and MYC was detected using anti-flag- (D) or anti-HA- (E) related precipitates.

[0027] Figure 6 Experimental results showing that EZH2 enhances the transcriptional activity of MYC; A: Effect of EZH2 on the half-life of MYC protein under 100 μg / mL CHX treatment, representing the quantification of MYC protein level relative to β-tubulin level, and MYC half-life was calculated using Prism (mean±SEM; n=2); B: SCC25 cells were transfected with two siEZH2 (#1 and #2) constructs for 48 h and then treated with 10 μM MG132 for 8 h; cell lysates were analyzed by Western blot; C: Western blot analysis of MYC phosphorylation in SCC15 cells overexpressing EZH2 and SCC25 cells transfected with siEZH2. D: SCC15 cells overexpressing EZH2 (upper panel) and SCC25 cells transfected with siEZH2 (lower panel, mean ± SEM; n = 2, Student's t test), ns: not statistically significant, *p < 0.05, **p < 0.01, ***p < 0.001.

[0028] Figure 7 Experimental results that squamocin effectively inhibits EZH2 methyltransferase activity and promotes MYC degradation in HNSCC; A: Western blot analysis of corresponding proteins in SCC15 and SCC25 cells after 24 h of treatment with designated drugs; B: Venn diagram of overlapping differentially expressed genes (DEGs, FDR<0.05) between SCC15 and SCC25 cells after squamocin treatment, and Fisher's exact test was used to quantify the DEG profiles of the two cell lines (p<0.05); C: FPKM of indicated genes in RNA-seq of SCC25 cell lines after squamocin treatment (mean ± SEM; n=3, Student's t-test); D: Analysis of H3K27me of UNC5B promoter in SCC25 cells using GEO database (GSE149042 and GSE222312) 3 E: H3K27me on the UNC5B promoter after SCC25 cells were treated with 10 μg / mL squamocin 3 ChIP-qPCR analysis of enrichment (mean ± SEM; n = 3, Student's t-test).

[0029] Figure 8 Transcriptomics experimental results showed that Squamocin treatment led to significant upregulation of ER stress and UPR;

[0030] A: Scatter plot of gene ontology enrichment analysis of DEGs commonly upregulated in SCC15 and SCC25 cells after treatment with squamocin; GO and top 20 biological processes are shown (p<0.05); B: Venn diagram showing the overlap of differentially expressed genes (DEGs, FDR<0.05) upregulated or downregulated in SCC15 and SCC25 cells after treatment with squamocin; Fisher's exact test was used to quantify the DEG profiles of the two cell lines (p value<0.05); C: Western blot analysis of the expression of EZH2 and MYC in SCC15 cells after treatment with 10μg / mL squamocin for 24h and ER stress inhibitors (ISRIB: 20μM, 4μ8C: 20μM, CeapinA7: 20μM) for 12h.

[0031] Fig. 9 Results of protein half-life and ubiquitination experiments; A: SCC15 and SCC25 cells were first treated with DMSO or 10 μg / mL squamocin for 24 h, and then treated with 100 μg / mL CHX for the specified time. Western blot analysis (upper panel), EZH2 and MYC degradation curves were drawn (lower panel), and the half-lives of EZH2 and MYC were calculated using Prism (mean ± SEM; N = 2); B: SCC15 and SCC25 cells were treated with 10 μg / mL squamocin for 24 h, 10 μM MG132 for 8 h, 10 μM CQ for 8 h, or squamocin for 24 h, followed by MG132 or / and CQ for 8 h, and cell lysates were analyzed by Western blot analysis; C: Western blot analysis of EZH2 or MYC ubiquitination in SCC15 and SCC25 cells after 10 μg / mL squamocin and DMSO for 24 h. D: SCC15 and SCC25 cells were treated with 10 μg / mL squamocin for the indicated time, and then immunoblot analysis was performed; E: Treatment as indicated. Cell lysates were detected by Western blot.

[0032] Fig.10Results of UBA6 knockout experiments; AB and D: SCC15 and SCC25 cells were transfected with siUBA6 (A), siUBE2Z (B) or siFBXW7 (D) for 48 hours, then treated with 10 μg / mL squamocin for 24 hours, cell lysates were immunoprecipitated with anti-EZH2 or anti-MYC, and analyzed with anti-ubiquitin; C: SCC15 and SCC25 cells were treated with squamocin (10 μg / mL) for 24 hours, ER stress inhibitors (ISRIB: 20 ​​μM, 4μ8C: 20 μM, CeapinA7: 20 μM) for 12 hours, and qRT-PCR analysis of the indicated genes was performed (mean ± SEM; n = 2, Student's t test); E: Co-immunoprecipitation of endogenous FBXW7 interacting with EZH2 or MYC in SCC15 and SCC25 cells.

[0033] Fig.11 Experimental results of squamocin inhibiting the EZH2 / MYC axis in various tumors; A: Representative tumor images of nude mouse HNSCC xenografts (n=4), B: Tumor volume measured every 3 days (mean ± SEM; n=4, two-way ANOVA test), C: Summary of tumor weights collected after euthanasia (mean ± SEM; n=4, Student's t test), D: HE, Ki67, EZH2, H3K27me 3 Immunohistochemical staining of MYC and GC in xenografts, scale bar: 200 μm, E, F: Representative tumor images and tumor volumes of GC (E) and CRC (F) xenografts in nude mice (mean ± SEM; n = 4, two-way ANOVA test).

[0034] Fig.12 HPLC chromatogram of isolated squamocin.

[0035] Fig.13 HPLC chromatogram of squamocin dissolved in blank solvent. DETAILED DESCRIPTION

[0036] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0038] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.

[0039] "Subject" or "patient" or "applicable person" refers to a human or a non-human animal such as a mammal. "Subject" can include any animal, including horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish, and birds. Human subjects may also be referred to as patients.

[0040] As used herein, an "effective amount" or "therapeutically effective amount" is an amount sufficient to affect a desired biological effect, such as a beneficial effect, including a clinical outcome. As such, an "effective amount" depends on the circumstances in which it is applied. The effective amount may vary according to factors known in the art such as the disease state, age, sex, and weight of the individual being treated. Several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the urgency of the therapeutic situation. In addition, the drug squamocin of the present invention may be administered as frequently as necessary to achieve a therapeutic amount.

[0041] As used herein, the term "prevent" and variations thereof and other grammatical equivalents include preventing the development, occurrence, hindering or avoiding head and neck squamous cell carcinoma (HNSCC), gastric cancer (GC) and colorectal cancer (CRC) and symptoms of these conditions and reducing the occurrence of symptoms. Prevention can be complete (i.e., no detectable symptoms) or partial, such that fewer symptoms are observed than would occur without treatment. The term also includes a preventive benefit. For HNSCC or conditions to be prevented, squamocin can be administered to patients at risk for a particular disease, or to patients reporting one or more physiological symptoms of the disease, even though a diagnosis of the HNSCC disease may not have been made.

[0042] Example

[0043] 1. Experimental Materials

[0044] 1.1 Cell lines

[0045] Human HNSCC cell lines SCC15 and SCC25 and human embryonic kidney cell line HEK293T cells were obtained from American Type Culture Collection (ATCC, USA).

[0046] 1.2 Main test kit instruments

[0047]

[0048]

[0049]

[0050] Supplementary Table S1.Small interfering RNA(siRNA)sequences

[0051]

[0052] 1.3 Preparation of main reagents

[0053] 1.3.1 Isolation and purification of Squamocin

[0054] 50 kg of Annona custardii seeds were soaked in 95% ethanol overnight, and filtered with 20 times the amount of 95% ethanol. The filtrate was concentrated under reduced pressure to obtain 5.6 kg of ethanol extract (Fls-1); 200 g of ethanol extract was taken, dissolved, and 300 g of diatomaceous earth was added. The sample was mixed, dried, and loaded into a Soxhlet extractor. It was first defatted with n-hexane, and then eluted with dichloromethane (32.7 g, Fls-2) and ethyl acetate respectively; the eluate was analyzed by HPLC, and it was confirmed that the dichloromethane part contained tetrahydrofuranose lactone components.

[0055] The Fls-2 portion was loaded onto a silica gel column and eluted with a hexane-acetone gradient to obtain two main components, which were identified as squanmocin (K19) and bullatacin (K16) by mass spectrometry, carbon NMR and hydrogen NMR analysis and TLC comparison with known compounds.

[0056] 1.3.2 Squamocin structure identification

[0057] Compound K19: white waxy solid, mp46-47℃, ESI-MS: 645.4792 (M++Na), its molecular formula is C37H66O7, 7.01 in 1H-NMR is 35-H, 5.00ppm(q) is 36-H, and 1.40(d) is the three protons of 37-CH3, which is the typical structure of unsaturated lactone. 13C-NMR also proves this, δ173.91 is 1-C, 148.98 is 35-C, δ134.22 is 2-C, 77.43 is 36-C, 19.20 is 37-C. At the same time, 1H NMR and 13C-NMR showed that K19 had an ortho-bis(THF) ring, with two hydroxyl groups located on both sides of the THF ring, 1H-NMR: δ3.39 (15-H), 3.85-3.93 (16-H, 19-H, 20-H, H-23, H-24); 13C-NMR: δ83.44 (C-16), 82.55 (C-19), 82.19 (C-20), 82.87 (C-23), 74.20 (C-15), 71.63 (C-24). NMR data showed that compound K19 was an ortho-bis(THF) ring-type annonaceous lactone. 13C-NMR and 1H-NMR data were basically consistent with the squamocin data reported in the literature, and K19 was identified as squamocin.

[0058] 1.3.3 Chemical Structure of Squamocin

[0059]

[0060] The Squamocin is also commercially available.

[0061] 1.3.4 HPLC profile of crude squamocin used in in vivo studies

[0062] The HPLC chromatogram of isolated squamocin is shown in Fig.12 The HPLC chromatogram of blank solvent dissolving squamocin is shown in Fig.13 .

[0063] 1.3.5 Preparation of Squamocin Stock Solution

[0064] Weigh 32 mg of squamocin solid and dissolve it in 3.2 mL of DMSO to prepare a mother solution with a concentration of 10 mg / mL. After filtering, divide it into aliquots and store it at -20°C.

[0065] 1.3.6 Preparation of 0.2M EDTA.Na2 solution

[0066] Weigh 74.448 mg of EDTA.Na2 and dissolve it in deionized water to make up to 1 mL. Filter and store at 4°C.

[0067] 1.3.7 Preparation of 2 mg / mL PI solution

[0068] Dissolve 10 mg of PI in deionized water to 5 mL and store at -20°C.

[0069] 1.3.8 Preparation of 10% Triton X-100 solution

[0070] Dissolve 1 mL of Triton X-100 in 9 mL of deionized water and store at 4°C.

[0071] 1.3.9 Preparation of 50 mg / mL PI working solution

[0072]

[0073] 1.3.10 Preparation of 5 mg / mL MTS solution

[0074] Weigh 5 mg of MTS powder, dissolve it in PBS to 1 mL, filter it and store it at -20℃ in the dark.

[0075] 2. Experimental methods

[0076] 1) Chemicals

[0077] Squamocin was isolated from Annona mume seeds according to the reported method, and its structure was identified by ESI-MS and NMR. Squamocin (20 mg / mL), EPZ-6438 (100 mM, Selleck, #S7128), cycloheximide (CHX, 100 mg / mL, MedChemExpress, #HY-12320), MG132 (10 mM, MedChemExpress, #HY-13259), chloroquine (CQ, 10 mM, TargetMol, #T8689), ISRIB (10 mM, MedChemExpress, # HY-12495A), 4μ8C (10 mM, MedChemExpress, #HY-19707), CeapinA7 (10 mM, MedChemExpress, #HY-108434), rotenone (50 mg / mL, MedChemExpress, #HY-B1756) and mitto-tempo (10 mM, MedChemExpress, #HY-112879) were dissolved in DMSO as stock solutions. Before each experiment, the stock solutions were stored at -80°C and thawed immediately.

[0078] 2) Lentiviral transduction and RNA interference

[0079] The full-length human EZH2 (NM_001203247.2) and MYC (NM_001354870.1) cDNAs amplified by PCR were subcloned into pOZ-FH-C-puro plasmid (Addgene, #32516) or pRRLSIN.cPPT.PGK-GFP to obtain EZH2 and MYC plasmids. WPRE (Addgene, #12252). HNSCC cell lines were infected with lentivirus. EZH2 or MYC was fused with HA or Flag tags and cloned into pcDNA-3.1 plasmid (Umine Biotechnology Co., Ltd., #BVA03). After 48 h, the culture medium was removed and replaced with fresh culture medium containing 2 μg / mL puromycin (Solarbio, #P8230), and cells carrying the constructs were selected for another 2 weeks to enrich. Endogenous EZH2, MYC, UBA6, UBA1, UBE2Z, FBXW7, and RING1 were knocked down using small interfering RNA (siRNA) (Qingdao Biotechnology Co., Ltd., Beijing, China), and the sequences are shown in Supplementary Table S1. The transfected HNSCC cell lines were used for subsequent experiments.

[0080] 3) Plasmid construction

[0081] EZH2 or MYC was fused with HA or Flag tags and cloned into pcDNA-3.1 plasmid (Umine Biotechnology Co., Ltd, #BVA03). Sequence deletion constructs of EZH2 (Umine Biotechnology Co, Ltd, #BW2757) or MYC (Umine Biotechnology Co, Ltd, #BW2753) were generated by PCR and subcloned into pcDNA-3.1. Immunoprecipitation using anti-Flag (1:50; Cell Signaling Technology, #14793) or anti-HA (1:50; Cell Signaling Technology, #3724) was used to detect the interaction between Flag-MYC and HA-EZH2 in HEK293T cells.

[0082] 4) Cell viability and proliferation assay

[0083] 5×10 3 cells (100 μL suspension per well) and 2×10 3Cells (100 μL suspension per well) were plated in 96-well plates for cell viability assay. After 12 h, the corresponding drugs were used for treatment for the corresponding time, and DMSO without drug administration was used as a negative control. Cell viability was determined using CCK8 (HANBIO, #HB-CCK-8-500T). Briefly, 10 μL CCK8 solution was added to each well. After 2 hours of culture, the optical absorbance (A) at 450 nm was detected using a microplate reader (Model 680, BIO-RAD, USA). The average value of the absorbance values ​​of each well was taken to calculate the proliferation inhibition rate: inhibition rate = (1 absorbance of the experimental group / absorbance of the control group) × 100%. The half-maximal inhibitor concentration (IC50) value was determined using Prism.

[0084] 5) Colony formation assay

[0085] 800 cells / well were plated in 6-well plates. Cells were treated with the corresponding drugs 12 h later, and DMSO without drug administration was used as a negative control. Cells were cultured for 10 days. Colonies were washed twice with cold PBS, fixed with 4% paraformaldehyde for 20 min, and developed with 0.1% crystal violet (Solarbio, #G1062) for 30 min. The number of colonies with ≥50 cells was counted under a microscope.

[0086] 6) Flow cytometric analysis

[0087] PI / RNase staining buffer (BD Pharmingen TM , #550825) and FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen TM , #556547) to detect cell cycle and apoptosis. Cells were treated with the corresponding drugs for the indicated time, then harvested and washed twice with PBS. Cell cycle assay: Cells were fixed with 70% ethanol at 4°C overnight, then resuspended with 500μL PI / RNase staining buffer, incubated in the dark for 15min at room temperature (RT), and analyzed by flow cytometry. In the apoptosis experiment, cells were resuspended in 100μL 1X Annexin V Binding Buffer and incubated with 5μL FITCAnnexin V and 5μL PI at RT for 15min. 400μL of 1X Binding Buffer was added to each tube, and samples were analyzed by flow cytometry within 1h. Cell death detection includes early apoptotic cells (PI negative, Annexin v positive) and late apoptotic cells (PI positive, Annexin v positive).

[0088] 7) Western blot and protein half-life determination

[0089] Cells were lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (GenStar, #E125-01) with fresh addition of protease inhibitor phenylmethylsulfonyl fluoride (PMSF) (Fdbio science, #FD0100). Protein concentration was determined using bis-cholic acid (BCA) protein assay kit (GenStar, #E162-01). Equal amounts of protein lysates were loaded onto SDS-PAGE gels and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, #IPVH00010). Blots were blocked with 5% skim milk for 1 hour at RT and then incubated with primary antibodies overnight at 4°C. Appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies were incubated for 1 hour at RT. The protein concentrations were determined using ImageQuant TM Protein bands were visualized using the LAS 500 system (GE Healthcare Life Sciences, Japan). To determine the stability and half-life of proteins, cells were treated with 100 μg / mL CHX and collected at designated time points (0, 15, 30, 60, and 90 min), and then Western blots were performed using total cell lysate for the target proteins. Protein abundance density analysis was performed using ImageJ software to generate protein degradation curves. The antibodies used are listed in Supplementary Table S2.

[0090] 8) Real-time quantitative PCR (qRT-PCR)

[0091] Total RNA was isolated using TRIzol reagent (Ambion, #15596026) and converted to cDNA using PrimeScript RT reagent Kit with gDNA Eraser (Vazyme, #R323-01) according to the manufacturer's instructions. qRT-PCR was performed using SYBR Green PCR Master Mix (Vazyme, #Q331-02). The relative expression of genes was calculated according to the 2-ΔΔCT method. The sequences of the primers used are listed in Supplementary Table S3.

[0092] 9) Immunoprecipitation and ubiquitination analysis

[0093] Cells were collected and lysed on ice for 30 min in NP-40 lysis buffer containing the protease inhibitor PMSF. To detect ubiquitination, cells were treated with 10 μM of the proteasome inhibitor MG132 for 6 h before lysis. Cell lysates were centrifuged at 14,000 × g for 20 min at 4°C, and protein concentrations were determined using a BCA protein Assay Kit. 1 mg of protein was extracted from the lysate and incubated with anti-EZH2 (1:3000; Cell Signaling Technology, #5246S), anti-MYC (1:3000; Abcam, #ab32072), or anti-fbxw7 (1:2000; Abcam, #ab109617) with rotation overnight at 4°C. 1 mg of protein lysate was incubated with nonspecific IgG antibody as a negative control. Next, immune complexes were precipitated with 50 μL of protein G beads (Millipore, #16-266). After rotating at 4°C for 2 h, the cells were washed twice with a mixture of NP-40 lysis buffer and 2× SDS loading buffer and boiled at 95°C for 10 min. The coprecipitates were analyzed by chemiluminescent Western blot.

[0094] 10) Immunohistochemistry

[0095] Immunohistochemistry was used to detect the protein levels of EZH2 and MYC in 20 pairs of paraffin-embedded HNSCC specimens. Immunohistochemical staining was evaluated by two independent pathologists. The staining intensity of malignant cells was scored to analyze the protein expression level: + (no staining), ++ (weak staining), +++ (moderate staining), ++++ (strong staining). Intensity scores less than or equal to ++ were considered low expression, while scores greater than ++ were classified as high expression.

[0096] 11) Immunofluorescence

[0097] Cells cultured in confocal culture medium were washed twice with cold PBS and fixed with 4% paraformaldehyde (Biosharp, #143174) for 20 minutes at room temperature. They were then permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, #V900502) for 10 minutes, blocked with 5% bovine serum for 30 minutes at room temperature, and then incubated with primary antibodies for EZH2 (1:2000; Cell Signaling Technology, #5246S) and MYC (1:2000; HUABIO, #RT1149) at 4°C overnight. The cells were incubated with Alexa fluorescent-labeled goat anti-rabbit IgG (1:1000; Cell Signaling Technology, #4412) or goat anti-mouse IgG antibody (1:1000; Cell Signaling Technology, #8890) at RT for 1 h. The cell nuclei were counterstained with 4'6-diamidino-2-phenylindole (DAPI) dye (Cell Signaling Technology, #4083S). Fluorescence images were obtained using a laser confocal fluorescence microscope (Olympus, FV3000, Japan).

[0098] 12) Xenograft Model

[0099] Stably transfected with EZH2 vector or control vector (5×10 6 Cancer cells (100 cells, 0.1 mL PBS) were injected subcutaneously into the right dorsal flank of 4-week-old female Balb / c nude mice (SPF (Beijing) Biotechnology Co., Ltd.). After 12 days, when the tumor size reached about 100-150 cubic millimeters, PBS, EPZ-6438 (50 mg / kg) or squamocin (0.4 mg / kg) were injected intraperitoneally every 3 days. Tumor volume (mm 3 ) was measured with a caliper and calculated every three days during the experiment using the formula (length × width 2 ) / 2, where width and length represent the vertical and maximum tumor diameters, respectively. At the endpoint, the tumors were resected and weighed. The tumor inhibition rate (TIR%) was calculated as follows: TIR% = (1-Wt / Wn) × 100%, where Wn is the average tumor weight of the negative control group, and Wt is the average tumor weight of mice in the experimental group. The excised tissue was fixed with 10% neutral buffered formalin for histological examination. Animal care and experiments were carried out in strict accordance with the Principles of Vertebrate Animal Use and Care and the Guide for the Care and Use of Laboratory Animals, and were approved by the Animal Care and Use Committee of Southern Medical University (SMU-L2021121).

[0100] 13) Toxicology experiments

[0101] In evaluating the optimal dose of squamocin and rotenone for Wister rats, the median lethal dose of rapid tail vein injection for 7 days was evaluated. The lethal doses of rotenone were 100μg / mL and 400μg / mL, respectively. Secondly, one-fifth of the median lethal dose was selected as the highest dose of the experiment. Rats were intravenously injected with high doses of 80μg / kg, medium doses of 32μg / kg, or low doses of 12.8μg / kg of squamocin and high doses of 20μg / kg of rotenone every day for one week. At the end, the levels of ALT, AST, urea, and CREA in the blood were evaluated by biochemical analysis. The excised tissues were fixed with 10% neutral buffered formalin for histological examination.

[0102] 14) ChIP coupled with quantitative PCR analysis

[0103] Immunoprecipitation was performed using a ChIP assay kit (Cell Signaling Technology, #9003). SCC25 cells were cross-linked with formaldehyde and then H3K27me 3 Antibodies (1:50; Cell Signaling Technology, #9733) or rabbit IgG (1:50; Cell Signaling Technology, #2729). DNA fragments were purified and analyzed by quantitative PCR. ChIP-qPCR UNC5B primers: Forward, GAGTCCCAGTCCACCTGTTG; Reverse, CAGAGGTGAGGTGAAGGCAG.

[0104] 15) RNA sequencing and data analysis

[0105] Total RNA was first purified with TRIzol reagent and then identified by 1% agarose gel electrophoresis and Bioanalyzer 2100 system. Sequencing libraries were constructed using NEBNext ultra-atm RNA Library Prep Kit for Illumina. Clean reads were generated by removing low-quality reads and then aligned with Human Genome Assembly GRCh38 / hg38 using hisat2 v2.0.5 (https: / / github.com / DaehwanKimLab / hisat2). The reads of each gene were counted using featurecots v1.5.0-p3, and the number of fragments per kilobase per million (FPKM) of each gene was calculated based on the length of the gene and the read count of each gene. Differential gene expression analysis was performed using the R package DESeq2v1.16.1. The definition of differentially expressed genes (DEGs) is as follows, unless otherwise stated. DEGs were up-regulated, log2(foldchange)>0, FDR<0.05; DEGs were down-regulated, log2(fold change)<0, FDR<0.05. Gene ontology enrichment analysis was performed on the DEGs that were commonly up-regulated or down-regulated between SCC15 and SCC25 cells after squamocin (10μg / mL) treatment for 24h. Gene set enrichment analysis (GSEA) was performed using GSEA software (https: / / www.broadinstitute.org / gsea) by exploring the Molecular Signatures Database (https: / / www.broadinstitute.org / gsea / msigdb / annotate.jsp).

[0106] 16) Molecular docking

[0107] The molecular structure of squamocin was retrieved and downloaded from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ). Target fishing analysis was performed using the SwissTargetPrediction website (http: / / swisstargetprediction.ch / ). Computational docking models were constructed using the AutoDoc vina program. The protein structures of HSP90α (PDB: 2QG2) and other proteins were obtained from the Protein Data Bank (PDB, https: / / www.rcsb.org / ).

[0108] 17) Differential Scanning Fluorometry (DSF)

[0109] DSF experiments were performed using the Bio-Rad CFX ConnectTM real-time system. First, 13.7 μL Tris buffer (50 mM), 2 μL protein (9 μM), and 0.5 μL compound were added to each well, followed by 1.8 μL SYPRO Orange mixture (50 times). Thermal denaturation was achieved by increasing the temperature from 25°C to 100°C (0.5°C per minute).

[0110] 18) Surface Plasmon Resonance (SPR)

[0111] The binding affinity of squamocin to its target protein HSP90α was detected using GE Healthcare's Biacore 8k spr instrument. Using a CM5 sensor chip, 18,000 RU of the target protein was immobilized on the sensor surface by a standard amine coupling reaction in PBS running buffer at 25°C. Gradient concentrations of squamocin containing 5% DMSO were injected into the channel to evaluate its binding affinity. The dissociation constant (KD value) of the squamocin-HSP90α complex was calculated using the Biacore 8k evaluation software. The results were fitted using a kinetic method. Kinetic Chi 2 (RU2)=1.93; ka(1 / Ms)=1561.36; Kd(1 / s)=0.03).

[0112] 19) Cellular thermal shift assay (CETSA)

[0113] 293T cells were transfected with HSP90αWT (wild type) / HSP90α mutant (N51A, G97A, F138K, Y139R) pcDNA3.1-3×Flag-C plasmid using Lipo3000 for 48 h, incubated with squamosin for 6 h, and then divided into equal volumes into PCR tubes and incubated for 3 min at 40-64°C with a gradient of 3°C. After freezing and thawing in liquid nitrogen three times, the supernatant was collected for Western blot.

[0114] 20) Patient-derived xenograft (PDX) mouse models

[0115] Tumor tissue used to prepare the PDX mouse model was initially resected from CRC patients with signed consent for use in preclinical studies. Briefly, under anesthesia and aseptic conditions, a small incision was made in the abdominal skin of NSG mice. Next, the collected tumor fragments were placed in a cavity under the skin and the wound was then sutured. This instance was considered generation 0 of the PDX mouse model. When the tumor reached a volume of 1500 cubic millimeters, it was resected and then re-implanted into the mouse following the same procedure until the third generation. At this point, whole exome sequencing demonstrated that the model was considered stable and growth after re-implantation could be guaranteed. Tumor volume (mm 3 ) was measured with a caliper and calculated every three days during the experiment. The calculation formula is (length × width 2 ) / 2.

[0116] 21) Statistical analysis

[0117] Statistical analysis was performed using IBM SPSS Statistics 26. Data are presented as mean ± SEM. Comparisons between two groups were performed using two-tailed Student's t test, while statistical significance between three or more groups was calculated using two-way analysis of variance. Differences in expression of each molecule in the ranked data were calculated using the Wilcoxon paired signed rank test. Survival data were plotted as Kaplan-Meier curves, and significance was estimated using the log-rank test. p values ​​(two-sided) < 0.05 were considered statistically significant. ns, ***p < 0.05, p < 0.01, ***p < 0.001.

[0118] 3.2 Experimental Results

[0119] 1) Squamocin inhibits the proliferation of HNSCC cell lines with high MYC expression

[0120] We found that squamocin has different effects on cells with different MYC expression levels. It has a strong inhibitory effect on HNSCC cell lines with high MYC expression levels (CAL27, FADU, SCC15, and SCC25), but has a weaker effect on non-cancerous cell lines with low MYC expression levels (NOK and HUVEC). Figure 1 A). Next, SCC15 and SCC25 were treated with squamocin at a dose of 5-20 μg / mL for 12, 24, and 48 h, respectively. Therefore, we found that squamocin had a significant dose- and time-dependent inhibition of cell viability in both HNSCC cell lines ( Figure 1 B). Calculate the maximum inhibitory concentration (IC50) of SCC15 (IC50 = 11.65 μg / mL) and SCC25 (IC50 = 10.85 μg / mL) ( Figure 1 B). Squamocin treatment significantly reduced the number of colonies in SCC15 and SCC25 cells. Cell cycle analysis showed that 10 μg / mL squamocin blocked the cell cycle in S phase and G2 / M phase in SCC15 cells, but only blocked the cell cycle in S phase in SCC25 cells ( Figure 1 C).

[0121] 2) Squamocin inhibits mitochondrial respiratory complex I

[0122] It has been reported that squamocin inhibits mitochondrial respiratory complex I, thereby impeding mitochondrial oxidative phosphorylation and inducing apoptosis. To investigate whether the proapoptotic activity of squamocin is attributed to its inhibition of mitochondrial respiratory complex I, we evaluated the effect of squamocin on mitochondrial function in two HNSCC cell lines. As expected, squamocin significantly inhibited the activity of mitochondrial respiratory complex I and reduced ATP production ( Figure 2 A). When these cells were pretreated with the mitochondria-specific antioxidant mito-TEMPO, ATP depletion was partially restored ( Figure 2 B). In addition, squamocin increased the levels of reactive oxygen species (ROS) in both HNSCC cell lines; whereas, when these cells were pretreated with mito-TEMPO, ROS accumulation was significantly inhibited ( Figure 2 C). These data confirm that squamocin impairs the function of mitochondrial respiratory complex I in HNSCC cells. However, unexpectedly, flow cytometry showed that pretreatment of the two HNSCC cell lines with mito-TEMPO (10 μM or 100 μM) only partially inhibited squamocin-induced apoptosis ( Figure 2D), suggesting that there may be other mechanisms mediating the antitumor effects of squamocin.

[0123] HSP90α is a direct binding target of squamocin

[0124] To address this issue, we performed a target fishing analysis using the SwissTargetPrediction database and identified 100 potential protein targets of squamocin (Table S1). Subsequently, we performed protein-protein interaction analysis to investigate the key proteins between these targets and screened the nodes with the highest confidence level (0.900) using the STRING database ( Figure 3 A). Using the Autodockvina program, molecular docking analysis of the top 10 proteins and squamocin was performed, and it was found that the binding energy of squamocin to the n-segment peptide chain fragment of the 90kDa heat shock protein (HSP90α, encoded by HSP90AA1, Table S1) was the lowest. HSP90α is an ATPase-directed molecular chaperone, one of the most abundant cytoplasmic molecular chaperones, and plays an important role in regulating protein homeostasis. The docking results showed that squamocin and HSP90α have a strong affinity for each other at Asn51 Gly97 Phe138 and Tyr139 Conventional hydrogen bonding ( Figure 3 B, Figure 3 C). To verify the computational docking results, we used differential scanning fluorimetry (DSF) and surface plasmon resonance (SPR) analysis to evaluate the binding ability of squamocin to HSP90α. In the DSF experiment, squamocin showed a thermal shift (ΔTm1) from 2.5°C to 9.5°C, and in the SPR experiment, the KD value was 1.9×10-5M ( Figure 3 D, Figure 3 E).

[0125] 3) Cellular thermal shift assay (CETSA) and knockdown experiments to verify the binding of squamosin to HSP90α

[0126] To verify the predicted binding mode, we constructed an HSP90α-mutant of N51A / G97A / F138K / Y139R and reassessed its binding ability using a cell-based thermal shift assay (CETSA). The results showed that this mutant abolished the binding of squamocin to HSP90α ( Figure 4 A), indicating that HSP90α is a direct target of squamocin. Importantly, we found that knockdown of HSP90α reduced the sensitivity of HNSCC cell lines to squamocin ( Figure 4 B). We also found that knockdown of HSP90α led to a decrease in EZH2 and MYC protein levels in SCC15, suggesting that HSP90α is involved in the stabilization of EZH2 and MYC. These results suggest that squamosin-induced degradation of EZH2 and MYC may be primarily dependent on HSP90α.

[0127] 4) Squamocin inhibits tumor growth in HNSCC mainly in an EZH2-dependent manner

[0128] Since EZH2 can regulate MYC expression at the transcriptional level or promote MYC stabilization as a non-PCR2 partner in several tumors, we were prompted to investigate whether squamocin treatment would also affect EZH2 levels in both HNSCC cell lines. Notably, squamocin reduced the steady-state protein level of EZH2 in a dose-dependent manner without affecting the mRNA level of EZH2 ( Figure 4 C), suggesting that squamocin regulates EZH2 through a post-transcriptional mechanism. After depletion of EZH2 by squamocin, global H3K27me3 (a marker of EZH2 deposition) and MYC levels were also reduced in a dose-dependent manner ( Figure 4 C), depletion of EZH2 and MYC occurred in both cytoplasmic and nuclear fractions ( Figure 4 D). Importantly, overexpression of EZH2 largely rescued squamocin-induced inhibition of proliferation as assessed by CCK8 and colony formation assays ( Figure 4 E, F). Flow cytometry showed that EZH2 overexpression alleviated squamocin-induced cell cycle arrest and apoptosis. Collectively, these findings suggest that squamocin inhibits tumor growth in HNSCC primarily in an EZH2-dependent manner.

[0129] 5) EZH2 and MYC have a synergistic effect in the progression of HNSCC

[0130] Immunofluorescence analysis showed that EZH2 and MYC colocalized mainly in the nuclei of SCC15 and SCC25 cells, and upregulation and loss of EZH2 similarly abolished the nuclear accumulation of MYC ( Figure 5 A). In addition, reciprocal co-immunoprecipitation (Co-IP) confirmed the interaction between EZH2 and MYC in two HNSCC cell lines ( Figure 5 B). We found that the MYC central domain (CD) and Y-like protein binding region (CDYL BR) of EZH2 are responsible for their direct interaction ( Figure 5 CE). These results indicate that MYC is a bona fide interacting partner of EZH2.

[0131] 6) EZH2 enhances the transcriptional activity of MYC

[0132] Next, we investigated the effects of EZH2 on MYC protein stability and transcriptional activity. Notably, time course experiments showed that forced expression of EZH2 prolonged the half-life of endogenous MYC protein from 53.7 to 81.3 minutes, whereas knockdown of EZH2 accelerated MYC protein turnover, shortening its half-life from 58.1 to 24.4 and 22.3 minutes ( Figure 6 A). In addition, MYC deficiency caused by EZH2 loss can be effectively restored by the proteasome inhibitor MG132 ( Figure 6 B), indicating that ablation of EZH2 stimulates proteasomal degradation of MYC. A well-characterized event in MYC degradation involves sequential phosphorylation of two key residues, serine 62 (p-S62) and threonine 58 (p-T58), which lead to stabilization and destabilization of MYC, respectively. Consistently, ectopic expression of EZH2 had little effect on p-S62 levels but significantly reduced p-T58 levels. Conversely, depletion of EZH2 resulted in a significant increase in p-T58 levels ( Figure 6 C). In addition, MYC target genes such as TP53, BMI1, PCNA, and CCND1 were significantly upregulated in EZH2-overexpressing SCC15 cells, but downregulated in EZH2-deficient SCC25 cells ( Figure 6 D), indicating that EZH2 enhances the transcriptional activity of MYC.

[0133] 7) Squamocin effectively inhibits EZH2 methyltransferase activity and promotes MYC degradation in HNSCC

[0134] Due to the reduction of H3K27me3 levels caused by squamocin ( Figure 4 C, D), we hypothesized that it might inhibit the enzymatic function of EZH2. We treated two HNSCC cell lines with 10 μg / mL squamocin or 25 μM (14 μg / mL) of EPZ-6438, the first EZH2 enzyme inhibitor approved by the US Food and Drug Administration (FDA). Notably, although EPZ-6438 and squamocin showed comparable efficacy in inhibiting H3K27me3 levels, only squamocin significantly inhibited the accumulation of MYC protein ( Figure 7A). To further investigate the methyltransferase activity of EZH2, we performed transcriptomic analysis to assess H3K27me3 response to squamocin. In SCC15 and SCC25 cells, squamocin treatment was compared with DMSO control, revealing a set of common differentially expressed genes (DEGs) with a false discovery rate (FDR) < 0.05, including 3256 upregulated genes and 2770 downregulated genes ( Figure 7 B). As expected, several canonical EZH2-PRC2 target genes that are transcriptionally repressed by H3K27me3, such as UNC5B, SMAD7, and GPRC5C, were significantly upregulated after treatment of the SCC25 cell line with squamocin ( Figure 7 C). Consistent with this, ChIP-qPCR assay confirmed that the overall enrichment of H3K27me3 on the UNC5B promoter was reduced in SCC25 cells due to squamocin treatment ( Figure 7 D, E). Given the striking effect of squamocin on MYC degradation, we investigated whether squamocin modulates the transcriptional activity of MYC. Our RNA-seq data revealed that the expression program of MYC-inactivated genes was upregulated, whereas the expression program of MYC-activated genes was downregulated in SCC15 and SCC25 cells after squamocin treatment. qRT-PCR confirmed the inhibitory effect of squamocin, but not EPZ-6438, on MYC-activated targets. Collectively, these results indicate that squamocin effectively depletes the EZH2 histone methyltransferase and its non-catalytic binding partner MYC in HNSCC cell lines.

[0135] 8) Transcriptomic analysis found that squamocin treatment led to significant upregulation of ER stress and UPR

[0136] MYC-hyperactivated tumor cells display enhanced activation of the UPR in multiple human cancers. Consistent with this notion, sustained, non-lethal UPR signaling was demonstrated in both in vitro and in vivo models of HNSCC, representing a potential therapeutic target, namely that cancer cells with a constitutively active UPR are hypersensitive to additional ER stress, which could trigger apoptosis. Importantly, we observed that squamocin not only inhibited mitochondrial respiratory complex I, leading to increased reactive oxygen species (ROS) and decreased ATP levels, but also disrupted the binding of HSP90α and ATP, which synergistically promote ER stress and UPR. As expected, gene ontology (GO) analysis revealed that common upregulated DEGs were significantly enriched in “response to ER stress” and “response to unfolded protein (UPR)” ( Figure 8A). Gene set enrichment analysis (GSEA) confirmed that squamocin treatment led to significant upregulation of ER stress and UPR ( Figure 8 B).

[0137] Using specific inhibitor blockers, we confirmed that squamocin activated ER stress and enhanced the degradation of ER-associated proteins in HNSCC cells.

[0138] In mammalian cells, the UPR is initiated by three ER transmembrane proteins that serve as sensors of ER stress: activating transcription factor 6 (ATF6), inositol-requiring enzyme 1α (IRE1α), and PRKR-like ER kinase (PERK). We consistently found that squamocin treatment enhanced the accumulation of three ER stress sensors, XBP1s, ATF4, and ATF6, in SCC15 and SCC25 cell lines, and blocking any of these sensors with specific inhibitors significantly attenuated squamocin-induced degradation of EZH2 and MYC ( Figure 8 C).

[0139] 9) Protein half-life and ubiquitination experiments confirm that EZH2 and MYC proteins are ubiquitinated and degraded by squamocin To determine which pathway is involved in squamocin-induced EZH2 and MYC degradation, we first performed a time course analysis and confirmed that squamocin significantly shortened the half-life of endogenous EZH2 and MYC proteins ( Fig. 9 A). Second, the proteasome inhibitor MG132 effectively rescued the decreased EZH2 and MYC protein levels; however, administration of the autophagy inhibitor chloroquine (CQ) did not produce similar results ( Fig. 9 B), indicating that squamocin-mediated degradation of EZH2 and MYC occurs through the UPS pathway. Third, ubiquitination experiments confirmed that both EZH2 and MYC proteins were ubiquitinated and degraded by squamocin in both HNSCC cell lines ( Fig. 9 C, D). Similar to siRNA depletion of EZH2 ( Figure 6 C), we also observed that MYC p-T58 was significantly increased after squamocin treatment in SCC15 and SCC25 cells ( Fig. 9 E).

[0140] qRT-PCR analysis results support that squamocin reprograms the UPS by triggering ER stress.

[0141] Typically, ubiquitination is achieved through a sequential enzymatic cascade of E1 activating enzymes (E1), E2 conjugating enzymes (E2), E3 ligases (E3), and deubiquitinases (DUBs), revealing the specific molecular mechanisms mediated by squamosins. We analyzed the global UPS in RNA-seq data. Notably, many human ubiquitinase genes were upregulated by squamosin. We validated the RNA-seq results by qRT-PCR analysis of two HNSCC cell lines, which showed that squamosin significantly upregulated a set of key UPS genes, including E1s (UBA6), E2s (UBE2Z, UBE2B, UBE2E2, UBE2E3, and UBE2S), and E3s (FBXW7).

[0142] 10) Knockout experiments indicate that the UBA6-UBE2Z cascade is responsible for squamocin-induced EZH2 and MYC protein degradation

[0143] We found that UBA6 was co-regulated in both HNSCC cell lines, whereas UBA1 was co-regulated, and knockdown of UBA6 abolished squamocin-mediated ubiquitination and degradation of EZH2 and MYC ( Fig.10 A). This suggests that squamocin activates the UPS through UBA6 rather than UBA1 in HNSCC cells. Since UBE2Z (UBA6-specific E2s) was significantly co-upregulated in both squamocin-treated HNSCC cell lines, we next investigated whether UBE2Z could mediate the degradation of EZH2 and MYC. The results showed that squamocin failed to reduce the levels of EZH2 and MYC in UBE2Z-knockout HNSCC cell lines ( Fig.10 B), indicating that enhancement of the UBA6-UBE2Z cascade is responsible for squamocin-induced EZH2 and MYC protein degradation.

[0144] 11) Heat map cluster analysis showing the downstream E3 ligases that EZH2 may bind

[0145] Heat map cluster analysis showed that DUBs (USP28, USP37, USP33, and USP22), BTRC, and SKP2 were downregulated, which could stabilize EZH2 or MYC, whereas E3s responsible for degrading EZH2 or MYC, including NEDD4L, PML, FBXO8, FBXW7, and RING1, were increased by squamocin.

[0146] 12) qRT-PCR and knockout experiments confirmed that FBXW7 binds to EZH2 and MYC

[0147] qRT-PCR results showed that after squamocin treatment, the e3 expression of FBXW7 and RING1 was most significantly upregulated ( Fig.10 C). Using specific siRNAs, we observed that knockdown of FBXW7 significantly blocked squamocin-induced degradation of EZH2 and MYC ( Fig.10 D), however, knocking out RING1 had little effect ( Fig.10 E), indicating that squamocin degrades EZH2 and MYC mainly in a FBXW7-dependent manner. Co-IP assay confirmed the binding of FBXW7 to EZH2 and MYC.

[0148] 13) Squamocin inhibits the EZH2 / MYC axis in various tumors

[0149] To investigate whether squamocin could inhibit tumor growth in vivo by targeting the EZH2-MYC axis, we established a nude mouse xenograft model of HNSCC with stable overexpression of EZH2. Mice bearing SCC15 tumors with EZH2 overexpression or control were intraperitoneally injected with phosphate-buffered saline (PBS), EPZ-6438, or squamocin every 3 days for a total of 5 times. Consistently, overexpression of EZH2 led to a significant increase in tumor volume and weight, which was effectively abolished by treatment with EPZ-6438 or squamocin ( Fig.11 AC). The tumor growth inhibition rate (TIR) ​​of squamocin and EPZ-6348 was 84.06% and 65.22%, respectively. Immunohistochemical staining of xenografts showed that EZH2 overexpression was accompanied by increased levels of Ki67, H3K27me3, and MYC. Similar to EPZ-6438 treatment, squamocin significantly reduced the expression of EZH2, Ki67, and H3K27me 3 , but only tumors treated with squamocin showed significant MYC loss ( Fig.11 D). Collectively, these results highlight the potential advantage of squamocin in degrading MYC over inhibitors targeting the enzymatic function of EZH2, suggesting that squamocin inhibits not only the catalytic activity of EZH2 but also its atypical activity.

[0150] Subsequently, we evaluated the effects of squamocin in other in vivo tumor models. The antitumor efficacy of squamocin was evaluated by AGS and SW480 xenograft models, and the results showed that squamocin effectively inhibited tumor growth in both GC and CRC, with TIRs of 56.49% and 53.82%, respectively. In contrast, the TIRs of EPZ-6438 in GC and CRC were 32.7% and 27.43%, respectively ( Fig.11E, F). In addition, squamocin showed a good safety profile in the mouse model, as no obvious histological changes were observed in important organs such as the heart, liver, spleen, lung, and kidney.

[0151] In the present invention, we observed that a single compound of ACG, squamosin, disrupts cell cycle progression and induces apoptosis in tumor cells, leading to cellular responses including ER stress and global reprogramming of the UPS. To our knowledge, this is the first time that a functional link between squamosin and ubiquitination and degradation of ER-associated proteins has been identified. These tumor cell-intrinsic events induce a powerful tumor arrest in HNSCC through ubiquitination and degradation of EZH2 and its non-PCR2 partner MYC. The ubiquitination cascade composed of UBA6, UBE2Z, and FBXW7 may control squamosin-induced ubiquitination of EZH2 and its non-PCR2 partner MYC. PCR 2 partner MYC degradation. To investigate the drug target of squamocin, three drug target identification techniques were used to orthogonally confirm HSP90α as a direct target of squamocin. Mechanistically, squamocin not only inhibits mitochondrial respiratory complex I, leading to reduced ATP production and increased ROS accumulation, but also impairs the binding of HSP90α to ATP. These tumor cell-intrinsic events caused by squamocin together trigger the UPR and ER stress responses, leading to ERAD-mediated degradation of EZH2 and its non-PCR2 partner MYC and causing apoptosis. These observations reveal a novel ubiquitination cascade that regulates squamocin to EZH2 and its non-PCR2 partner MYC degradation and highlight the potential of squamocin as a therapeutic strategy.

[0152] In conclusion, our data elucidate the role of squamocin in inhibiting EZH2 and its non-PCR2 partner MYC and provide evidence for future clinical trials in HNSCC. Given the ubiquitous roles of EZH2 and MYC in tumorigenesis, this class of inhibitors will help accelerate the development of therapeutic approaches targeting EZH2-MYC-dependent cancers.

[0153] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of the annona lactone compound squamocin in the preparation of a drug for preventing and / or treating tumors, wherein: The tumor is head and neck squamous cell carcinoma, gastric cancer, and / or colorectal cancer.

2. The use according to claim 1, wherein: The tumor is head and neck squamous cell carcinoma.

3. The use according to claim 1, wherein: The tumor is gastric cancer.

4. The use according to claim 1, wherein: The tumor is colorectal cancer.

5. The use according to any one of claims 1 to 4, wherein: The dosage form of the drug is tablet, capsule, granule, solution, pill, suspension, enteric-coated tablet, sustained-release preparation, or effervescent tablet.

6. The use according to any one of claims 1 to 4, wherein: The application includes squamocin as an inhibitor targeting the UBA6-UBE2Z-FBXW7 ubiquitin cascade to degrade EZH2 and MYC pathways.

7. The use according to any one of claims 1 to 4, wherein: The application includes squamocin as an inhibitor targeting heat shock protein Hsp90α.

8. A drug for treating head and neck squamous cell carcinoma, gastric cancer, and / or colorectal cancer, characterized in that: Its active ingredients include the annona lactone compound squamocin.

Images