GhLBD6 gene application for regulating early maturity of gossypium hirsutum and KASP marker
By identifying the GhLBD6 gene, a member of the Class I LBD family of upland cotton, verifying its function using VIGS technology, and developing the KASP marker, the problem of unclear function of Class I LBD family members in regulating flowering time was solved, enabling efficient early-maturing cotton breeding and providing gene resources and molecular marker-assisted selection.
Patent Information
- Application Number
- CN202511802281.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-06-30
AI Technical Summary
The function of members of the LBD family (Type I) of the genus *Gossypium* in regulating flowering time is still unclear, and related research is relatively lacking, which has affected the breeding progress of early-maturing cotton varieties.
By identifying the GhLBD6 gene, a member of the LBD family of upland cotton I, and verifying its function using VIGS technology, combined with haplotype and expression pattern analysis, a KASP marker was developed. Candidate genes for regulating flowering time, GhLBD6, were screened out, and breeding evolution analysis was conducted to develop molecular marker-assisted selection.
It provides an efficient and stable molecular-assisted selection tool, improves the accuracy and efficiency of early-maturing cotton breeding, overcomes the limitations of phenotypic selection, reveals the negative regulatory mechanism of flowering time in upland cotton, and provides gene resources and genetic markers for early-maturing cotton varieties.
Smart Images

Figure CN122303291A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of upland cotton technology, and more specifically, to the application of the GhLBD6 gene and KASP marker for regulating early maturity in upland cotton. Background Technology
[0002] The transition from vegetative to reproductive growth in plants begins with flower bud differentiation, and flowering, as a key manifestation of this process, is comprehensively regulated by internal genetic factors and external environmental factors. In the model plant Arabidopsis thaliana, it has been revealed that genetic pathways such as photoperiod, vernalization, temperature, gibberellin, autonomy, and age regulate and integrate genes to achieve the flowering transition. Studies have shown that type I... LBD Genes play an important role in regulating flowering time: Arabidopsis as2 The mutant exhibits a late-flowering phenotype; overexpression in wheat TaLBD16-4D It can lead to premature heading; overexpression of apple in Arabidopsis MdLBD11 This can lead to delayed flowering; Peony PoLBD25 Overexpression of this compound delays flowering, while silencing it induces early flowering. Early-maturing upland cotton ( Gossypium hirsutum L. (cotton) has the advantages of a short growing season and relatively uniform maturity, which can adapt to the short frost-free climate of the inland cotton-growing areas in Northwest my country and meet the requirements of mechanized harvesting. Flowering period is one of the important traits for evaluating the early maturity of cotton, and exploring the genetic resources that regulate the flowering period of upland cotton is of great significance for breeding early-maturing cotton varieties.
[0003] Currently, there are some reports on the functional studies of members of the LBD family of the Gossypium genus, such as: GhAS2 Involved in regulating leaf shape development, GhLBD100 It can improve the resistance of upland cotton to Verticillium wilt; the GhLBD18 protein acts on... GhATG18a Upstream regulation of autophagy activity and control of somatic embryogenesis, Asian cotton GaLBD1 ~ GaLBD5 It can induce callus formation. However, the function of members of the Gossypium Class I LBD family in regulating flowering time remains unclear, and related research is relatively scarce. Therefore, this study identified members of the Gossypium Class I LBD family and conducted bioinformatics analysis on them. Candidate genes were screened using haplotype and expression pattern analysis, and functional verification was performed using VIGS technology. Furthermore, breeding evolution analysis and related molecular marker development were conducted to reveal the role of Gossypium Class I LBD family members in regulating flowering time, providing excellent gene resources and a foundation for future early-maturing cotton variety breeding and marker-assisted selection. Summary of the Invention
[0004] To address the unclear function of members of the LBD family (Group I) in regulating flowering time, this application provides a method for regulating early maturity in upland cotton. GhLBD6Gene applications and KASP markers.
[0005] Firstly, this application provides a method for regulating early maturity in upland cotton. GhLBD6 For gene applications, the following technical solutions are adopted: Upland cotton type I LBD family genes GhLBD6 , GhLBD6 The gene coding region sequence is shown in SEQ ID NO: 1.
[0006] By adopting the above technical solution, wherein SEQ ID NO: 1 is as follows: .
[0007] Preferred, GhLBD6 The natural variation of the coding region contains one SNP and one Indel.
[0008] By employing the above technical approach, and through natural variation analysis of 619 upland cotton germplasm resources using the CottonMD database, verifying the authenticity of variant sites using Sanger sequencing, and screening for genetic markers related to flowering time using association analysis, thus obtaining... GhLBD6 Specific variation information in the coding region provides a basis for haplotype classification and molecular marker development.
[0009] Preferred, GhLBD6 The coding region contains two haplotypes. GhLBD6 -Hap1 and GhLBD6 -Hap2.
[0010] By adopting the above technical solution, haplotype analysis is performed based on coding region SNPs and Indel variations. Major haplotypes are identified through population genetics methods, and the association between haplotypes and traits is verified by combining flowering period phenotypic data. Therefore, two clear haplotype classifications are obtained, which facilitates breeding evolution analysis and the discovery of superior allelic variations.
[0011] Preferably, the haplotype GhLBD6 -Hap1 and GhLBD6 -Hap2 is composed of the SNP and Indel of the coding region.
[0012] By adopting the above technical solutions, the combination patterns of variant sites can be confirmed through PCR amplification and sequencing, the linkage relationship between SNPs and Indels can be revealed through haplotype block analysis, and the stability of haplotype composition can be evaluated through statistical tests. Therefore, the specific genetic basis of haplotypes can be obtained, and the operability of haplotypes in molecular-assisted selection can be enhanced.
[0013] Preferred, GhLBD6 It belongs to the LBD family of upland cotton, category I.
[0014] By employing the above technical approach, LBD / ASL proteins are a class of plant-specific transcription factors. They were initially named ASL because of their early discovery of function in regulating leaf symmetry development, and later named LBD based on the conserved LOB domain due to the revelation of their functional diversity. The LOB domain consists of a zinc finger-like CX2CX6CX3C domain, a Gly-Ala-Ser motif, and a leucine-like zipper motif LX6LX3LX6L. Based on the integrity of the leucine-like zipper motif, the LBD family can be divided into class I, which has a complete leucine-like zipper sequence, and class II, which has an incomplete leucine-like zipper sequence. Among them, the study of class I LBD members is more systematic and their functions are more diverse.
[0015] Preferred, GhLBD6 There are differences in haplotype frequency distribution among natural populations of upland cotton, among which GhLBD6-Hap1 has a relatively high frequency among cotton varieties in the inland cotton-growing areas of Northwest China.
[0016] By adopting the above technical solutions, by analyzing the haplotype frequencies of varieties from different geographical origins and eras, combining the artificial selection pressure analysis of the early-maturing demand in the Northwest Inland Cotton Region, and verifying the selection signals through nucleotide diversity and genetic differentiation index, evidence of the association between haplotype distribution and ecological adaptability is obtained, providing support for regionalized breeding.
[0017] Preferred early-maturing varieties include GhLBD6 -Hap1 is the main variety, while among the late-maturing varieties, the main variety is... GhLBD6 -Hap2 is the primary component.
[0018] By adopting the above technical solution, haplotype verification was performed on extremely early-flowering and late-flowering varieties. The correlation between haplotype and flowering time was confirmed through phenotypic-genotypic association analysis. The enrichment degree of haplotype in different maturity populations was evaluated using statistical methods. Therefore, the relationship between haplotype and early maturity trait was obtained, providing molecular targets for the breeding of early-maturing varieties.
[0019] Preferred, knockdown GhLBD6 It can promote earlier flower bud differentiation, significantly advancing the budding and flowering periods by 6.57 days and 6.86 days, respectively.
[0020] By adopting the above technical solution, the VIGS technology is used to silence the 113 cotton product. GhLBD6 The expression was obtained by observing the process of flower bud differentiation through paraffin sections, statistically analyzing the time of budding and flowering, and performing significance tests. GhLBD6 Direct functional evidence of negative regulation of flowering period confirms its role as a flowering inhibitor.
[0021] Preferred, knockdown GhLBD6 Key genes that induce flowering GhAP1 The expression is adjusted upwards.
[0022] By employing the above technical solution, and by using qRT-PCR to detect changes in the expression of key genes in the flowering pathway in silenced plants, through 2 -△△Ct The expression level was quantified using a method, and the regulatory relationship was confirmed by significance analysis, thus obtaining... GhLBD6 The molecular mechanism by which flowering period is regulated by influencing the expression of downstream genes.
[0023] Secondly, this application provides a method for regulating early maturity in upland cotton. GhLBD6 The KASP marker for gene applications employs the following technical solution: A method for regulating early maturity in upland cotton GhLBD6 KASP markers for gene applications, wherein the KASP molecular markers are paired with GhLBD6 Haplotypes were screened.
[0024] By employing the above-mentioned technical approach, and through expression analysis in haplotype-binding tissues and early- and late-flowering varieties, candidate genes regulating the flowering period of upland cotton were screened. GhLBD6 VIGS experiments showed that knockdown GhLBD6 It can lead to earlier flower bud differentiation, advancing the budding and flowering periods by 6.57 days and 6.86 days respectively, and induce key flowering genes. GhAP1 and GhSVP The expression is adjusted upwards. GhSOC1 and GhCAL The expression is downgraded; GhLBD6 The coding region mainly contains two haplotypes. GhLBD6 -Hap1 and GhLBD6 -Hap2, where GhLBD6 -Hap1 is associated with early maturity traits and has a high frequency in cotton-growing areas in Northwest China and in modern bred varieties, indicating that it has been artificially selected. The KASP molecular marker developed based on this site can distinguish between two haplotypes, providing a basis for molecular breeding of early-maturing cotton.
[0025] In summary, this application has the following beneficial effects: 1. Because this application is based on GhLBD6 KASP molecular markers were developed from non-synonymous SNP sites in the coding region. Haplotype typing was achieved using allele-specific PCR technology, and its typing efficiency and consistency were verified in various early and late maturing upland cotton varieties. Because this marker can distinguish... GhLBD6 -Hap1 and GhLBD6 The -Hap2 haplotype is associated with the flowering phenotype, thus providing an efficient and stable molecular-assisted selection tool that can be applied to early-maturing cotton breeding practices, improving the accuracy and efficiency of variety selection and overcoming the limitations of phenotypic selection in related upland cotton breeding.
[0026] 2. Because this application uses haplotype analysis, based on SNP locus data from various upland cotton germplasm resources, it identifies two main haplotypes, GhLBD6-Hap1 and GhLBD6-Hap2, which are composed of SNPs and Indels in the GhLBD6 coding region. Through association analysis, it was found that GhLBD6-Hap1 is associated with early maturity traits and has a high distribution frequency in the Northwest Inland Cotton Region and modern bred varieties. Further analysis of nucleotide diversity and genetic differentiation index confirmed that this gene was artificially selected during the breeding process, thus obtaining allelic variations closely related to ecological adaptability, and providing genetic markers and selection basis for regional early maturity breeding.
[0027] 3. This application uses the identification of LBD family members of upland cotton I and ensures the accuracy of gene identification through conserved domain and motif analysis. By combining haplotype and expression pattern analysis, GhLBD6 was screened as a candidate gene for regulating flowering time. Its function was verified in Zhongmian 113 using VIGS technology. It was confirmed that knocking down GhLBD6 can lead to earlier flower bud differentiation, earlier budding and flowering time. Therefore, the evidence for the negative regulatory mechanism of flowering time in upland cotton is obtained, providing gene targets and functional basis for the genetic improvement of early-maturing cotton varieties. Attached Figure Description
[0028] Figure 1 This is a schematic diagram of the primer sequences used in the experiments proposed in this application; Figure 2 A schematic diagram illustrating the identification and phylogenetic analysis of the Class I LBD family members proposed in this application; Figure 3 A schematic diagram illustrating the identification of the nine species of Class I LBD family members proposed in this application; Figure 4 This is a schematic diagram illustrating the phylogenetic, gene, and protein structure analysis of the members of the upland cotton class I LBD family proposed in this application; Figure 5 This is a schematic diagram illustrating the chromosome distribution and collinearity analysis of the Class I LBD genes in upland cotton proposed in this application; Figure 6 This is a schematic diagram of haplotype analysis and candidate gene expression analysis of members of the upland cotton class I LBD family proposed in this application; Figure 7 This is a statistical diagram illustrating the VIGS silent plant phenotype observation of the upland cotton GhLBD6 proposed in this application. Figure 8 This is a schematic diagram of the breeding evolution analysis and genotyping of the GhLBD6 gene proposed in this application. Detailed Implementation
[0029] The present application will be further described in detail below with reference to the accompanying drawings and embodiments.
[0030] Example 1 Identification of LBD family members (Class I): Genomes and annotation files for each species were obtained from the following databases: *Gossypium hirsutum_ZJU* and *Gossypium arboreum_CRI* from Cottongen (https: / / www.cottongen.org / ); *Gossypium raimondii_v2.1*, *Arabidopsis thaliana_TAIR10*, *Malus domestica_v1.1*, *Oryza sativa_v7.0*, *Zea mays_APGv4*, and *Hordeum vulgare_r1* from Phytozome (https: / / phytozome-next.jgi.doe.gov / ); and *Triticum aestivum_v2.2* from Ensemble plants (https: / / plants.ensembl.org / index.html). Using 43 LBD protein sequences from Arabidopsis thaliana and a Hidden Markov Model (HMM, PF03195) of the LOB domain as references, LBD proteins in the above species were preliminarily identified using TBtools' BlastP alignment and HMM search. Further conserved domains were predicted using NCBICDD, and conserved motifs were identified using MEME. Proteins possessing the CX2CX6CX3C motif, the GAS motif, and the LX6LX3LX6L motif were identified as members of the class I LBD family.
[0031] Identification and phylogenetic analysis of LBD family members (class I): Based on BlastP and HMM analysis, 574 LBD proteins were identified from Arabidopsis thaliana, upland cotton, Asian cotton, Gossypium ramondii, apple, rice, maize, barley, and common wheat, with numbers of 43, 131, 65, 68, 69, 36, 49, 32, and 81, respectively. Through conserved domain and motif analysis of these proteins, 423 members of the LBD family (class I) were screened. Figure 3 Phylogenetic analysis divided the aforementioned class I LBD proteins into six groups (groups 1 to 6). Figure 2 A). Among them, group 2 contained the fewest proteins, with only 43; group 6 contained the most proteins, with 128; the remaining groups had a relatively even distribution of protein counts. All six groups contained type I LBD proteins from the above nine species, and the distribution of type I LBD proteins from different species varied in different groups. Figure 2 B).
[0032] Real-time Example 2 Bioinformatics analysis of LBD family members (class I) was performed using MEGA12.0 to construct a phylogenetic tree of LBD protein sequences, employing the Neighbor Joining (NJ) method with a Bootstrap value set to 1000. The phylogenetic tree was beautified using itol (https: / / itol.embl.de / ). Conserved motifs, conserved domains, gene structure, and chromosome distribution were visualized using TBtools, along with intraspecific collinearity analysis and Ka / Ks calculations. Collinearity analysis and plotting among upland cotton, Asian cotton, and Gossypium redmondii were performed using JCVI. The TM-1WHU reference genome in CottonMD (https: / / yanglab.hzau.edu.cn / CottonMD / help.1) was used for ID conversion of the target gene, and SNP sites were queried. Based on reported transcriptome data from different tissues of upland cotton TM-1, the expression values (FPKM) of the target gene were normalized using Log2(FPKM+1), and an expression pattern heatmap was generated using TBtools.
[0033] Analysis of conserved motifs, domains, and gene structures of 102 identified upland cotton class I LBD family members: Figure 4 Conserved motif analysis revealed that members with closely related evolutionary relationships shared similar motif compositions and arrangement patterns, confirming the rationality of the grouping. All members of the upland cotton I class LBD contained motifs 2, 3, and 4, which are essential for the formation of a complete LOB domain. Group 6 contained the most motif types, while groups 1 and 2 contained the fewest. Conserved domain analysis showed that, except for GhLBD15-4 and GhLBD31-2 which contained two domains, the remaining members contained only one. Gene structure analysis showed that among the upland cotton I class LBD members, 24 genes did not contain introns, 68 genes contained only one intron, 9 genes contained two introns, and 1 gene (…). GhLBD31-2 It contains 12 introns, and the differences in gene structure suggest functional diversity.
[0034] Example 3 RNA extraction and qRT-PCR detection and analysis: Total RNA was extracted from cotton samples using the AFT Spin Universal Plant Fast RNA Extraction Kit (Aibotek), and the first strand of cDNA was synthesized in one step using the UnionScript First-strand cDNA Synthesis Mix for qPCR (Jinsha). GhActinAs an internal reference gene, qRT-PCR experiments were performed using BrightCycle Universal SYBR Green qPCR Mix with UDG (Aibotec). 2 -△△Ct The relative expression levels of the target gene were calculated using [method name missing], and data analysis was performed using IBM SPSS Statistics 27 software. Plotting was conducted using Origin 2024. Primer sequences used in the qRT-PCR experiments are listed below. Figure 1 .
[0035] Example 4 Primers for VIGS silencing in upland cotton plants were designed using the NCBI Primer-BLAST tool. Primer sequences are shown below. Figure 1 Using cDNA from ZM113 leaves as a template, the target fragment was amplified using Taq 2X PCR Mix with Dye V2 (Aibotek), and then ligated into the pTRV2 vector. A suitable plasmid was then transformed into GV3101 Agrobacterium competent cells. MMA (10 mmol / L 2-morpholine ethanesulfonic acid, 200 mmol / L...) was then added. -1 Acetyleugenol, 10 mmol / L -1 Resuspend the bacterial suspension with magnesium chloride to an OD600 of 1.6–1.8, incubate at room temperature in the dark for 3–4 hours, and then mix the pTRV1 auxiliary bacterial resuspension with TRV:00 (negative control) and TRV: GhCLA1 (Positive control), TRV: GhLBD6 (Experimental Group) The bacterial suspension was mixed in equal proportions. The bacterial suspension was used to infect the abaxial surface of the cotyledons of one-week-old ZM113 plants via syringe injection. The feasibility of the experimental method was verified by the albinism observed in the positive control plants. TRV with relative expression below 0.5 was screened using qRT-PCR. GhLBD6 Silent plants. Primer synthesis and plasmid sequencing were performed by Sangon Biotech Co., Ltd.; among which... GhLBD6 The silence sequence is shown below: GTTCACAAGGTGTTCGGTGCTAGCAACGTTACGAAGCTACTCAACGAGCTGCACCCGTCGCAACGGGAGGACGCGGTTAATTCGCTGGCGTATGAGGCGGATATGCGGTTGAGGGACCCCGTTTACGGTTGCGTTGGGGTTATATCCCTCCTCCAGCACCAACTCCGGCAACTGCAAATGGATCTCAGCTGTGCTAAGTCGGAACTCTCAAAGTACCAGAGCTTGGGTATAAC GGGACACGCTGGTCTCATAGCGGCAGCAGCGGCTGCTACGGCTACGACCCATCAGAACTTAGGGATCAATCTGATCGGTAACGGCGGCAGTGGTGGAGGAGGAGGACGGGAACATCATTTCCACCACCATCAATTCTTCCCCAGGGATCATCACCATCACCATCAACAACAGATGTTAATGAGCTTCGATGCTAGCAGTAACTGCGACGCAAATCTCCTCGCCATGAACGTC.
[0036] Haplotype analysis and candidate gene expression analysis of upland cotton Class I LBD genes: To screen key genes that may regulate flowering time in upland cotton, CottonMD was used to analyze 102 upland cotton Class I LBD genes. LBD SNP locus analysis was performed on the genes. The results showed that 19 genes did not contain any SNP loci; 66 genes contained varying numbers of SNP loci, but none were associated with flowering time; and 17 genes contained SNP loci associated with flowering time. Further haplotype analysis was performed on these 17 genes. Figure 6 A) A scatter plot was created with the ratio of the number of samples between the two main haplotypes as the x-axis and the negative logarithm of the significance level at flowering as the y-axis. From this plot, three candidate genes with a relatively even distribution of haplotype sample numbers were selected: GhLBD6 , GhLBD20-2 and GhLBD12-1 Based on published transcriptome data of upland cotton TM-1 from different tissues and developmental stages, expression heatmaps of these three genes were constructed. Figure 6 B). The results show that, GhLBD6 It is expressed at high levels in leaves and ovules. GhLBD20-2 It is mainly highly expressed in the pistil and ovule. GhLBD12-1 It is highly expressed primarily in roots and fibers. Detection was performed using qRT-PCR. GhLBD6 , GhLBD20-2 and GhLBD12-1The relative expression of early and late flowering varieties of upland cotton at the three-leaf stage in the shoot tip and young leaves. The results showed that only GhLBD6 Significant differences were observed in its expression between early-flowering and late-flowering varieties, suggesting that it may be involved in regulating flowering time.
[0037] Example 5 Cytological observation of cotton apical meristems was performed using apical meristems from the experimental group and negative control at the three-leaf stage, which were preserved in FAA (70% ethanol: formaldehyde: glacial acetic acid = 9:1:1) fixative. After 24 hours of fixation, the experimental materials were sequentially washed, dehydrated, cleared, paraffin-embedded, embedded, sectioned (5 μm thick), spread (45℃), dried (42℃ for 36 hours), dewaxed, and stained (1% safranin). The flower bud differentiation of the experimental group and negative control was then observed under an optical microscope.
[0038] Knock down GhLBD6 Expression leads to ZM113 exhibiting an early flowering phenotype: to verify GhLBD6 Its function in regulating flowering time was demonstrated by knocking down VIGS in ZM113. GhLBD6 The expression of TRV: 7 days after injection. GhCLA1 The control group plants showed a distinct albino phenotype. Figure 7 A) indicates that the VIGS system is effective. qRT-PCR detection showed that, compared with the control TRV:00, TRV: GhLBD6 In the plant GhLBD6 The expression level of [the substance] decreased significantly to below 50%. Figure 7 B). Flower bud differentiation in plants is a crucial process in the transition from vegetative growth to reproductive growth, and its timing directly affects crop maturity. To clarify... GhLBD6 The effect of silence on flower bud differentiation, we studied TRV: GhLBD6 Paraffin sections of shoot apical meristems from silent plants and control plants at the three-leaf stage were prepared. Results showed that when... GhLBD6 When the silent plants have begun flower bud differentiation, the control plants are still in the vegetative growth stage, indicating that... GhLBD6 Lowering the level can advance flower bud differentiation. Figure 7 C). Phenotypic statistical analysis revealed that... GhLBD6 The budding and flowering periods of the silent plants were significantly earlier than those of the control by 6.57 days and 6.86 days, respectively. Figure 7 D), indicating inhibition GhLBD6 Expression of this gene can lead to earlier flowering in ZM113. This can be achieved by detecting the expression of key flowering genes (…). Figure 7 E), discovery GhLBD6 After silence GhAP1 ( APETALA1 )and GhSVP ( Short Vegetative Phase The expression was significantly upregulated. GhSOC1 ( SUP-PRESSOR OF OVEREXPRESSION OF CONSTANS 1 )and GhCAL( CAULIFLOWER The expression was significantly downregulated. GhLFY ( LEAFY No significant change in expression () Figure 7 E). In summary, the adjustment in ZM113 is as follows. GhLBD6 Expression can advance flower bud differentiation, promote budding and flowering, and affect the expression of key genes for flowering in upland cotton.
[0039] Example 6 Haplotype analysis and genotyping were based on SNP loci from 619 upland cotton germplasm resources, combined with flowering time typographic data obtained in two previous studies under two different environments. GhLBD6 Association analysis was performed between variant sites in the gene coding region and flowering time. Five early-maturing varieties, Liaojinmian3, Xinluzao32, Jiumian11, Jinken1161, and Zhongmian125, and five late-maturing varieties, Nanguamian, Humian204, Emian12, Ekangmian8, and Xuzhou553, were selected. Gene sequences containing variant sites were amplified by PCR and Sanger sequencing was performed to confirm the existence of superior allelic variations. Haplotypes of target genes in 619 accessions were analyzed across three major cotton-producing regions: the Northwest Inland Cotton Region (NIR), the Yellow River Cotton Region (YRR), and the Yangtze River Cotton Region (YZRR), as well as across different age groups (Early, Middle, and Modern). Furthermore, the proportion of different haplotypes was compared among the 50 extreme accessions each with the earliest (Min-50) and latest (Max-50) flowering times. Nucleotide diversity (π) and interpopulation genetic differentiation index (π) within the target regions were calculated using VCFtools. F ST Primers and probes were designed based on SNP non-synonymous mutation sites. Figure 1 KASP genotyping was performed using the AQPTM-SNP / InDel universal genotyping kit (Beijing Jiacheng).
[0040] GhLBD6 Evolutionary analysis of superior allelic variations in breeding and development of molecular markers: Analysis of allelic variations in 619 upland cotton materials from different regions and eras. GhLBD6 The coding region contained one SNP and one Indel, which together constituted two main haplotypes: GhLBD6 -Hap1 and GhLBD6 -Hap2 ( Figure 8A). The flowering periods of the varieties corresponding to these two haplotypes differed significantly. Figure 8 B). Through PCR cloning and sequencing verification, it was confirmed that early-maturing varieties were predominantly... GhLBD6 -Hap1 is the main variety, while among the late-maturing varieties, the main variety is... GhLBD6 -Hap2 is the main component ( Figure 8 C). Further analysis shows that, GhLBD6 -The distribution frequency of Hap1 in different regions and years increases with the advancement of flowering time. Figure 8 D). Additionally... GhLBD6 -Hap1 was distributed at a significantly higher frequency in extremely early flowering varieties. Figure 8 E). Through the analysis of GhLBD6 π and gene-related regions F ST The value is estimated. A low π value indicates low genetic diversity in this gene region and relatively simple nucleotide types. Figure 8 F); High F ST The value indicates that the degree of genetic differentiation in this region is high and the genetic differences are significant. Figure 8 G). Comprehensive analysis results show that, GhLBD6 Genes underwent artificial selection during the improvement of upland cotton varieties. Genotyping of 77 early- and late-maturing upland cotton varieties was performed using KASP technology, and the genotyping results were consistent with expectations. Figure 8 H).
[0041] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
1. A method for regulating early maturity in upland cotton GhLBD6 Gene applications, characterized by, GhLBD6 The gene coding region sequence is shown in SEQ ID NO:
1.
2. A method for regulating early maturity in upland cotton according to claim 1. GhLBD6 Gene applications, characterized by, GhLBD6 The SNP site in the coding region contains one SNP and one Indel.
3. A method for regulating early maturity in upland cotton according to claim 1 GhLBD6 Gene applications, characterized by, GhLBD6 The coding region contains two haplotypes. GhLBD6 -Hap1 and GhLBD6 -Hap2.
4. A method for regulating early maturity in upland cotton according to claim 3. GhLBD6 Gene applications, characterized by, The haplotype GhLBD6 -Hap1 and GhLBD6 -Hap2 is composed of the SNP and Indel of the coding region.
5. A method for regulating early maturity in upland cotton according to claim 1. GhLBD6 Gene applications, characterized by, GhLBD6 It belongs to the LBD family of upland cotton, category I.
6. A method for regulating early maturity in upland cotton according to claim 1 GhLBD6 Gene applications, characterized by, GhLBD6 There are differences in haplotype frequency distribution among natural populations of upland cotton, among which GhLBD6 -Hap1 has a relatively high frequency among cotton varieties in the inland cotton-growing areas of Northwest China.
7. A method for regulating early maturity in upland cotton according to claim 1 GhLBD6 Gene applications, characterized by, Early-maturing varieties GhLBD6 -Hap1 is the main variety, while among the late-maturing varieties, the main variety is... GhLBD6 -Hap2 is the primary component.
8. A method for regulating early maturity in upland cotton according to claim 1 GhLBD6 Gene applications, characterized by, Knock down GhLBD6 It can promote earlier flower bud differentiation, advancing the budding and flowering periods by 6.57 days and 6.86 days respectively.
9. A method for regulating early maturity in upland cotton according to claim 1 GhLBD6 Gene applications, characterized by, Knock down GhLBD6 Key genes that induce flowering GhAP1 The expression is adjusted upwards.
10. A method for regulating early maturity in upland cotton as described in any one of claims 1-9 GhLBD6 KASP markers for gene applications, wherein the KASP molecular markers are paired with GhLBD6 Haplotypes were screened.