Use of ferrous sulfate in the preparation of a drug for treating intrahepatic cholestasis of pregnancy

Abstract

The application discloses application of ferrous sulfate in preparation of a medicine for treating intrahepatic cholestasis of pregnancy, and belongs to the field of medicines. The application finds that the use of ferrous sulfate can improve intrahepatic cholestasis of pregnancy, relieve liver and placenta damage, and on this basis, improve placenta function and offspring development. The application provides a new treatment means for preparing the medicine for treating intrahepatic cholestasis of pregnancy, applies ferrous sulfate to the drug development process related to intrahepatic cholestasis of pregnancy, and provides a new means and path for treating intrahepatic cholestasis of pregnancy.

Description

Technical Field

[0001] This invention relates to the application of ferrous sulfate in the preparation of drugs for treating intrahepatic cholestasis of pregnancy, and belongs to the pharmaceutical field. Background Technology

[0002] Intrahepatic cholestasis of pregnancy (ICP) is a liver condition limited to pregnancy, typically presenting with symptoms such as itchy skin, jaundice, and elevated bile acid levels. Although these symptoms and abnormal biochemical markers usually subside shortly after delivery, ICP is highly likely to recur in subsequent pregnancies or when using estrogen and progesterone for contraception. This condition not only increases the mother's risk of developing hepatobiliary diseases but also increases the likelihood of adverse perinatal consequences, such as fetal ischemia and hypoxia, premature birth, meconium staining, neonatal respiratory distress syndrome, and even stillbirth.

[0003] Currently, treatment strategies for intrahepatic cholestasis of pregnancy (ICP) mainly include: using topical moisturizers and oral antihistamines to temporarily relieve non-rash-related itching; using intestinal bile acid binders such as activated charcoal, guar gum, and cholestyramine to accelerate bile acid excretion and block its recirculation from the intestine to the liver; and using ursodeoxycholic acid (UDCA) and S-adenosylmethionine (SAMe) to detoxify bile acids or alter their solubility. However, these treatments only provide mild relief from itching symptoms in ICP patients and have no significant effect on improving intrahepatic cholestasis during pregnancy or preventing adverse perinatal consequences. There are currently no definitively effective treatments for potential complications during pregnancy such as miscarriage, fetal respiratory distress, and neonatal growth retardation.

[0004] Therefore, finding and screening effective drugs is particularly important for treating ICP and improving pregnancy outcomes. Summary of the Invention

[0005] To address the aforementioned problems, this invention has discovered that the use of ferrous sulfate can improve liver and placental damage caused by ICP, and on this basis, improve pregnancy outcomes.

[0006] Ferrous sulfate is primarily used as an iron supplement to treat and prevent iron-deficiency anemia. It is a common form of iron that is easily absorbed and utilized by the body. Iron deficiency leads to reduced hemoglobin synthesis, resulting in iron-deficiency anemia. Taking ferrous sulfate can quickly replenish iron, promote hemoglobin synthesis, and improve anemia symptoms. Appropriate ferrous sulfate supplementation can also help promote growth and development in children and improve their physical condition. However, there are currently no studies reporting the role of ferrous sulfate in the treatment of ICP (intracytoplasmic Spondylitis).

[0007] The first object of the present invention is to provide the use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a medicament for treating ICP.

[0008] In one embodiment, the symptoms of intrahepatic cholestasis of pregnancy include itching and elevated total bile acid levels.

[0009] In one embodiment, the drug is any pharmaceutically acceptable dosage form.

[0010] In one embodiment, the dosage form includes: tablets, oral liquids, injections, pills, powders, or capsules.

[0011] In one embodiment, the composition further contains excipients.

[0012] In one embodiment, the excipient is a pharmaceutically acceptable excipient; optionally, the excipient includes one or more of the following: probiotics, lactose, maltose, microcrystalline cellulose, carboxymethyl cellulose, hydroxypropyl methyl cellulose, starch, sucrose, glucose, aspartame, water, glycerin, whey protein powder, and chitosan oligosaccharides.

[0013] In one embodiment, the drug further comprises a drug carrier.

[0014] In one embodiment, the drug carrier comprises microcapsules, microspheres, nanoparticles, and / or liposomes.

[0015] A second object of the present invention is to provide a pharmaceutical composition for treating intrahepatic cholestasis of pregnancy, the pharmaceutical composition containing ferrous sulfate.

[0016] In one embodiment, the pharmaceutical composition further includes one or more of the following: S-adenosylmethionine, dexamethasone, Artemisia capillaris decoction, Smecta, Ursodeoxycholic acid, S-adenosylmethionine disulfate, Yin Zhi Huang oral liquid, and probiotics.

[0017] In one embodiment, the probiotics include one or more of Bifidobacterium, Lactobacillus, and Bacillus subtilis.

[0018] A third object of the present invention is to provide the use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a medicament for improving placental function and promoting vascular development in patients with intrahepatic cholestasis of pregnancy.

[0019] Beneficial effects:

[0020] This invention discovers that ferrous sulfate can improve ICP and alleviate liver and placental damage, thereby improving pregnancy outcomes. Specifically, administration of ferrous sulfate can: (1) significantly inhibit the abnormal increase of total bile acid (TBA) in ICP mice; (2) significantly improve liver damage in ICP mice and inhibit the abnormal increase of aspartate aminotransferase (AST) and alanine aminotransferase (AST) in the liver; (3) significantly improve placental blood flow in mice and increase placental weight, fetal weight, and fetal crown-rump length; and (4) significantly improve placental function-related mRNA in mice.

[0021] This invention provides a novel treatment method for ICP by applying ferrous sulfate to the development of ICP-related drugs, resulting in a better approach to treating ICP. This invention offers a completely new approach to ICP treatment, broadens the selection of drugs for ICP treatment, and contributes to the development of this technological field. Attached Figure Description

[0022] Figure 1 A schematic diagram illustrating how ferrous sulfate reduces serum and placental TBA levels in mice, as well as liver AST and ALT activities, using serum and placental tissue levels, liver AST, and liver ALT as indicators.

[0023] Figure 2 A schematic diagram illustrating how ferrous sulfate improves the morphology of mouse liver and placenta, using H&E staining of the liver and placenta, the area of ​​liver lipid droplets, and the area of ​​blood sinuses as indicators.

[0024] Figure 3 A schematic diagram showing how ferrous sulfate improves placental function in mice, using placental weight, fetal mouse weight, and crown-rump length as indicators, along with gross images of fetal mice after cesarean section.

[0025] Figure 4 A schematic diagram of mRNAs related to ferrous sulfate's ability to improve mouse placental function. Detailed Implementation

[0026] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0027] raw material:

[0028] Ferrous sulfate was purchased from Shanxi Lijiu Pharmaceutical Co., Ltd., and C57BL / 6 mice were all obtained from the Experimental Animal Center of Jiangnan University.

[0029] Detection method:

[0030] 1. Biochemical indicator testing

[0031] The AST content in liver tissue was detected using an aspartate aminotransferase (AST) assay kit (Nanjing Jiancheng Company).

[0032] The ALT content in liver tissue was detected using an alanine aminotransferase (ALT) assay kit (Nanjing Jiancheng Company).

[0033] The total bile acid assay kit (Nanjing Jiancheng Company) was used to detect the levels of TBA in serum, placenta, and liver tissue.

[0034] 2. Histopathological damage detection

[0035] Mouse placenta and liver tissue were first fixed by soaking in 4% paraformaldehyde, then dehydrated with a gradient of alcohol from 70% to 100%, and cleared with 100% xylene. After that, the tissue was placed in a paraffin bath for paraffin embedding, and finally paraffin sections were prepared. After staining with an H&E staining kit (Nanjing Jiancheng Company), the tissue was observed and photographed under a microscope.

[0036] Example 1: Application of ferrous sulfate in the treatment of ICP

[0037] The therapeutic effect of ferrous sulfate on ICP was tested through animal experiments. The specific methods are as follows:

[0038] 1. Animal experiments (constructing an ICP model by feeding the animal with a diet containing 0.5% w / w cholic acid (CA))

[0039] Experimental methods

[0040] One night before mating, mice were paired and caged at a female-to-male ratio of 3:1. The morning after mating, sperm were observed under a microscope via vaginal smears. Mice with a large number of motile sperm were considered successfully mated and this was recorded as day 1 of gestation. Pregnant mice were fed a normal diet until day 12.5 of gestation. Based on consistent body weight, they were divided into four groups: a normal group, a normal treatment group (Normal + 5 mg / kg FeSO4), a model group (0.5% CA), and a treatment group (0.5% CA + 5 mg / kg FeSO4). From day 12.5, the model and treatment groups were fed a diet containing 0.5% CA until the end of gestation to establish the ICP model. The treatment group received 5 mg / kg FeSO4 daily during model establishment. The control and normal treatment groups continued with a normal diet. The normal treatment group received 5 mg / kg FeSO4 daily starting from day 12.5. Pregnant mice underwent cesarean section on day 20.5 of gestation. Maternal serum and liver were collected to investigate the success of the ICP model. Placenta and fetal mice were collected to investigate the effect of intrahepatic cholestasis on pregnancy outcomes.

[0041] 2. Treatment efficacy testing

[0042] (1) TBA content and liver function

[0043] The levels of TBA in mouse serum and placental tissue, as well as liver AST and ALT activity, were measured, and the results are as follows: Figure 1 As shown in Table 1.

[0044] The results showed that the model group (0.5% CA) had a 216% increase in serum TBA and a 195% increase in placental TBA compared to the normal group. In contrast, the ferrous sulfate treatment group (0.5% CA + 5 mg / kg FeSO4) showed a 45% decrease in serum TBA and a 29% decrease in placental TBA compared to the model group, indicating that ferrous sulfate effectively inhibited the abnormal increase in TBA during ICP. In the model group (0.5% CA), AST and ALT levels in mouse liver tissue increased by 99% and 98% respectively. In the ferrous sulfate treatment group (0.5% CA + 5 mg / kg FeSO4), AST and ALT levels in mouse liver tissue decreased by 51% and 49% respectively compared to the model group, indicating that ferrous sulfate improved liver damage during ICP. There were no significant differences in any indicators between the normal treatment group and the normal group, indicating that 5 mg / kg FeSO4 did not cause harm to serum or liver.

[0045] Table 1. TBA content and AST activity

[0046]

[0047] (2) Pathological changes in the liver and placenta

[0048] AST / ALT ratios are important biomarkers for predicting liver function in patients with intracranial pneumonia (ICP). Detecting AST and ALT levels in liver tissue yields results as follows: Figure 2 As shown in Table 2.

[0049] The degree of vacuolation in mouse liver tissue and the area of ​​sinusoids in the placenta were measured, and the results are as follows: Figure 2 As shown in Table 2.

[0050] The results showed that in the model group (0.5% CA), H&E staining of the liver of mice revealed uneven arrangement of hepatic cords, pyknosis of cell nuclei, increased vacuolation of liver tissue, and a 98% increase in lipid droplet area. In contrast, compared to the model group, the treatment group showed more uniform arrangement of hepatic cords, reduced vacuolation and pyknosis of cell nuclei, and a 39% reduction in lipid droplet area. The model group (0.5% CA) showed a 32% decrease in placental sinus area; while the treatment group showed a 48% increase in sinus area, indicating that ferrous sulfate has an effect on improving liver tissue damage and placental vascularization in ICP. There were no significant differences in any indicators between the normal drug administration group and the normal control group, suggesting that 5 mg / kg FeSO4 did not cause damage to the liver and placental tissue.

[0051] Table 2. Liver lipid droplet area and placental sinusoidal area

[0052]

[0053] (3) Development of mouse offspring

[0054] The weight of the mouse placenta, the weight of the fetus, and the crown-rump length were measured, and the results are as follows: Figure 3 As shown in Table 3.

[0055] The results showed that in the model group (0.5% CA), placental weight decreased by 20%, fetal weight decreased by 34%, and crown-rump length decreased by 23%. In contrast, in the treatment group (0.5% CA + 5 mg / kg FeSO4), compared to the model group, placental weight increased by 27%, fetal weight increased by 28%, and crown-rump length increased by 19%, indicating that ferrous sulfate has an effect on improving placental function in ICP. There were no significant differences in any indicators between the normal treatment group and the normal control group, suggesting that 5 mg / kg FeSO4 did not cause harm to the placenta or fetuses.

[0056] Table 3 Placental function

[0057]

[0058] (4) Mouse placental function

[0059] The relative expression levels of mouse placental-associated mRNAs (Pgf, Fatp4, Glut1, Igf2, Snat2) were detected using RT-qPCR. The results are as follows: Figure 4As shown in Table 4.

[0060] The results showed that the relative mRNA expression levels of Pgf, Fatp4, Glut1, Igf2, and Snat2 were significantly lower than those in the normal group, only about half that of the control group. In contrast, in the treatment group (0.5% CA + 5 mg / kg FeSO4), the relative mRNA expression levels of Pgf, Fatp4, Glut1, Igf2, and Snat2 were significantly higher than those in the model group, indicating that ferrous sulfate has the effect of improving placental function in ICP.

[0061] The q-PCR primer sequences are as follows:

[0062] Pgf:

[0063] Upstream primer: AGTGGAAGTGGTGCCTTTCAA;

[0064] Downstream primer: GTGAGACACCTCATCAGGGTA;

[0065] Fatp4:

[0066] Upstream primer: ACTGTTCTCCAAGCTAGTGCT;

[0067] Downstream primer: GATGAAGACCCGGATGAAACG;

[0068] Glut1:

[0069] Upstream primer: TCAAACATGGAACCACCGCTA;

[0070] Downstream primer: AAGAGGCCGACAGAGAAGGAA;

[0071] Igf2:

[0072] Upstream primer: CGTGGCATCGTGGAAGAGT;

[0073] Downstream primer: ACGTCCCTCTCGGACTTGG;

[0074] Snat2:

[0075] Upstream primer: GGGACATAAGGCGTATGGTCT;

[0076] Downstream primer: GGTAGCTTGACATAGCCCCAA.

[0077] Table 4. Relative expression levels of placental function-related mRNAs

[0078]

[0079] Comparative Example 1: Increasing the dosage of ferrous sulfate failed to treat ICP.

[0080] This study also attempted to further supplement the iron deficiency in maternal mice by increasing the dosage of ferrous sulfate (FeSO4). The specific implementation method is the same as in Example 1, except that the dosage of ferrous sulfate was changed to 10 mg / kg. The results showed that when maternal mice were given 10 mg / kg of FeSO4, the vacuolation of the liver and the degeneration and necrosis of hepatocytes were not alleviated; in fact, the degeneration of hepatocytes was exacerbated. Simultaneously, this dosage of FeSO4 did not improve placental blood flow; instead, it led to a further reduction in sinusoidal area. Furthermore, we measured the birth weight, placental weight, and crown-rump length of offspring mice in this dosage group. The results showed that the birth weight and placental weight of the offspring mice were not improved, and the crown-rump length was actually reduced. Gross images of the offspring mice showed that this dosage did not show a significant improvement effect. Specific results are as follows: Figure 2 and Figure 3 As shown.

[0081] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. The use of ferrous sulfate or a composition containing ferrous sulfate in the preparation of a medicament for treating intrahepatic cholestasis of pregnancy, characterized in that, The dosage of the ferrous sulfate is 5 mg / kg.

2. The application according to claim 1, characterized in that, The symptoms of intrahepatic cholestasis of pregnancy include itching, elevated total bile acid levels, and elevated aspartate aminotransferase (AST).

3. The application according to claim 1, characterized in that, The drug can be any pharmaceutically acceptable dosage form.

4. The application according to claim 3, characterized in that, The dosage forms include tablets, oral liquids, injections, pills, powders, or capsules.

5. The application according to claim 1, characterized in that, The drug also contains excipients.

6. The application according to claim 5, characterized in that, The excipients are pharmaceutically acceptable; the excipients include one or more of the following: probiotics, lactose, maltose, microcrystalline cellulose, carboxymethyl cellulose, hydroxypropyl methyl cellulose, starch, sucrose, glucose, aspartame, water, glycerin, whey protein powder, and chitosan oligosaccharides.

Images