Puerenin, an immunomodulatory peptide and its applications

Abstract

This invention relates to an immunomodulatory peptide, Puerenin, and its applications, belonging to the biomedical field. Puerenin is a polypeptide encoded by the defense peptide gene of the Puer tree frog, a species endemic to China. It has a molecular weight of 1486.7 Daltons, an isoelectric point of 12.58, and its amino acid sequence is shown in SEQ ID NO:2. The gene encoding the precursor of the immunomodulatory peptide Puerenin is available in GenBank. Accession No. PQ862905 consists of a 592-nucleotide sequence, as shown in SEQ ID NO:1; nucleotides 400–435 encode the gene for Puerin, a multifunctional immunomodulatory peptide from the mature Puer tree frog. The application of Puerin in the preparation of antioxidants, scavenging damaged DNA, and protecting against photodamage to the skin is discussed. Beneficial effects include a strong anti-photodamage effect on the skin, significantly inhibiting the occurrence of photodamage.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an immunomodulatory peptide, Puerenin, and its applications. Background Art

[0002] The skin, the largest organ in the human body, covers the entire body surface and serves as a vital barrier protecting internal organs and tissues from various pathogens and environmental stressors. However, it is also vulnerable to various environmental risk factors. Ultraviolet (UV) radiation is one of the most significant environmental risk factors causing skin damage, and photodamage encompasses a range of skin diseases induced or exacerbated by UV radiation. The prevention and treatment of photodamage-related skin diseases has become a global public health issue. Therefore, finding safe, low-toxicity, and cost-effective novel and highly effective drugs for the prevention and treatment of photodamage is an urgent problem to be solved.

[0003] Free radicals are highly reactive atomic groups or atoms with one or more unpaired electrons, produced during the metabolism of organisms. They can exist independently and are essential for life, but are also potential killers of biological macromolecules, cells, and tissues. Some bioactive peptides have rapid and powerful free radical scavenging capabilities, which can maximize the protection of the skin, minimizing free radical damage induced by sunlight, ultraviolet radiation, etc.

[0004] Amphibians are one of the most important resources for the discovery of bioactive peptides. Their exposed skin allows them to secrete a variety of novel and functionally complex bioactive peptides to withstand harsh environments. These active peptides participate extensively in various physiological activities and possess diverse pharmacological activities, such as antimicrobial, antitumor, antioxidant, immunomodulatory, wound repair, and analgesic effects. Currently, screening pharmacologically active monomeric compounds from amphibian skin is a hot topic in new drug development. According to domestic and international literature, different active peptides have been isolated from various biological sources, and some have already entered the clinical trial stage. *Puer tree frog* (… Polypedates puerensis (This is a type of amphibian belonging to the family Araneidae in the order Anura. It is mainly distributed in the tropical and subtropical forests of Puer area and its surrounding areas in Yunnan Province. The role of cathelicidin, an immunomodulatory peptide in its skin secretions, in resisting skin photodamage, clearing damaged DNA, and antioxidation has been rarely reported.) Summary of the Invention

[0005] The first objective of this invention is to provide an immunomodulatory peptide, Puerenin; the second objective is to provide applications of the aforementioned immunomodulatory peptide, Puerenin.

[0006] The first objective of this invention is achieved as follows: the nucleotide sequence of the immunomodulatory peptide Puerenin is shown in the sequence listing SEQ ID NO: 1.

[0007] The immunomodulatory peptide Puerenin described in this invention is a cationic polypeptide encoded by the host defense peptide gene of the Puer tree frog, an amphibian endemic to China. It has a molecular weight of 1486.7 Daltons, a net charge of +5, and an isoelectric point of 12.58. The primary structure of the polypeptide (amino acid sequence SEQ ID NO:2) is as follows:

[0008] Trp Gly Asn Arg Ala Val Arg Gly Arg Arg Arg Cys

[0009] WGNRAVRGRRRC(12aa)

[0010] The gene encoding this immunomodulatory peptide precursor consists of 592 nucleotides (SEQ ID NO:1), and its sequence from the 5' end to the 3' end is as follows:

[0011] atggcgctcg ctgctgcact caccttcctg ctggggctgg cctgcaccat cctggcctcccctatacaag aatggagcgaggatgacgtc gccgtcatgg cgctgtacag cgcagattac tacaacaaagtatccggaga ggacgtcatt tacgggcttg tgggagacaa ggcggaatac gtcgatgaag aaaattttggatttcatcaa ctttttttcctgatacaaga aaccatttgc caaaaaagta acaacaacac ccagactgatggctgcgcat tcaaggaggg cggcgttgtg aaatcctgca cttcacgctt tttcacaaag gatgaccgggacgttgtggt gacctgccaataccaagatg gccaacagaa acactcaaga gtgagaagat ggggcaatcgcgctgtcaga ggaagaagac gctgttaaga cattgctgaa tgtaaccagc ccacttcccc tttttttaaaattttttcaa aaatcttgca tgaaaaattgacaaaaattt aaaaaatcac agaatataga gttagcatagaatttttgtt tgcaaaaaaa aaaaaaaaaa aaaaaaaaaa aa

[0012] Nucleotides 400–435 encode the gene for the mature immunomodulatory peptide Puerenin.

[0013] The present invention relates to the application of Puerenin, a multifunctional immunomodulatory peptide, in the preparation of drugs for treating skin photodamage, drugs for clearing damaged DNA, drugs for skin antioxidant protection and scavenging free radicals in the body, and its application in the preparation of cosmetics.

[0014] This invention has revealed that Puerenin possesses both antioxidant activity and DNA binding and scavenging activity, providing protection against skin photodamage. Therefore, Puerenin is a multifunctional cathelicidin immunomodulatory peptide.

[0015] This invention provides a Pu'er tree frog ( Polypedates puerensisApplications of Puerenin, a novel immunomodulatory peptide derived from [source name], in anti-oxidation, DNA scavenging, and protection against photodamage to the skin.

[0016] The beneficial effects of this invention are as follows: It provides a multifunctional immunomodulatory peptide, Puerenin, from the skin of the Puer tree frog, which exhibits potent anti-photodamage activity. This immunomodulatory peptide possesses strong DNA-binding activity and can scavenge damaged DNA in photodamaged mice. Furthermore, it exhibits strong antioxidant activity and anti-photodamage effects, and can be used in the preparation of drugs for anti-photodamage, drugs for scavenging damaged DNA, drugs for scavenging free radicals in vivo, and cosmetics. This multifunctional immunomodulatory peptide from the tree frog skin has the advantages of simple sequence and low synthesis cost. Attached Figure Description

[0017] Figure 1 This is a schematic diagram illustrating the extremely strong antioxidant activity of the immunomodulatory peptide Puerenin.

[0018] Figure 2 This diagram illustrates the strong DNA binding and DNA scavenging effects of the immunomodulatory peptide Puerenin.

[0019] (A) Puerenin can bind to DNA; DNA and Puerenin-DNA complexes were prepared and then identified by 1% agarose gel electrophoresis.

[0020] (B) The binding affinity between DNA and Puerenin;

[0021] (C) The effect of Puerenin on clearing damaged DNA in photodamaged mice;

[0022] Figure 3 This is a schematic diagram illustrating the strong anti-photodamage effect of the immunomodulatory peptide Puerenin on the skin. Detailed Implementation

[0023] The present invention will be further described below with reference to embodiments and accompanying drawings, but this does not limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0024] The nucleotide sequence of the immunomodulatory peptide Puerenin described in this invention is shown in the sequence listing SEQ ID NO: 1.

[0025] The amino acid sequence encoded by the immunomodulatory peptide Puerenin is shown in SEQ ID NO: 2.

[0026] The application of the immunomodulatory peptide Puerenin described in this invention is its use in the preparation of drugs for treating skin photodamage.

[0027] The invention will be further illustrated below with specific implementation examples:

[0028] I. Antioxidant effects of Puerenin, a multifunctional immunomodulatory peptide in the skin of the Puerh tree frog.

[0029] The antioxidant effect of the functional immunomodulatory peptide Puerenin was detected by the ABTS+ clearance assay.

[0030] ABTS + • It is a fairly stable blue-green free radical cation that transforms into colorless ABTS in the presence of a hydrogen-donating antioxidant. Antioxidant peptides scavenge ABTS. + The antioxidant capacity was determined by the change in absorbance at 734 nm. The antioxidant capacity of the sample was compared with that of ABTS. + • The clearance rate is directly proportional to the clearance rate of ABTS. + • The clearance rate (%) is calculated using the following formula:

[0031] Clearance rate (%) = (A control -A sample ) / A control ×100

[0032] A control This is the absorbance of the control group (usually a solution without a sample, or a solution with no antioxidant activity); A sample This is the absorbance of the sample group (the solution containing the sample to be tested). The higher the clearance rate, the stronger the antioxidant activity of the sample.

[0033] ① Preparation of ABTS stock solution, concentration 2 mM. ② Preparation of K2S2O8 in PBS solution, concentration 70 mM. ③ ABTS + • Preparation: Before use, mix ABTS stock solution and K2S2O8 solution at a volume ratio of 250:1 and incubate at room temperature in the dark for 15-16 hours. ④ Dilute ABTS with PBS before the experiment. + • Prepare a solution with an A734 concentration between 0.8 and 0.030. Pipette the diluted ABTS solution. + • Add 10 μL of the sample to be tested (final concentration of 0, 20, 40, or 80 μg / mL) to 200 μL of solution, and measure its absorbance once per minute at a wavelength of 734 nm.

[0034] All of the above experiments used sample soluble solution (PBS) as a control.

[0035] The results are as follows Figure 1The results showed that 80ug / ml of Pueraria lobata multifunctional immunomodulatory peptide Puerenin could rapidly clear ABTS. + Free radicals were scavenged, with a 90% clearance rate within 2 minutes. This indicates that Puerenin, a multifunctional immunomodulatory peptide from the Puer tree frog skin, has a strong antioxidant effect and also has advantages such as simple sequence and low synthesis cost, making it suitable for use in the preparation of drugs for skin antioxidant protection and scavenging of free radicals in the body.

[0036] II. The DNA-binding and DNA-clearing effects of Puerenin, a multifunctional immunomodulatory peptide in the skin of the Puerh tree frog.

[0037] 1. DNA Binding Activity Assay: ① Prepare DNA and Puerenin-DNA complexes, then identify them by 1% agarose gel electrophoresis. After electrophoresis, photograph and record the data under UV light. The preparation method of Puerenin-DNA complex is as follows: Dissolve 2 mg of Puerenin and 0.4 mg of DNA in 2 ml of PBS solution and incubate at room temperature for 15 minutes. Figure 2 (B). ② The dissociation constant (KD) was determined using the Octet RED96 system (ForteBio) via BLI to quantitatively assess the binding affinity between DNA and Puerenin. Biotin-labeled DNA (200 nM) was immobilized on Dip and Read biotin biosensors (ForteBio) and equilibrated with PBST solution. The biosensors were then exposed to different concentrations of peptides (5, 12.5, 25 μM) and washed with PBST (dissociation). Affinity (KD) was calculated using data analysis software (Forteio). The smaller the KD value, the stronger the binding affinity between the two substances. BLI results showed that Puerenin and CpG (a reporter molecule for DNA binding detection) had a high affinity (KD = 3.8 pM). Figure 2 (B).

[0038] 2. Effect of Puerenin on DNA Damage in Photodamaged Mice: C57BL / 6 mice were treated with or without Puerenin (200 μg / mL) after UVB irradiation. Fresh skin tissue was collected 96 hours later and dehydrated overnight at 4°C in 15% sucrose solution (prepared with PBS). The next day, the dehydrated skin samples were embedded in OCT embedding medium, and 15 μm frozen sections were prepared using a Leica cryostat for extracellular DNA staining. The sections were fixed in 4% paraformaldehyde for 30 minutes. Then, they were stained with SYTOX Orange nucleic acid staining solution (1:3000) for 15 minutes, washed three times with PBS, and finally mounted with neutral resin. The slides were imaged using a confocal microscope. SYTOX Orange staining results showed a large accumulation of extracellular DNA in the skin of the photodamaged mouse model. Compared with the model group, the local cfDNA level in the Puerenin treatment group was significantly reduced. Furthermore, Puerenin treatment effectively downregulated peripheral blood serum extracellular DNA to levels comparable to those in normal mice. Figure 2 (C).

[0039] Experimental results show that the multifunctional immunomodulatory peptide Puerenin has strong DNA-binding activity and can effectively remove damaged DNA from photo-damaged mice. Figure 2 ).

[0040] III. Application of Puerenin, a multifunctional immunomodulatory peptide from the skin of the Puer pterosa tree frog, in the preparation of drugs for treating skin photodamage.

[0041] Adult female C57BL / 6 mice (6-8 weeks old, 18-20g) were used in the experiment. After one week of acclimatization under standard conditions, the mice were randomly divided into four groups (n=10 per group): normal group (hair removal only, no UVB irradiation), model group (UVB irradiation + PBS treatment), and Puerenin treatment group (UVB irradiation + Puerenin treatment). The model group and the treatment group received a single high-dose UVB irradiation of 1000mJ / cm². The normal group and the model group were treated with PBS daily, while the Puerenin treatment group was treated with 100μL of Puerenin solution (200μg / mL, PBS solvent) daily. The skin on the back of the mice was photographed and observed until day 7.

[0042] The results are as follows Figure 3 As shown: After ultraviolet radiation, mice developed diffuse erythema and swelling on their skin 24 hours after radiation, which progressively worsened. Scratching led to erosion, ulceration, exudation, and crusting. Puerenin treatment significantly inhibited ultraviolet-induced skin erythema and edema.

[0043] Experimental results show that the multifunctional immunomodulatory peptide Puerenin has a strong anti-photodamage effect on the skin. Figure 3 ).

Claims

1. An immunomodulatory peptide, Puerenin, characterized in that... The amino acid sequence of the immunomodulatory peptide Puerenin is shown in SEQ ID NO:

2.

2. An application of the immunomodulatory peptide Puerenin according to claim 1, characterized in that... The application of the immunomodulatory peptide Puerenin in the preparation of drugs for treating skin photodamage.

Images