A glycosyltransferase ugt76g1 mutant and a method for catalyzing synthesis of rebaudioside m
By coupling the glycosyltransferase UGT76G1 mutant with sucrose synthase AtSUS, the problem of low yield of rebaudioside M was solved, achieving efficient catalytic synthesis, and the yield of mutant 101H10 was significantly increased.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- DONGTAI HAORUI BIOTECHNOLOGY CO LTD
- Filing Date
- 2024-05-29
- Publication Date
- 2026-06-05
AI Technical Summary
The yield of rebaudioside M in existing technologies is low and cannot meet the high market demand.
The glycosyltransferase UGT76G1 mutant was coupled with sucrose synthase AtSUS to catalyze the synthesis of rebaudioside M using rebaudioside D, UDPG and sucrose as substrates. The catalytic activity of the UGT76G1 mutant was improved by modifying it.
The efficient synthesis of rebaudioside M was achieved, with a significant increase in yield. The yield of mutant 101H10 was nearly 10 times higher than that of wild type, and the catalytic efficiency was significantly improved.
Smart Images
Figure CN119931982B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biocatalytic synthesis technology, and in particular to a glycosyltransferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside M. Background Technology
[0002] Rebaudioside M is a natural sweetener extracted from stevia and belongs to the steviol glycoside family. Compared to other common steviol glycosides, such as rebaudioside A, rebaudioside M is also very sweet and has a relatively good taste, close to sucrose, while being low in calories to almost zero. Therefore, it is often used as an additive in health and weight loss foods.
[0003] Rebaudioside M has undergone rigorous food safety assessments and is considered a safe food additive that can be used in the food and beverage industry to replace traditional sugars, reducing product calories without affecting sweetness. This helps diabetics and those trying to control their weight to reduce sugar intake. Furthermore, Rebaudioside M can, to some extent, avoid certain bitter or aftertastes, thus it is used in high-end food formulations to optimize taste and flavor.
[0004] However, the yield of rebaudioside M in existing technologies is relatively low and cannot meet the high market demand. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a glucose transferase UGT76G1 mutant and a method for catalyzing the synthesis of rebaudioside M, in order to overcome the problem of low yield of rebaudioside M in the prior art.
[0006] In a first aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, wherein the UGT76G1 mutant is any one of the following (A)-(C):
[0007] (A) A protein obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:
[0008] The 89th amino acid was mutated from M to H;
[0009] The 380th amino acid was mutated from L to M;
[0010] The 411th amino acid is mutated from A to Y;
[0011] (B) is a protein that has 95% or 98% or more of the same amino acid sequence as defined in (A) and has the same function;
[0012] (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).
[0013] Compared with the prior art, the glycosyltransferase UGT76G1 mutant provided by the present invention is obtained by screening for mutations of glycosyltransferase UGT76G1, and has higher catalytic activity, enabling efficient synthesis of rebaudioside M using rebaudioside D and UDPG as substrates.
[0014] Furthermore, the amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.3.
[0015] In a second aspect, the present invention provides a biomaterial comprising any one of the following:
[0016] (A) An expression gene that encodes the above-mentioned glycosyltransferase UGT76G1 mutant;
[0017] (B) A recombinant plasmid containing the expressed gene described in (A);
[0018] (C) A recombinant cell containing the recombinant plasmid described in (B) or the expressed gene described in (A).
[0019] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:
[0020] In SEQ ID NO.2, bits 265-267 are replaced with CAT instead of ATG;
[0021] In SEQ ID NO.2, bits 1138-1140 are replaced by ATG instead of CTC;
[0022] In SEQ ID NO.2, bits 1231-1233 are replaced with TAT instead of GCA;
[0023] Preferably, the sequence of the expressed gene is as described in SEQ ID NO.4.
[0024] Thirdly, the present invention provides an enzyme composition comprising the above-mentioned glycosyltransferase UGT76G1 mutant and sucrose synthase AtSUS;
[0025] Sucrose synthase AtSUS is either (B1) or (B2):
[0026] The amino acid sequence of (B1) is shown in SEQ ID NO.5;
[0027] Proteins that have 95% or 98% or more of the same amino acid sequence as (B1) and have the same function.
[0028] Fourthly, the present invention provides a method for synthesizing rebaudioside M using glycosyltransferase UGT76G1, characterized in that rebaudioside M is synthesized using the above-mentioned enzyme composition as substrates, with rebaudioside D, UDPG and sucrose as substrates.
[0029] Furthermore, in the catalytic reaction system, the concentration of rebaudioside D is 5~100mM, the concentration of UDPG is 0.1~5mM, the concentration of sucrose is 40~800mM, the amount of glycosyltransferase UGT76G1 mutant enzyme solution added is 0.1~50mL, and the amount of sucrose synthase AtSUS enzyme solution added is 0.1~50mL.
[0030] Furthermore, the preparation method of the glycosyltransferase UGT76G1 mutant enzyme solution includes the following steps:
[0031] (1) The coding gene of the glycosyltransferase UGT76G1 mutant was constructed into an expression vector to obtain recombinant plasmid A. Recombinant plasmid A was transformed into host bacteria to obtain recombinant strain A;
[0032] (2) The seed culture of recombinant strain A was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the concentration reaches 0.6-0.8, L-arabinose is added and the cells are induced and cultured at 25-40℃ for 8-40 hours. After centrifugation, the bacterial cells are collected and lysed. The supernatant is the glycosyltransferase UGT76G1 mutant enzyme solution. The inoculum size is 1 v / v %; the final concentration of kanamycin sulfate is 10-100 μg / mL; and the final concentration of L-arabinose is 0.1-15 mM.
[0033] Furthermore, the preparation method of sucrose synthase AtSUS enzyme solution includes the following steps:
[0034] (1) The AtSUS encoding gene of sucrose synthase was constructed into an expression vector to obtain recombinant plasmid B. Recombinant plasmid B was transformed into host bacteria to obtain recombinant strain B. The AtSUS encoding gene is shown in SEQ ID NO.6.
[0035] (2) The seed culture of recombinant strain B was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the concentration reaches 0.6-0.8, add L-arabinose and continue induction culture at 25-40℃ for 8-40h. Centrifuge, collect the bacterial cells and break them up. Centrifuge again, and the supernatant is the sucrose synthase AtSUS enzyme solution. The inoculum size is 1 v / v %; the final concentration of kanamycin sulfate is 10-100 μg / mL; and the final concentration of L-arabinose is 0.1-15 mM.
[0036] Furthermore, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.
[0037] Furthermore, in the catalytic reaction system, the pH value is 5.0~8.0, the temperature is 25~60℃, and the reaction time is 5~30h.
[0038] Compared with existing technologies, this invention couples the glycosyltransferase UGT76G1 mutant with sucrose synthase AtSUS dienzyme, using sucrose, UDPG, and rebaudioside D as substrates to catalyze the synthesis of rebaudioside M. In this process, UDPG is recycled, reducing substrate consumption. Furthermore, the fructose generated in the reaction can be quantitatively analyzed, indirectly measuring the activity level of the glycosyltransferase UGT76G1 mutant. Based on this characteristic, the glycosyltransferase UGT76G1 can be targeted for evolutionary modification to improve its catalytic activity. Attached Figure Description
[0039] Figure 1 To determine the yield of rebaudioside M (RM) under the catalysis of different glycosyltransferase UGT76G1 mutants.
[0040] Figure 2 The yield of lebodiin M (RM) varies with conversion time. Detailed Implementation
[0041] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.
[0042] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.
[0043] Example 1
[0044] Construction of recombinant Escherichia coli engineered strain AtSUS
[0045] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers, and the cDNA of the Arabidopsis-derived sucrose synthase gene atsus as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The sequence of the atsus gene fragment is shown in SEQ ID NO.6, and the amino acid sequence of the sucrose synthase atsus is shown in SEQ ID NO.5.
[0046] Inf-pYB1k-atsus-F: GCTAACAGGAGGAATTAACCATGGAAAATAAAACGGAGACC (SEQ IDNO.7)
[0047] Inf-pYB1k-atsus-R:
[0048] CCAGATCTACCCTCGAGTTACAACGATGAAATGTAAGAAAC (SEQ ID NO.8)
[0049] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibotek Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositolin Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020May 24;19(1):109. This pYB1k vector has been disclosed.)
[0050] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)
[0051] pYB1k-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)
[0052] The atsus gene was ligated into the expression vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-atsus.
[0053] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). The Gibson ligation product was added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.
[0054] Multiple single clones were selected for culture and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pYB1k-atsus.
[0055] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO. 11)
[0056] atsus-F300-R: CTTGTGGGTCGTTGTCGAGGATG (SEQ ID NO.12)
[0057] Escherichia coli BW25113 competent cells were prepared using the CaCl2 method. The plasmid pYB1k-atsus was transformed into the E. coli BW25113 competent cells, and then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing pYB1k-atsus were selected to obtain the recombinant E. coli engineered strain AtSUS.
[0058] Example 2
[0059] Construction of a recombinant Escherichia coli strain expressing wild-type glycosyltransferase UGT76G1
[0060] Based on the nucleotide sequence of the wild-type glycosyltransferase UGT76G1 from the NCBI database, Anhui General Biotechnology Co., Ltd. synthesized the full sequence and transferred it into the vector pET28a to obtain the recombinant expression vector pET28a-ugt76g1. (This expression vector was previously disclosed in PeiWang, Hai-Yan Zhou, Bo Li, Wen-Qing Ding, Zhi-Qiang Liu, Yu-Guo Zheng, Multiple modification of Escherichia coli for enhanced β-alanine biosynthesis through metabolic engineering, Bioresource Technology, Volume 342, 2021, 126050).
[0061] Using Inf-pYB1k-ugt76g1-F and Inf-pYB1k-ugt76g1-R as primers and pET28a-ugt76g1 as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ugt76g1 gene fragment.
[0062] Inf-pYB1k-ugt76g1-F: CTAACAGGAGGAATTAACCATATGGCCGAAAACAAGACCGA (SEQ IDNO.13)
[0063] Inf-pYB1k-ugt76g1-R: GTACCAGATCTACCCTCGAGTTACAAAGAGGAAATGTAAG (SEQ IDNO.14)
[0064] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment.
[0065] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)
[0066] pYB1k-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)
[0067] The ugt76g1 gene was ligated into the empty vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-ugt76g1.
[0068] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). Gibson ligation products were added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.
[0069] Multiple single clones were selected for culture and PCR verification was performed using primers pBAD-F and ugt76g1-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pYB1k-ugt76g1.
[0070] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO. 11)
[0071] ugt76g1-F300-R: CTGCAGTTCCAGTTCACGAC (SEQ ID NO.15)
[0072] Escherichia coli BW25113 competent cells were prepared using the CaCl2 method. The plasmid pYB1k-ugt76g1 was then transformed into the E. coli BW25113 competent cells, followed by plating on LB agar plates containing kanamycin and incubation overnight at 37°C. Positive clones containing pYB1k-ugt76g1 were selected; these were the recombinant E. coli expressing the wild-type glycosyltransferase UGT76G1.
[0073] Example 3
[0074] Construction of a library of glycosyltransferase UGT76G1 mutants
[0075] Wild-type glycosyltransferase UGT76G1 was randomly mutated using error-prone PCR to construct a mutant library. Using ugt76g1-ATG-F and ugt76g1-TAA-R primers and pYB1k-ugt76g1 plasmid as a template, ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA) due to its low-fidelity nature. The amplification system and procedure are shown in Tables 1 and 2.
[0076] ugt76g1-ATG-F: ATGGCCGAAAACAAGACCGA (SEQ ID NO.16)
[0077] ugt76g1-TAA-R:TTACAAAGAGGAAATGTAAG (SEQ ID NO.17)
[0078] Table 1 Error-prone PCR amplification systems
[0079]
[0080] Table 2 Commonly Misunderstood PCR Amplification Procedures
[0081]
[0082] After purification of the PCR product, the mutant gene fragment of UGT76G1 was obtained. These fragments were then ligated to the vector pYB1k using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT76G1 mutant gene. The Gibson ligation reaction system is shown in Table 3.
[0083] Table 3 Gibson linkage reaction system
[0084]
[0085] The reaction was carried out in a 50℃ water bath for 1 hour. The resulting plasmid containing the UGT76G1 mutant gene was then transferred to *E. coli* DH5α competent cells and cultured. The cells were then incubated in a shaker for 1 hour. After incubation, the cells were plated and incubated at 37℃ for 12 hours. After colony growth, five single-clone strains were randomly selected, and their plasmids were extracted and sequenced after culturing the bacterial culture. Subsequently, colonies were scraped from the plate with a glass rod to extract the plasmid library, which was stored at -20℃ for subsequent high-throughput screening of mutant libraries.
[0086] Example 4
[0087] High-throughput screening
[0088] After the random mutant library was constructed, single colonies were picked from the plate using a toothpick sterilized by high temperature and autoclave, and inoculated into a 96-well plate containing 800 μL of LB medium (containing kanamycin sulfate). The seed culture was obtained by shaking in a 96-well plate at 37°C and 900 rpm for 24 h.
[0089] Seed culture was collected using an inoculation needle and transferred to a new 96-well LB medium containing kanamycin sulfate (final concentration 50 μg / mL). The culture was incubated at 37°C and 900 rpm until OD was achieved. 600 When the pH value reached 0.6–0.8, L-arabinose was added to a final concentration of 1 mM, and the cells were induced and cultured for another 22 h in a 96-well plate at 30°C and 900 rpm. After induction, the cells were collected by centrifugation at 3000 × g for 20 min. Lysozyme solution was added to each well and mixed thoroughly to allow the lysozyme to fully act on the cells, lysing them and releasing the intracellular enzyme. After lysis, the cells were centrifuged at 3000 × g for 20 min at 4°C in a refrigerated centrifuge to obtain the glycosyltransferase UGT76G1 mutant enzyme solution, which was used for subsequent reactions.
[0090] Preparation of AtSUS enzyme solution: Seed culture of recombinant Escherichia coli strain AtSUS was collected using an inoculation needle and transferred to an Erlenmeyer flask containing 10 mL of LB medium, which also contained kanamycin sulfate (final concentration 50 μg / mL). The flask was incubated at 37℃ and 220 r / min in a shaker. When OD... 600 When the concentration reaches 0.6-0.8, L-arabinose with a final concentration of 1 mM is added, and the cells are cultured at 30℃ and 220 r / min for another 22 h. After centrifugation, the cells are collected and then sonicated to disrupt the cell structure. After centrifugation at 5000×g for 5 min, the sucrose synthase AtSUS enzyme solution is obtained.
[0091] Reaction system: 8 mM rebaudioside D, 48 mM sucrose, 1.6 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mL glycosyltransferase UGT76G1 mutant enzyme solution, 100 mM sodium phosphate buffer, mixed, pH of the reaction system is 8, reacted in a water bath at 37℃ for 6 h, and the reaction was terminated by heating for 5 min.
[0092] DNS assay procedure: The reaction product was centrifuged at 3000×g for 20 min at 4°C in a refrigerated centrifuge to obtain the reaction supernatant. 70 μL of the reaction supernatant and 210 μL of DNS were added to a clean 96-well plate, mixed well, and heated for 5 min to initiate the DNS colorimetric reaction. After cooling to room temperature, the plate was centrifuged at 3000×g for 18 min. 200 μL of the supernatant was transferred to a 96-well microplate, and the OD was measured using a microplate reader. 540 Numerical value. OD 540 The UGT76G1 mutant used in the reaction solution with the high value is the mutant with high activity, and it is then retested in a vial.
[0093] Small-bottle validation: OD was obtained after screening with a 96-well plate. 540 After obtaining mutants with high glycosyltransferase values, single colonies of the UGT76G1 mutant, wild-type UGT76G1 glycosyltransferase, and recombinant Escherichia coli strain AtSUS were picked and inoculated into test tubes, respectively. The tubes were then incubated in a shaker at 37°C and 220 rpm for 12 h to obtain seed culture. The seed culture was then inoculated into 20 mL LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a 1% volume ratio, and incubated again at 37°C and 220 rpm until OD was obtained. 600 L-arabinose was added to a final concentration of 1 mM at pH values of 0.6-0.8 for induction, and the cells were cultured at 30℃ and 200 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), and the cells were resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer. The cells were then lysed and centrifuged to obtain UGT76G1 mutant enzyme solution, wild-type UGT76G1 enzyme solution, and sucrose synthase AtSUS enzyme solution.
[0094] The reaction system consisted of 8 mM rebaudioside D, 48 mM sucrose, 1.6 mM UDPG, 0.5 mL UGT76G1 mutant enzyme solution or wild-type UGT76G1 enzyme solution, and 0.2 mL AtSUS enzyme solution. The solution was brought to a final volume of 10 mL with 100 mM sodium phosphate buffer. The pH of the reaction system was 8. The mixture was incubated in a water bath at 37°C for 6 hours, then the reaction was terminated by boiling for 5 minutes. After centrifugation at 10000×g for 2 minutes, the supernatant was used for the DNS reaction. The OD was then analyzed.540 The yield of rebaudioside M was verified by HPLC analysis of the reaction solution catalyzed by the mutant with a higher value than that of wild-type UGT76G1.
[0095] Filtering results:
[0096] After multiple initial screenings and vial rescreenings of the UGT76G1 mutant library, the inventors ultimately obtained four superior mutants from nearly 2000 mutants. These four mutants exhibited higher enzyme activities than the wild type, significantly improving the efficiency of catalyzing the synthesis of rebaudioside M from rebaudioside D. The yield results of rebaudioside M from the superior mutants in vial retesting are shown below. Figure 1 As shown in the figure. Among them, the yield of rebaudioside M in mutant 101H10 was nearly 10 times higher than that in the wild type. Sequencing revealed that the amino acid sequence of mutant 101H10 was obtained by the following mutations based on the amino acid sequence shown in SEQ ID NO.1: amino acid at position 89 was mutated from M to H, amino acid at position 380 was mutated from L to M, and amino acid at position 411 was mutated from A to Y.
[0097] Example 5
[0098] Scale-up study of the synthesis of rebaudioside M by the optimal mutant 101H10
[0099] Seed cultures of mutant 101H10 and sucrose synthase AtSUS were inoculated separately into 400 ml LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C with shaking at 220 rpm until OD was obtained. 600 When the α-graft ratio was 0.6-0.8, L-arabinose was added to two culture media to a final concentration of 1 mM for induction. The culture was carried out at 30℃ and 220 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the cells were lysed and centrifuged to obtain UGT76G1 mutant 101H10 enzyme solution and sucrose synthase AtSUS enzyme solution.
[0100] Reaction system: Rebaudioside D 20 mM, sucrose 120 mM, UDPG 1 mM, sucrose synthase AtSUS enzyme solution 10 mL, mutant 101H10 enzyme solution 10 mL, and sodium phosphate buffer to make up to 100 mL. The pH of the reaction system is 8. Reaction conditions: 37℃ for 16 h.
[0101] The reaction solution was sampled every 1 hour, and the yield of rebaudioside M was analyzed by HPLC as a function of conversion time. The results are as follows: Figure 2As shown, the optimal mutant 101H10 can convert 20 mM rebaudioside D (RD) into 17.2 mM rebaudioside M (RM) within 16 h, with an RD conversion rate of 86%.
[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A glycosyltransferase UGT76G1 mutant, characterized in that, The UGT76G1 mutant is any one of the following (A)-(B): (A) The protein obtained by making the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The 89th amino acid was mutated from M to H; The 380th amino acid was mutated from L to M; and, The 411th amino acid is mutated from A to Y; (B) A fusion protein obtained by attaching a tag to the end of the protein defined in (A).
2. The glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that, The amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.
3.
3. A biomaterial, characterized in that, The biomaterial includes any one of the following: (A) An expression gene encoding a mutant of the glycosyltransferase UGT76G1 as described in claim 1 or 2; (B) A recombinant plasmid containing the expressed gene described in (A); (C) A recombinant cell containing the recombinant plasmid described in (B) or the expressed gene described in (A).
4. An enzyme composition, characterized in that, The enzyme composition comprises the glycosyltransferase UGT76G1 mutant as described in claim 1 or 2 and sucrose synthase AtSUS; The amino acid sequence of the sucrose synthase AtSUS is shown in SEQ ID NO.
5.
5. A method for synthesizing rebaudioside M using glycosyltransferase UGT76G1 catalyzed by glycosyltransferase, characterized in that, Rebaudin M was synthesized using the enzyme composition of claim 4 as a substrate, with rebaudin D, UDPG and sucrose as substrates.
6. The method according to claim 5, characterized in that, In the catalytic reaction system, the concentration of rebaudioside D is 5-100 mM, the concentration of UDPG is 0.1-5 mM, the concentration of sucrose is 40-800 mM, the amount of glycosyltransferase UGT76G1 mutant enzyme solution added is 0.1-50 mL, and the amount of sucrose synthase AtSUS enzyme solution added is 0.1-50 mL.
7. The method according to claim 6, characterized in that, The preparation method of the glycosyltransferase UGT76G1 mutant enzyme solution includes the following steps: (1) The coding gene of the glycosyltransferase UGT76G1 mutant was constructed into an expression vector to obtain recombinant plasmid A. Recombinant plasmid A was transformed into host bacteria to obtain recombinant strain A; (2) The seed culture of recombinant strain A was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the concentration reaches 0.6-0.8, L-arabinose is added and the culture is continued at 25-40℃ for 8-40 hours. After centrifugation, the bacterial cells are collected and broken up. The supernatant is the glycosyltransferase UGT76G1 mutant enzyme solution. The inoculum volume of the seed culture is 1% by volume. The final concentration of kanamycin sulfate is 10-100 μg / mL. The final concentration of L-arabinose is 0.1-15 mM.
8. The method according to claim 6, characterized in that, The preparation method of the sucrose synthase AtSUS enzyme solution includes the following steps: (1) The AtSUS encoding gene of sucrose synthase was constructed into an expression vector to obtain recombinant plasmid B. Recombinant plasmid B was transformed into host bacteria to obtain recombinant strain B. (2) The seed culture of recombinant strain B was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the concentration reaches 0.6-0.8, L-arabinose is added and the culture is continued at 25-40℃ for 8-40 hours. After centrifugation, the bacterial cells are collected and broken up. After centrifugation, the supernatant is the sucrose synthase AtSUS enzyme solution. The inoculum volume of the seed culture is 1% by volume. The final concentration of kanamycin sulfate is 10-100 μg / mL. The final concentration of L-arabinose is 0.1-15 mM.
9. The method according to claim 7 or 8, characterized in that, The host bacteria are Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.
10. The method according to claim 5 or 6, characterized in that, In the catalytic reaction system, the pH value is 5.0~8.0, the temperature is 25~60℃, and the reaction time is 5~30h.