Application of Gossypium hirsutum GhHSTF2d Gene in Regulating Gossypol Synthesis in Cotton

Abstract

The present invention relates to the field of genetic engineering technology, and particularly to the application of genes in upland cotton GhHSTF2d in regulating gossypol synthesis in cotton. With the silencing of upland cotton GhHSTF2d , the expression levels of gossypol synthesis genes CDNC , CYP706B1 , CYP71BE79 , CYP82D113 , DH‑1 decrease extremely significantly, and the gossypol content in cotton leaves decreases significantly, indicating that upland cotton GhHSTF2d affects the biosynthesis of gossypol by regulating the expression of gossypol synthesis genes.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly to the application of genes in upland cotton GhHSTF2d in regulating the synthesis of gossypol in cotton. Background Art

[0002] Cotton is one of the main economic crops in the world. Its main product is fiber, and by-products include cotton seeds, etc. Cotton seeds are rich in protein and oil. If used as a food resource, the annual global cotton seed production can meet the protein needs of 500 million people every year. However, there are a large number of anti-nutritional substances, gossypol, in cotton seeds, which greatly limits the utilization of cotton seeds. On the other hand, the presence of gossypol helps protect cotton from pests and diseases, and it has been used as an anti-tumor drug and a contraceptive drug in clinical treatment.

[0003] Gossypol belongs to sesquiterpenoid compounds. Its biosynthesis starts from the mevalonate pathway (MVA pathway), starting with farnesyl pyrophosphate (FPP), and ends with the polymerization of two molecules of hemigossypol to form gossypol. The genes reported in the gossypol synthesis pathway mainly include CDNC, CYP706B1, CYP82D113, CYP71BE79, DH1, 2-OD-1, CYP736A196, and SPG, etc. A recent study successfully identified and characterized the key protein GhDIR5 that controls the biosynthesis of (+)-gossypol and (-)-gossypol in cotton. By using gene editing technology to remove (+)-gossypol, low-toxic or non-toxic cotton seeds were obtained with no significant impact on the insect resistance of cotton, opening up a new way for the asymmetric synthesis of complex natural products. Although the research on the synthesis pathway of gossypol is relatively clear, the low-gossypol plants obtained by knocking out the gossypol synthesis genes cannot be widely promoted due to their instability in the field. Cotton contains other terpenoid compounds such as hemigossypolone and gossyplure that share the synthesis pathway with gossypol. These substances have structures similar to gossypol and also have insect resistance.

[0004] Since plants are immobile, they have evolved complex and efficient molecular regulatory networks to resist or adapt to external stresses. Among them, the regulation of transcription factors plays a key role. Heat stress transcription factors (HSFs) play an important role in abiotic stresses, especially in response to high-temperature stress. Currently, multiple members of the HSFs transcription factor family have been identified in some plants. For example, SIHsfA2 plays an important role in different abiotic stress responses and tolerances in tomatoes; Arabidopsis thaliana AtHsfB1 and AtHsfB2, as inhibitors of heat-induced HSFs expression, regulate the heat tolerance of Arabidopsis thaliana; OsHsfA7 may participate in the response of transgenic rice to high salt or drought stress by regulating the target gene OsHsp24.1. In cotton, research on heat stress transcription factors also mainly focuses on drought or heat stress-related aspects. GhHRP affects the cotton heat stress response by finely regulating ethylene and auxin signal transduction; GhHSFA4a may regulate the resistance of cotton to Verticillium wilt by participating in the synthesis and signal transduction of secondary metabolites, but there is a lack of direct evidence for its regulation of secondary metabolite synthesis. Moreover, there are few reports on the regulation of secondary metabolite synthesis by heat stress transcription factors in other plants.

[0005] By verifying the function of GhHSTF2d in regulating gossypol biosynthesis in cotton, the present invention not only provides a new perspective on the function of heat stress transcription factors in the process of plant growth and development, but also draws a new pathway for the cotton gossypol synthesis regulatory network, providing a solid theoretical basis for the cultivation of low-gossypol cotton varieties. Summary of the Invention

[0006] To solve the above problems, the present invention provides upland cotton GhHSTF2d genes in the application of regulating cotton gossypol synthesis. With the silencing of upland cotton GhHSTF2d genes, the expression levels of gossypol synthesis genes CDNC , CYP706B1 , CYP71BE79 , CYP82D113 , DH- 1 decrease extremely significantly, and the gossypol content in cotton leaves decreases significantly, indicating that upland cotton GhHSTF2d affects gossypol biosynthesis by regulating the expression of gossypol synthesis genes.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides the application of upland cotton GhHSTF2d genes in regulating cotton gossypol synthesis.

[0009] Preferably, silencing the upland cotton GhHSTF2d genes negatively regulates cotton gossypol synthesis.

[0010] Preferably, silence of Gossypium hirsutum GhHSTF2d genes reduces the expression of gossypol synthesis genes.

[0011] Preferably, the gossypol synthesis genes include CDNC genes, CYP706B1 genes, CYP71BE79 genes, CYP82D113 genes and DH-1 one or several of the genes.

[0012] Preferably, the nucleotide sequence of the Gossypium hirsutum GhHSTF2d gene is as shown in SEQ ID No.1.

[0013] Preferably, the amino acid sequence of the protein encoded by the Gossypium hirsutum GhHSTF2d gene is as shown in SEQ ID No.2.

[0014] Advantages of the present invention:

[0015] With the silence of Gossypium hirsutum GhHSTF2d , the expression levels of gossypol synthesis genes CDNC , CYP706B1 , CYP71BE79 , CYP82D113 , DH-1 decrease extremely significantly, and the gossypol content in cotton leaves decreases significantly, indicating that Gossypium hirsutum GhHSTF2d affects the biosynthesis of gossypol by regulating the expression of gossypol synthesis genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0017] Figure 1 is the analysis of the expression pattern of the Gossypium hirsutum GhHSTF2d gene; A, analysis of the expression levels of GhHSTF2d in cotton roots, stems, leaves and flowers; B, WB verification results of the rabbit polyclonal antibody against GhHSTF2d, MW.peotein maker, GhHSTF2d antigen protein (24.54KDa); C, WB verification results of the rabbit polyclonal antibody against the GhHSTF2d protein;

[0018] Figure 2 is the subcellular localization result of the Gossypium hirsutum GhHSTF2d gene;

[0019] Figure 3 is the Gossypium hirsutum GhHSTF2dSilencing of the gene led to a decrease in gossypol content in cotton leaves; A. ClcrV:SU was used as the positive control, ClcrV:00 was used as the negative control, and ClcrV:GhHSTF2d was used as the experimental group; B. The first true leaves of 15 cotton seedlings just unfolded were injected and numbered 1 - 15. Among them, the expression level of GhHSTF2d in No. 4, 5, 6, and 7 decreased extremely significantly, and the expression level of GhHSTF2d in No. 8 and 9 decreased significantly; C. The expression level of gossypol synthesis genes; D. The free gossypol content in cotton leaves. Asterisks indicate significant differences. The detection method used Student's t - test (* P<0.05, ** P<0.01). Detailed implementation mode

[0020] The present invention provides upland cotton GhHSTF2d The application of the gene in regulating gossypol synthesis in cotton. In the present invention, the nucleotide sequence of the upland cotton GhHSTF2d gene is shown in SEQ ID No.1, specifically as follows:

[0021]

[0022] In the present invention, the upland cotton GhHSTF2d The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2, specifically as follows:

[0023] MNPYFPVKEEYPSSSYSQSDDDAPRMMELPQPVEGLHDSGPPPFLTKTFDMVDDPSTNYIVSWSSGGSSFIVWDPHSFSTNLLPRYFKHNNFSSFVRQLNTYGFRKIDSDKWEFANEGFVRGQRDLLKSIRRRKTTTSQLPTSQQALGPCVEVGRFGLDGEVDRLRRDNQVLTMELVKLRQQQLSTRAYIQAIEERLQCTEKKQQQMMSFLARAIQNPSFLQQLMQQKERTKDLEEAMSRKRMRPIVQLPLGVDVGESSRGSDGTNPVKTKPLEFGDYGYQVTELEALALEMQGYGRTRRGQEESQNGHEHRESHDKELDEGFWEELLNEKFLELDIPGTELARD。

[0024] In the present invention, silencing the upland cotton GhHSTF2d gene preferably negatively regulates the synthesis of gossypol in cotton. In the present invention, silencing the upland cotton GhHSTF2d gene preferably decreases the expression of gossypol synthesis genes. In the present invention, the gossypol synthesis genes preferably include CDNC gene, CYP706B1 gene, CYP71BE79 gene, CYP82D113 gene and DH-1 one or several of the genes.

[0025] To further illustrate the present invention, the present invention will be described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0026] Example 1

[0027] Cloning of cotton GhHSTF2d gene:

[0028] Extract the total RNA of the leaves, roots, stems of Gossypium arboreum L. cv. Zhongmian 24 seedlings grown for 14 days and the petals of the 5-10 days in the field flowering period (TIANGEN Biotech Co., Ltd. Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441)). The experimental method refers to the instructions in the kit, and then use MonScript™ RTIII Super Mix with dsDNase (Two-Step) purchased from Mona Biotechnology Co., Ltd. (Suzhou, #MR05201) to synthesize the first-strand cDNA. The specific steps are as follows:

[0029] 1. Prepare the following reaction system on ice:

[0030] Table 1 System

[0031]

[0032] 2. Gently mix and centrifuge briefly for 30 s on a small centrifuge;

[0033] 3. Incubate at 37°C for 2 min in a PCR instrument to eliminate genomic DNA contamination;

[0034] 4. Incubate at 55°C for 5 min to inactivate DNaseⅠ and temporarily place on ice.

[0035] (II) Synthesis of the first-strand cDNA

[0036] 1. Prepare the following reaction system on ice:

[0037] Table 2 System

[0038]

[0039] 2. Gently mix and centrifuge briefly for 30 s on a small centrifuge;

[0040] 3. Incubate at 50°C for 15 min in a PCR instrument;

[0041] 4. After the reaction is completed, incubate at 85°C for 5 min to terminate the reaction;

[0042] 5. Collect the cDNA solution obtained after the reaction is completed and store it in a -20°C refrigerator.

[0043] Using the above cotton cDNA as a template, clone the cotton GhHSTF2d gene.

[0044] (I) Primer design

[0045] Bioinformatics analysis of the gene number Ghicr24_A11G135000.1 (Zhong 24 database) and the nucleotide sequence of the coding region of GhHSTF2d, GhHSTF2dThe nucleotide sequence of the gene is shown in SEQ ID No.1. Its coding sequence is 1038bp in length, and its amino acid sequence is shown in SEQ ID No.2, including 345 amino acids. Primers were designed using Primer Premier 5.0, and the primer information is shown in the following table:

[0046] Table 3 Primers

[0047]

[0048] (II) Ordinary PCR Amplification and PAGE Electrophoresis

[0049] The high-fidelity amplification enzyme used for the gene was KOD-Plus-Neo purchased from Toyobo (Japan, KOD-401). The amplification system is shown in the following table:

[0050] Table 4 System

[0051]

[0052] Mix briefly by instantaneous centrifugation, and then perform PCR amplification on eppendorf nexus SX1. The procedure is as follows:

[0053] Pre-denature at 94°C for 2 min; denature at 98°C for 10 s, anneal at 58°C for 30 s, extend at 68°C for 2 min, for 35 cycles; extend at 68°C for 5 min.

[0054] The PCR amplification product was electrophoresed on a 10% agarose gel. During gel preparation, an appropriate amount of Gel Red staining solution was added. After 15 min at 220V, observe and take pictures on the gel imager of Bio-RAD company ( Figure 1 in A), where the DNA Maker is 2K (TransGen Biotech).

[0055] (III) Gel Extraction of the Target Gene

[0056] The kit used was the FastPure® Gel DNA Extraction Mini Kit purchased from Novoprotein (Nanjing, #DC301). The specific operation steps are as follows:

[0057] 1. After the PCR amplification product is electrophoresed, quickly cut off the gel with the target gene band under ultraviolet light while wearing eye protection. Try to cut off the excess part as much as possible and keep the band intact, and then add it to a clean 2 mL centrifuge tube.

[0058] 2. First, add 500 μL of Buffer GDP to the centrifuge tube, then place it in a water bath at 55°C for 10 min, and invert the centrifuge tube up and down during this period until the gel is completely melted.

[0059] 3. For the droplets on the wall of the instantaneous separation collection tube in the centrifuge, place the FastPure DNA Mini Columns-G adsorption column into a 2 mL Collection Tube. If the solution in the centrifuge tube is ≤700 μL, it can be completely added to the adsorption column, and centrifuge at 12,000 rpm for 1 min. If it is >700 μL, it can be added to the adsorption column in two portions. After the first centrifugation, put the adsorption column back into the collection tube and repeat centrifuging at 12,000 rpm for 1 min.

[0060] 4. Discard the waste liquid. First, put the adsorption column back into the collection tube, then add 300 μL of Buffer GDP, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min.

[0061] 5. Discard the waste liquid. First, put the adsorption column back into the collection tube, add 700 μL of Buffer GW (with appropriate amount of absolute ethanol added) into the adsorption column, and centrifuge at 12,000 rpm for 1 min.

[0062] 6. Repeat step 5.

[0063] 7. Discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge the empty tube at 12,000 rpm for 2 min.

[0064] 8. Put the adsorption column into a new 1.5 mL centrifuge tube, open the lid and let it stand at room temperature for a few minutes to completely evaporate the residual washing solution.

[0065] 9. Add 30 - 50 μL of Elution Buffer preheated in a 55°C water bath to the center of the adsorption column, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, then put the adsorption column back into the centrifuge tube, re-add the solution at the bottom of the tube to the adsorption column, let it stand and centrifuge again, and store the collected DNA in a -20°C refrigerator.

[0066] Use fluorescence quantitative experiments to analyze the high and low expression levels of the GhHSTF2d gene in cotton roots, stems, leaves and flowers ( Figure 1 in B), and the specific method is as follows:

[0067] The reagents used are Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix from Yeasen Biotech Co., Ltd. (Shanghai, #11184ES08). The PCR system is as follows:

[0068] Table 5 System

[0069]

[0070] The PCR reaction was carried out on a LightCycler 480 Ⅱ (Roche) system, and the procedure was as follows:

[0071] Table 6 Procedure

[0072]

[0073] The primer information used was as follows:

[0074] qPCR-GhHSTF2d-F (SEQ ID No.3): TCTCAGCTCCCAACATCTCAAC;

[0075] qPCR-GhHSTF2d-R (SEQ ID No.4): CTGCTGCTTCTTTTCTGTGCAT;

[0076] The quantitative results were as shown in Figure 1 B below. The gene had a relatively high expression level in cotton leaves. A polyclonal antibody against the GhHSTF2d protein was prepared in live rabbits (relevant experiments were conducted by Wuhan Pujian Biotechnology Co., Ltd.), and the results were as shown in GhHSTF2d C below. The size of the GhHSTF2d protein was approximately 24.54 KDa. Figure 2

[0077] Example 2

[0078] Subcellular localization of the GhHSTF2d gene:

[0079] The coding region sequence of GhHSTF2d was cloned into the plant expression vector pBI21 to obtain the p35S- GhHSTF2d -eGFP vector (constructed and synthesized by Shanghai Sangon Biotech Co., Ltd.). The constructed vector was transformed into Agrobacterium tumefaciens GV3101 (Vidi, AC1001). The specific steps were as follows:

[0080] 1. Add 0.01 - 1 μg of the pCAMBIA2300 plasmid to 100 μL of Agrobacterium competent cells, gently pipette the bottom of the tube to mix, incubate on ice for 5 min, treat with liquid nitrogen for 5 min, incubate in a water bath at 37°C for 5 min. To improve the transformation efficiency, the operation can be repeated once, and finally incubate on ice for 5 min.

[0081] 2. Under sterile conditions, add 700 μL of LB liquid medium without added antibiotics, invert and culture in a constant temperature incubator at 28°C with shaking at 220 rpm for 2 - 3 h.

[0082] ​3. Centrifuge at 6000 rpm for 1 min, then aspirate a portion of the supernatant in a laminar flow hood and leave about 100 μL of LB liquid medium. Resuspend the cell pellet and spread it on an LB solid medium plate containing 50 μg / mL kanamycin and 50 μg / mL rifampicin resistance, and culture it in an incubator at 28°C for 2 - 3 d.

[0083] Then culture the obtained GV3101 strain in an LB medium containing 50 μg / mL kanamycin (Solarbio, K8020) and 50 μg / mL rifampicin (Solarbio, R8011) at 200 r / min in a shaker at 28°C for 16 h. Centrifuge the cultured bacterial solution in a centrifuge (eppendorf, 5424R) at 5000 rpm for 10 min. Resuspend the obtained pellet with a resuspension solution of 10 mmol / L MgCl2 (Sangon Biotech, B300598), 10 mmol / L 2-(4-morpholino) ethanesulfonic acid (Solarbio, M8010), and 150 μmol / L acetosyringone (Sangon Biotech, A601111), and adjust the OD 600 value to 1.0. Inject the tobacco leaves and culture them in the dark for 16 h, then culture them under light at 28°C for 48 h, and observe the fluorescence under a laser confocal microscope. The experiment has three independent biological replicates.

[0084] The results are as Figure 2 shown, and GhHSTF2d may be localized in the nucleus and cell membrane.

[0085] Example 3

[0086] Virus-induced gene silencing of the GhHSTF2d gene

[0087] Use an online website (http: / / vigs.solgenomics.net / ) to determine the silencing sequence of GhHSTF2d, design primers for PCR amplification, and the primer sequences are as follows:

[0088] CLCrV-F (SEQ ID No.5):

[0089] TGCCTGCAGACTAGTCAGAATCCGTCATTTCTGC

[0090] CLCrV-R (SEQ ID No.6):

[0091] ACCTAGGGGCGCGCCATGGCTCTCTCGATGCTCA

[0092] The target fragment was obtained and recovered according to the above gene cloning-related methods, and ligated to the pCLCRVA vector. After transforming Agrobacterium and shaking the bacteria, it was mixed with the pCLCRVB resuspension. After standing for 3 h, the cotyledons of 14-day-old cotton seedlings were injected. Among them, the injection of the empty CLCRV was used as the control (ck). After the appearance of the yellow leaf phenotype in the positive plants, the total RNA of the leaves of each seedling was extracted, and the expression levels of the key genes for gossypol synthesis were identified using the above fluorescence quantitative PCR detection method. The quantitative primers are as follows:

[0093] Table 7 Primer Information

[0094]

[0095] At the same time, the contents of terpenoid compounds such as gossypol in the dried cotton leaves were measured (measured by Hainan Baisui Biotechnology Co., Ltd.). The measurement method is as follows:

[0096] The reagents used in the experiment, methanol (Shanghai, #M116118), phosphoric acid (Shanghai, #P112025), acetonitrile (Shanghai, #A104440), formic acid (Shanghai, #F112034), ethanol (Shanghai, #E111993), were all chromatographic grades and purchased from Aladdin.

[0097] Table 8 Standard Solution

[0098]

[0099] Take 10 g of the sample in a centrifuge tube, add 10 mL of anhydrous ethanol to each tube, shake for 2 min and then let it stand at room temperature for 5 min. Pipette 5 mL of the supernatant, dry it with nitrogen, and finally make a volume of 1 mL with anhydrous ethanol and filter it with a 0.45 µm inorganic filter membrane under sterile conditions.

[0100] The chromatographic conditions are shown in the following table:

[0101] Table 9 Chromatographic Conditions

[0102]

[0103] The gossypol standard working solutions with different concentrations were added in sequence, the peak height and peak area were counted, and then the standard curve was drawn. The sample solution was injected into the liquid chromatograph, and the concentration of gossypol in the sample was calculated after counting and drawing the standard curve.

[0104] The results are as Figure 3 shown. With the silencing of GhHSTF2d, the expression levels of the gossypol synthesis genes CDNC, CYP706B1, CYP71BE79, CYP82D113, and DH-1 decreased extremely significantly, and the gossypol content in the cotton leaves decreased significantly, indicating that GhHSTF2d may affect the biosynthesis of gossypol by regulating the expression of gossypol synthesis genes.

[0105] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Upland cotton GhHSTF2d The application of the gene in regulating cotton gossypol synthesis is characterized in that: Silent Upland Cotton GhHSTF2d The gene negatively regulates cotton gossypol synthesis; Upland cotton GhHSTF2d The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: Silent Upland Cotton GhHSTF2d Genetically down-regulate the expression of genes involved in cottonypol synthesis; The cottonpol synthesis gene is CDNC Gene, CYP706B1 Gene, CYP71BE79 Gene, CYP82D113 Genes and DH-1 One or more genes.

3. The use according to claim 1, characterized in that: Upland cotton GhHSTF2d The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.2.

Images