Modified natural killer (NK) cells for immunotherapy

Abstract

The present disclosure relates to the production of NK cells (or other lymphocytes) from induced pluripotent cells derived from cells, such as maturely developed T cells, and their use for immunotherapy.

Description

This application is a divisional application of an invention patent application with an application date of February 14, 2020, application number 202080014486.8, and invention name “Modified Natural Killer (NK) Cells for Immunotherapy”. Related Applications

[0001] This application claims priority to U.S. Provisional Application No. 62 / 806,457, filed on February 15, 2019; U.S. Provisional Application No. 62 / 841,066, filed on April 30, 2019; U.S. Provisional Application No. 62 / 841,684, filed on May 1, 2019; and U.S. Provisional Application No. 62 / 943,649, filed on December 4, 2019, the entire contents of each of which are expressly incorporated herein by reference. Background Art

[0002] NK cells can be used for immunotherapy, for example, in the context of immuno-oncology. NK cells are a type of cytotoxic innate lymphocytes. NK cells play an important role in tumor immunity, and the cytotoxic activity of NK cells is tightly regulated by a network of activation and inhibition pathways (see, e.g., Gras Navarro A, Bjorklund AT and Chekenya M (2015) Front. Immunol. [Immunology Frontier] 6: 202; incorporated herein by reference in its entirety).

[0003] The use of naturally occurring or modified NK cells in immunotherapy methods has been reported, such as by autologous or allogeneic NK cell transfer, and although some success has been achieved, this method is typically characterized by suboptimal NK cell responses. In the context of immuno-oncology, it is believed that the suboptimal response is at least partially directed to tumors that utilize NK cell inhibition pathways to inhibit cytotoxic NK cell activity, limit NK cell invasion and / or inhibit NK cell proliferation and survival. Therefore, limited success has been seen in the use of NK cells in the therapy of solid tumors.

[0004] Preliminary work has been done in attempting to focus NK cell responses on specific cells, for example, by expressing chimeric antigen receptors in NK cells that target NK cells to tumor cells, or by modulating activation or inhibition of NK cell pathways to achieve stronger and / or more sustained NK cell responses. See, e.g., Jing Y, et al. (2015) PLoS ONE [Public Library of Science Comprehensive] 10(3): e0121788; and Oberschmidt O, Kloess S and Koehl U (2017) Front. Immunol. [Immunology Frontier] 8: 654; incorporated herein by reference in their entirety.

[0005] In order to seek off-the-shelf allogeneic NK cell therapies that can be used in combination with therapeutic antibodies, an induced pluripotent stem cell line has been developed in which the cells express an enhanced version of CD16 (hnCD16), and NK cells have been derived from this iPSC line. See, e.g., Li et al., Cell Stem Cell. 2018 Aug 2; 23(2): 181-192.e5; incorporated herein by reference in its entirety.

[0006] However, all of these approaches have met with limited success to date, and there remains a need to develop better treatments for immunotherapy. Summary of the invention

[0007] Some aspects of the present disclosure provide compositions, cells, cell groups, methods, strategies and treatments available in the context of immunotherapy methods such as immuno-oncology treatment methods. In some embodiments, the present disclosure provides modified NK cells (or other lymphocytes) that can be used for NK cell therapy, for example, in the context of immunotherapy methods. In some embodiments, the cells and cell groups provided herein are characterized by one or more modifications, which enhance their efficacy in immunotherapy methods. For example, in some embodiments, NK cells are provided, and these NK cells include one or more modifications as follows, which achieve the loss of function of genes or proteins related to the inhibition of NK cell function in the treatment context; and / or one or more modifications as follows, which achieve the expression of exogenous nucleic acids or proteins related to the enhanced NK cell function in the treatment context. In some embodiments, the present disclosure provides modified NK cells derived from induced pluripotent cells (iPSC). NK cells derived from iPSC are also referred to as iNK cells herein. In some embodiments, modified iNK cells are provided, which are derived from somatic cells, such as, but not limited to, fibroblasts, peripheral blood cells or mature T cells (T cells that have undergone thymic selection). In some embodiments, the NK or iNK cells provided herein comprise one or more genome edits, such as indels or insertions of exogenous nucleic acid constructs caused by cutting genomic loci with RNA-guided nucleases. The use of RNA-guided nuclease technology in the context of generating modified NK and iNK cells allows the engineering of complex changes with enhanced properties relevant to clinical applications.

[0008] Some aspects of the present disclosure provide complex editing strategies, and the resulting NK cells with complex genomic changes, which allow the production of advanced NK cell products for clinical applications (e.g., for immuno-oncology treatment methods). In certain embodiments, the modified NK cells provided herein can be used as ready-made clinical solutions for patients suffering from or diagnosed with hyperproliferative diseases (e.g., cancer). In certain embodiments, compared with unmodified NK cells, modified NK cells show enhanced survival rate, proliferation, NK cell response level, NK cell response duration, resistance to NK cell exhaustion and / or target recognition. For example, the modified NK cells provided herein may include genome editing resulting in the following conditions in the modified NK cells: expression of a chimeric antigen receptor (CAR) of interest, e.g., a CAR targeting mesothelin, EGFR, HER2, and / or MICA / B; expression of CD16 variants, e.g., non-naturally occurring CD16 variants, such as hnCD16 (see, e.g., Zhu et al., Blood [blood] 2017, 130:4452, the contents of which are incorporated herein by reference in their entirety); expression of IL15 / IL15RA fusions; loss of function of TGFβ receptor 2 (TGFβR2); and / or expression of dominant negative TGFβR2 variants; loss of function of ADORA2A; loss of function of B2M; expression of HLA-G; loss of function of CIITA; loss of function of PD1; loss of function of TIGIT; and / or loss of function of CISH; or any combination of two or more thereof. In one embodiment, the modified NK cells include genome editing resulting in loss of function of TGFβR2 and loss of function of CISH. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of TGFβR2 and loss of function of TIGIT. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of TGFβR2 and loss of function of ADORA2A. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of TGFβR2 and loss of function of NKG2A. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of CISH and loss of function of TIGIT. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of CISH and loss of function of ADORA2A. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of CISH and loss of function of NKG2A. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of TIGIT and loss of function of ADORA2A. In one embodiment, the modified NK cell comprises a genome editing that results in loss of function of TIGIT and loss of function of NKG2A.In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of ADORA2A and loss of function of NKG2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TGFβR2, loss of function of CISH, and loss of function of TIGIT. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TGFβR2, loss of function of CISH, and loss of function of ADORA2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TGFβR2, loss of function of CISH, and loss of function of NKG2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TGFβR2, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TGFβR2, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TGFβR2, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of CISH, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of CISH, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of CISH, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified NK cells comprise genome editing resulting in loss of function of TIGIT, loss of function of ADORA2A, and loss of function of NKG2A.

[0009] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0010] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; expression of soluble MICA and / or MICB; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0011] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; expression of soluble MICA and / or MICB; expression of exogenous IL-12; expression of exogenous IL-18; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0012] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; expression of exogenous IL-12; expression of exogenous IL-18; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0013] In one aspect, the disclosure features a modified lymphocyte, wherein the modified lymphocyte does not express endogenous CD3, CD4 and / or CD8; and expresses at least one endogenous gene encoding: (i) CD56 (NCAM), CD49 and / or CD45; (ii) NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group-2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptor; or any combination of two or more thereof; wherein the modified lymphocyte further: (1) comprises at least one exogenous nucleic acid construct encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) interleukin (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA Class II histocompatibility antigen alpha chain gene, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of CISH. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH and loss of function of TIGIT.In one embodiment, the modified lymphocytes exhibit loss of function of CISH and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TIGIT and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TIGIT and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of ADORA2A and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH, loss of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TIGIT, loss of ADORA2A, and loss of function of NKG2A.

[0014] In one embodiment, the modified lymphocytes do not express endogenous CD3, CD4 and / or CD8; and express at least one endogenous gene encoding: (i) CD56 (NCAM), CD49 and / or CD45; (ii) NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group-2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptor; or any combination of two or more thereof; wherein the modified lymphocytes further: (1) comprise at least one exogenous nucleic acid construct encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγR III, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or its variants; (v) interleukin 12 (IL-12); (vi) interleukin-12 receptor (IL-12R) or its variants; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) a nucleic acid sequence encoding the leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) exhibits loss of function of transforming growth factor beta receptor 2 (TGFβR2), cytokine-inducible SH2-containing protein (CISH), or a combination thereof.

[0015] In some embodiments, the nucleic acid construct is an expression construct comprising a nucleic acid sequence encoding a gene product listed under (1)(i)-(1(ix) or any combination thereof, operably linked to a promoter that drives expression of the nucleic acid sequence in a target cell (e.g., a modified lymphocyte, e.g., a modified NK cell provided herein). In some embodiments, the promoter is specifically expressed in the target cell, e.g., the promoter is a lymphocyte or NK cell-specific promoter. In some embodiments, the promoter is a CD56 (NCAM) promoter. In some embodiments, the promoter is a CD49 promoter. In some embodiments, the promoter is a CD45 promoter. In some embodiments, the promoter is an FcγRIII promoter. In some embodiments, the promoter is an NKG2D promoter. In some embodiments, the promoter is a CD69 promoter.

[0016] In some embodiments, an exogenous nucleic acid construct encoding a gene product listed under (1) is knocked into a genomic locus encoding a gene product listed under (2), resulting in loss of function of the gene product listed under (2) and expression of the gene product encoded by the exogenous nucleic acid construct, driven by a heterologous promoter or by an endogenous promoter of the genomic locus into which the exogenous nucleic acid construct was knocked.

[0017] In some embodiments, an exogenous nucleic acid construct encoding a gene product listed under (1) is knocked into a "safe harbor" locus, such as the ROSA26 locus, the collagen locus, or the AAVSI genomic locus.

[0018] In some embodiments, two or more HLA class II histocompatibility antigen alpha chain genes are selected from HLA-DQA1, HLA-DRA, HLA-DPAl, HLA-DMA, HLA-DQA2, and HLA-DOA. In some embodiments, two or more HLA class II histocompatibility antigen beta chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPBl, HLA-DQBl, HLA-DQB3, HLA-DQB2, HLA-DRBl, HLA-DRB3, HLA-DRB4, and HLA-DRB5.

[0019] In some embodiments, the modified lymphocytes comprise a rearranged endogenous T cell receptor (TCR) locus. In some embodiments, the rearranged TCR comprises a TCRα VJ and / or TCRβ V(D)J segment rearrangement and a complete V-domain exon.

[0020] In some embodiments, the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

[0021] In some embodiments, the IL-15R variant is a constitutively active IL-15R variant. In some embodiments, the constitutively active IL-15R variant is a fusion of IL-15R and an IL-15R agonist (e.g., an IL-15 protein or an IL-15R binding fragment thereof). In some embodiments, the IL-15R agonist is IL-15, or an IL-15R binding variant thereof. Exemplary suitable IL-15R variants include, but are not limited to, for example, those described in: Mortier E et al., 2006; The Journal of Biological Chemistry [Journal of Biological Chemistry] 2006 281: 1612-1619; or Bessard-A et al., Mol Cancer Ther. [Molecular Cancer Therapeutics] September 2009; 8 (9): 2736-45, the entire contents of each of which are incorporated herein by reference. Based on the present disclosure and the knowledge in the art, additional suitable variants are obvious to those of ordinary skill in the art. The present disclosure is not limited in this regard.

[0022] In some embodiments, TGFβR2 is a dominant negative variant of TGFβ receptor II (DN-TGFβR2).

[0023] In some embodiments, CAR is capable of binding to mesothelin, EGFR, HER2, MICA / B, BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptide (i.e., E7), EBV viral peptide, CD70, WT1, CEA, EGFRvIII, IL13Rα2, GD2, CA125, CD7, EpCAM, Muc16 and / or CD30.

[0024] In some embodiments, the modified lymphocytes are derived from pluripotent or multipotent stem cells. In some embodiments, the multipotent stem cells are hematopoietic stem cells (HSC). In some embodiments, the multipotent stem cells are induced pluripotent stem cells (iPSC). In some embodiments, the multipotent stem cells are embryonic stem cells (ESC).

[0025] In some embodiments, the modified lymphocytes are derived from pluripotent or multipotent stem cells, which contain at least one or more exogenous nucleic acid constructs encoding any one of (1)(i)-(1)(ix) or any combination thereof; and / or at least one genomic alteration that achieves a loss of function of any one of (2)(i)-(2)(xi) or any combination thereof in the lymphocytes.

[0026] In some embodiments, the modified lymphocytes are derived from pluripotent or multipotent stem cells comprising at least one genomic alteration that achieves loss of function of any of (2)(i)-(2)(xi) or any combination thereof in the lymphocytes.

[0027] In some embodiments, at least one genomic alteration that achieves loss of function of one or more of (2)(i)-(2)(xi) in a lymphocyte comprises insertion of an exogenous nucleic acid construct.

[0028] In some embodiments, the exogenous nucleic acid construct encodes any one of (1)(i)-(1)(ix) or any combination thereof.

[0029] In some embodiments, the modified lymphocytes exhibit loss of function of two or more of the genes / proteins listed under (2).

[0030] In some embodiments, the modified lymphocyte comprises an deletion or insertion of an exogenous nucleotide construct in a genomic locus containing a gene or encoding a protein under (2).

[0031] In some embodiments, the modified lymphocytes comprise deletions or insertions of exogenous nucleotide constructs in two or more genomic loci containing genes or encoding proteins under (2).

[0032] In some embodiments, the modified lymphocytes are obtained by editing the genomic locus with an RNA-guided nuclease. In some embodiments, the RNA-guided nuclease is a CRISPR / Cas nuclease. In some embodiments, the RNA-guided nuclease is selected from the group consisting of SpCas9, SaCas9, (KKH) SaCas9, AsCpf1 (AsCas12a), LbCpf1, (LbCas12a), CasX, CasY, Cas12h1, Cas12i1, Cas12c1, Cas12c2, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fok1, Sniper-Cas9, xCas9, AaCas12b, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9, BhCas12b, and BhCas12b V4.

[0033] In some embodiments, the modified lymphocytes are obtained by editing two or more genomic loci containing genes encoding any of the proteins under (2). In some embodiments, at least two of the two or more genomic loci containing genes encoding any of the proteins under (2) have been edited by different RNA-guided nucleases. In some embodiments, at least one of the two or more genomic loci containing genes encoding any of the proteins under (2) has been edited by Cas9, and wherein at least one of the loci has been edited by Cpf1.

[0034] In some embodiments, the modified lymphocytes express endogenous CD56, CD49, and CD45.

[0035] In some embodiments, the modified lymphocytes are natural killer (NK) cells.

[0036] In another aspect, the disclosure features a modified cell, wherein the modified cell (1) comprises at least one exogenous nucleic acid construct encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, cluster of differentiation 16 (CD16)); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD 47 (CD47); or any combination of two or more thereof; and / or (2) exhibits loss of function of at least one of the following: (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA Class II histocompatibility antigen alpha chain gene, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof. In one embodiment, the modified cell exhibits loss of function of TGFβR2 and loss of function of CISH. In one embodiment, the modified cell exhibits loss of function of TGFβR2 and loss of function of TIGIT. In one embodiment, the modified cell exhibits loss of function of TGFβR2 and loss of function of ADORA2A. In one embodiment, the modified cell exhibits loss of function of TGFβR2 and loss of function of NKG2A. In one embodiment, the modified cell exhibits loss of function of CISH and loss of function of TIGIT. In one embodiment, the modified cell exhibits loss of function of CISH and loss of function of ADORA2A. In one embodiment, the modified cell exhibits loss of function of CISH and loss of function of NKG2A. In one embodiment, the modified cell exhibits loss of function of TIGIT and loss of function of ADORA2A. In one embodiment, the modified cell exhibits loss of function of TIGIT and loss of function of NKG2A.In one embodiment, the modified cells exhibit loss of function of ADORA2A and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of TIGIT. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of ADORA2A. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of TGFβR2, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified cells exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified cells exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified cell exhibits loss of function of CISH, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified cell exhibits loss of function of TIGIT, loss of function of ADORA2A, and loss of function of NKG2A.

[0037] In one embodiment, the modified cell (1) comprises at least one exogenous nucleic acid construct encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, cluster of differentiation 16 (CD16)); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) exhibits loss of function of transforming growth factor beta receptor 2 (TGFβR2), cytokine-inducible SH2-containing protein (CISH), or a combination thereof.

[0038] In some embodiments of the modified cells (e.g., modified lymphocytes) provided herein comprising an exogenous nucleic acid construct, the exogenous nucleic acid construct is an expression construct comprising a nucleic acid sequence encoding a gene product listed under (1)(i)-(1(x) or any combination thereof, operably linked to a promoter that drives expression of the nucleic acid sequence in a target cell (e.g., a modified lymphocyte, e.g., a modified NK cell provided herein). In some embodiments, the promoter is specifically expressed in the target cell, e.g., the promoter is a lymphocyte or NK cell-specific promoter. In some embodiments, the promoter is a CD56 (NCAM) promoter. In some embodiments, the promoter is a CD49 promoter. In some embodiments, the promoter is a CD45 promoter. In some embodiments, the promoter is an FcγRIII promoter. In some embodiments, the promoter is an NKG2D promoter. In some embodiments, the promoter is a CD69 promoter.

[0039] In some embodiments of the modified cells (e.g., modified lymphocytes) provided herein, an exogenous nucleic acid construct encoding a gene product listed under (1) is knocked into a genomic locus encoding a gene product listed under (2), resulting in loss of function of the gene product listed under (2) and expression of the gene product encoded by the exogenous nucleic acid construct, driven by a heterologous promoter or by an endogenous promoter of the genomic locus into which the exogenous nucleic acid construct was knocked.

[0040] In some embodiments of the modified cells (e.g., modified lymphocytes) provided herein, the modified cells comprise functional loss of two or more HLA class II histocompatibility antigen alpha chain genes and / or two or more HLA class II histocompatibility antigen beta chain genes, the two or more HLA class II histocompatibility antigen alpha chain genes being selected from HLA-DQA1, HLA-DRA, HLA-DPAl, HLA-DMA, HLA-DQA2, and HLA-DOA. In some embodiments, two or more HLA class II histocompatibility antigen beta chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPBl, HLA-DQBl, HLA-DQB3, HLA-DQB2, HLA-DRBl, HLA-DRB3, HLA-DRB4, and HLA-DRB5.

[0041] In some embodiments, the modified cells are immune cells. In some embodiments, the immune cells are lymphocytes. In some embodiments, the lymphocytes are NK cells. In some embodiments, the lymphocytes are iNK cells.

[0042] In some embodiments, the modified cell is a pluripotent or multipotent stem cell, such as an iPS cell or a hematopoietic stem cell, or a differentiated cell derived from such a pluripotent or multipotent stem cell, such as an iNK cell.

[0043] In some embodiments, the modified cells do not express endogenous T cell co-receptors.

[0044] In some embodiments, the lymphocytes are T cells.

[0045] In some embodiments, the modified cell comprises a rearranged endogenous TCR locus, wherein the rearranged TCR comprises TCRα VJ and / or TCRβ V(D)J segment rearrangements and complete V-domain exons.

[0046] In some embodiments, the modified cells express at least one endogenous gene encoding: (i) CD56 (NCAM), CD49 and / or CD45; (ii) NK cell receptor (cluster of differentiation 16 (CD16)); (iii) natural killer group-2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptor; or any combination of two or more thereof.

[0047] In some embodiments, the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

[0048] In some embodiments, the modified cells express at least one NK cell biomarker. In some embodiments, the NK cell biomarker is CD56, CD49 and / or CD45.

[0049] In one aspect, disclosed herein is a cell population comprising the modified lymphocytes described herein or the modified cells described herein.

[0050] In one aspect, disclosed herein is a pharmaceutical composition comprising a cell population disclosed herein.

[0051] In another aspect, the present disclosure provides an isolated lymphocyte population, wherein the cell population comprises at least 1 x 10 3 , at least 1x 10 4 , at least 1x 10 5 , at least 2x 10 5 , at least 3x 10 5 , at least 4x 10 5 , at least 5x 10 5 , at least 1x 10 6 , at least 2x 10 6 , at least 3x 10 6 , at least 4x 10 6, at least 5x 10 6 , at least 1x 10 7 , at least 1x 10 7 , at least 2x 10 7 , at least 3x10 7 , at least 4x 10 7 , at least 5x 10 7 , at least 1x 10 8 , at least 2x 10 8 , at least 3x 10 8 , at least 4x 10 8 , at least 5x10 8 , at least 1x 10 9 , at least 1x 10 9 , at least 2x 10 9 , at least 3x 10 9 , at least 4x 10 9 , at least 5x 10 9 , at least 1x10 10 , at least 2x 10 10 , at least 3x 10 10 , at least 4x 10 10 , at least 5x 10 10 , at least 1x 10 11 , or at least 1x 10 12cells, and wherein at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, at least 99.99%, at least 99.999%, or nearly 100% of the lymphocytes in the cell population: (a) contain a rearranged T cell receptor (TCR) locus; (b) do not express endogenous CD3; (c) express endogenous CD56 (NCAM), CD49 and / or CD45; and (d) express endogenous genes encoding at least: (i) NK The modified lymphocyte further comprises: (1) at least one exogenous nucleic acid construct encoding: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, CD16); (iii) an interleukin 15 (IL-15 ); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) exhibits loss of function of at least one of the following: (i) transforming growth factor beta receptor 2 (TGFβR2 ); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen alpha chain genes, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof. In one embodiment, the modified lymphocyte exhibits loss of function of TGFβR2 and loss of function of CISH. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of ADORA2A.In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2 and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH and loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit loss of function of CISH and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TIGIT and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TIGIT and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of ADORA2A and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of TIGIT. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of CISH, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TGFβR2, loss of function of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of ADORA2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH, loss of function of TIGIT, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of CISH, loss of ADORA2A, and loss of function of NKG2A. In one embodiment, the modified lymphocytes exhibit loss of function of TIGIT, loss of ADORA2A, and loss of function of NKG2A.

[0052] In one embodiment, the isolated lymphocyte population comprises at least 1 x 10 3 , at least 1x 10 4 , at least 1x 10 5 , at least 2x 10 5 , at least 3x 10 5 , at least 4x 10 5 , at least 5x 105 , at least 1x 10 6 , at least 2x 10 6 , at least 3x 10 6 , at least 4x 10 6 , at least 5x 10 6 , at least 1x 10 7 , at least 1x 10 7 , at least 2x 10 7 , at least 3x 10 7 , at least 4x 10 7 , at least 5x10 7 , at least 1x 10 8 , at least 2x 10 8 , at least 3x 10 8 , at least 4x 10 8 , at least 5x 10 8 , at least 1x 10 9 , at least 1x10 9 , at least 2x 10 9 , at least 3x 10 9 , at least 4x 10 9 , at least 5x 10 9 , at least 1x 10 10 , at least 2x 10 10 , at least 3x10 10 , at least 4x 10 10 , at least 5x 10 10 , at least 1x 10 11 , or at least 1x10 12cells, and wherein at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, at least 99.99%, at least 99.999%, or nearly 100% of the lymphocytes in the cell population: (a) contain a rearranged T cell receptor (TCR) locus; (b) do not express endogenous CD3; (c) express endogenous CD56 (NCAM), CD49 and / or CD45; and (d) express endogenous genes encoding at least: (i) NK cell receptor (cluster of differentiation 16 (CD16)); (ii) natural killer group-2 member D (NKG2D); (iii) CD69; (iv) natural cytotoxicity receptor; or any combination of two or more thereof; and wherein the modified lymphocytes further: (1) contain at least one An exogenous nucleic acid construct encoding the following: (i) a chimeric antigen receptor (CAR); (ii) a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen differentiation cluster CD47 (CD47); or any combination of two or more thereof; and / or (2) exhibits loss of function of transforming growth factor beta receptor 2 (TGFβR2), cytokine-inducible SH2-containing protein (CISH), or a combination thereof.

[0053] In some embodiments, the rearranged TCR locus comprises TCRα VJ and / or TCRβ V(D)J segment rearrangements and complete V-domain exons. In some embodiments, the rearranged endogenous TCR locus consists of no more than two rearranged alleles.

[0054] In some embodiments, the natural cytotoxic receptor is NKp30, NKp44, NKp46, and / or CD158b.

[0055] In some embodiments, the in vitro lymphocyte population does not contain more than 1%, more than 0.1%, more than 0.001%, more than 0.0001%, more than 0.00001%, more than 0.000001%, more than 0.0000001%, more than 0.00000001%, more than 0.000000001%, more than 0.0000000001%, or more than 0.00000000001% of cells expressing reprogramming factors from an exogenous nucleic acid construct.

[0056] In some embodiments, the in vitro lymphocyte population does not contain cells expressing reprogramming factors from an exogenous nucleic acid construct. In some embodiments, the reprogramming factor is Oct-4 and / or Sox-2.

[0057] In some embodiments, the in vitro lymphocyte population does not contain cells containing an episomal expression construct encoding a reprogramming factor.

[0058] In some embodiments, each cell in the in vitro lymphocyte population comprises the same combination of the exogenous nucleic acid constructs listed under (1) and the loss of functions listed under (2).

[0059] In some embodiments, the in vitro lymphocyte population comprises less than 0.001%, less than 0.002%, less than 0.003%, less than 0.004%, less than 0.005%, less than 0.006%, less than 0.007%, less than 0.008%, less than 0.009%, less than 0.01%, less than 0.02%, less than 0.03%, less than 0.04%, less than 0.05%, less than 0.06%, less than 0.07%, less than 0.08%, less than 0.09%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% of cells containing a chromosomal translocation.

[0060] On the other hand, the disclosure provides a method for treating a subject, the method comprising administering any modified lymphocyte, any modified cell, any pharmaceutical composition or a cell population separated in vitro to a subject in need thereof. In certain embodiments, the subject suffers from or is diagnosed with a proliferative disease. In certain embodiments, the proliferative disease is cancer. In certain embodiments, cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC) or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian cancer / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical cancer and HPV+ head and neck cancer, oral cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcoma and hematological cancers like ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

[0061] In some embodiments, the method of producing the modified lymphocytes, modified cells, cell populations, or lymphocyte populations isolated in vitro of the present disclosure comprises: (a) obtaining induced pluripotent stem cells (iPSCs); (b) modifying the iPSCs or their undifferentiated or differentiated daughter cells to contain at least one exogenous gene of (1) and / or contain loss of function of at least one gene of (2); (c) directing the differentiation of the iPSCs to hematopoietic lineage cells, wherein the hematopoietic lineage cells retain the edited genetic loci contained in the iPSCs.

[0062] In some embodiments, the differentiation direction comprises: (i) contacting iPSCs with a composition comprising a BMP pathway activator and optionally bFGF to obtain mesodermal cells; and (ii) contacting the mesodermal cells with a composition comprising a BMP pathway activator, bFGF and a WNT pathway activator to obtain mesodermal cells with definitive hemogenic endothelial (HE) potential, wherein the mesodermal cells with definitive hemogenic endothelial (HE) potential are capable of providing hematopoietic lineage cells; wherein the mesodermal cells and mesodermal cells with definitive HE potential are obtained in steps (i) and (ii) without the step of embryoid body formation; wherein the hematopoietic lineage cells comprise definitive hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSC), hematopoietic multipotent progenitor cells (MPP), pre-T cell progenitors, pre-NK cell progenitors, T cell progenitors, NK cell progenitors, T cells, NK cells, NKT cells or B cells.

[0063] In some embodiments, the method of directing differentiation of iPSCs to cells of the hematopoietic lineage further comprises: contacting the mesodermal cells having definitive HE potential with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells.

[0064] In some embodiments, the differentiation directed method further comprises contacting the definitive HE cells with a composition comprising a BMP activator and optionally a ROCK inhibitor and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L and IL11 to obtain hematopoietic multipotent progenitor cells (MPPs).

[0065] In some embodiments, the differentiation directed method further comprises: contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L and IL7; and optionally one or more of a BMP activator, a ROCK inhibitor, TPO, VEGF and bFGF, to obtain pre-T cell progenitors, T cell progenitors and / or T cells.

[0066] In some embodiments, the differentiation directed method further comprises contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7 and IL15, and optionally one or more of a BMP activator, a ROCK inhibitor, VEGF and bFGF to obtain pre-NK cell progenitors, NK cell progenitors and / or NK cells.

[0067] In some embodiments, the method of producing the modified lymphocytes, modified cells, cell populations, or lymphocyte populations isolated in vitro of the present disclosure further comprises: prior to step c), contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor, and a ROCK inhibitor to seed and expand these cells.

[0068] In some embodiments, the method for producing the modified lymphocytes, modified cells, cell groups or lymphocyte groups separated in vitro of the present disclosure further comprises: detecting the rearranged T cell receptor (TCR) loci in these hematopoietic lineage cells. In some embodiments, the method further comprises selecting hematopoietic lineage cells comprising the rearranged TCR loci based on the TCR encoded by the rearranged TCR loci in conjunction with the target antigen. In some embodiments, the target antigen is a tumor antigen.

[0069] On the other hand, the present disclosure provides a method comprising: reprogramming a donor cell to a pluripotent state; editing a target locus in the donor cell genome; and differentiating the reprogrammed donor cell into a lymphocyte. In some embodiments, editing is performed before or during the step of reprogramming the donor cell to a pluripotent state. In some embodiments, the donor cell is a fibroblast, a peripheral blood cell, a lymphocyte, or a T cell.

[0070] In another aspect, the present disclosure provides a method comprising: differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises: (1) an exogenous nucleic acid comprising: (i) a nucleic acid encoding a chimeric antigen receptor (CAR); (ii) a nucleic acid encoding a non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, CD16); (iii) a nucleic acid encoding interleukin 15 (IL-15); (iv) a nucleic acid encoding IL-15R or a variant thereof; (v) a nucleic acid encoding interleukin 12 (IL-12); (vi) a nucleic acid encoding IL-12R or a variant thereof; (vii) a nucleic acid encoding human leukocyte antigen G (HLA-G); (viii) a nucleic acid encoding human leukocyte antigen E (HLA-E); (ix) ) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and (2) exogenous nucleic acid insertions or deletions in one or more of the following genetic loci: (i) transforming growth factor beta receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1, CD279); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA Class II histocompatibility antigen alpha chain gene, and / or two or more HLA class II histocompatibility antigen beta chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof, wherein the deletion or insertion results in a loss of function of a gene product encoded by the corresponding one or more genetic loci. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises an exogenous nucleic acid deletion or insertion in TGFβR2 and CISH, wherein the deletion or insertion results in a loss of function of a gene product encoded by TGFβR2 and / or CISH. In one embodiment, the method comprises differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises an exogenous nucleic acid deletion or insertion in TGFβR2 and TIGIT, wherein the deletion or insertion results in a loss of function of a gene product encoded by TGFβR2 and / or TIGIT.In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in TGFβR2 and ADORA2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by TGFβR2 and / or ADORA2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in TGFβR2 and NKG2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by TGFβR2 and / or NKG2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in CISH and TIGIT, wherein the insertion or insertion results in a loss of function of a gene product encoded by CISH and / or TIGIT. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in CISH and ADORA2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by CISH and / or ADORA2A. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in CISH and NKG2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by CISH and / or NKG2A. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in TIGIT and ADORA2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by TIGIT and / or ADORA2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in TIGIT and NKG2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by TIGIT and / or NKG2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in ADORA2A and NKG2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by ADORA2A and / or NKG2A.In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in TGFβR2, CISH and TIGIT, wherein the insertion or insertion results in the loss of function of the gene product encoded by TGFβR2, CISH and / or TIGIT. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in TGFβR2, CISH and ADORA2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by TGFβR2, CISH and / or ADORA2A. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in TGFβR2, CISH and NKG2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by TGFβR2, CISH and / or NKG2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in TGFβR2, TIGIT and ADORA2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by TGFβR2, TIGIT and / or ADORA2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in TGFβR2, TIGIT and NKG2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by TGFβR2, TIGIT and / or NKG2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in TGFβR2, ADORA2A and NKG2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by TGFβR2, ADORA2A and / or NKG2A. In one embodiment, the method includes differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell includes an exogenous nucleic acid insertion or insertion in CISH, TIGIT and ADORA2A, wherein the insertion or insertion results in a loss of function of a gene product encoded by CISH, TIGIT and / or ADORA2A.In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in CISH, TIGIT and NKG2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by CISH, TIGIT and / or NKG2A. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in CISH, ADORA2A and NKG2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by CISH, ADORA2A and / or NKG2A. In one embodiment, the method includes differentiating genetically modified pluripotent stem cells into lymphocytes, wherein the genetically modified pluripotent stem cells include exogenous nucleic acid insertions or insertions in TIGIT, ADORA2A and NKG2A, wherein the insertion or insertion results in the loss of function of the gene product encoded by TIGIT, ADORA2A and / or NKG2A.

[0071] In some embodiments, the exogenous nucleic acid of (2) is the exogenous nucleic acid of (1). In some embodiments, the pluripotent stem cells are iPS cells. In some embodiments, the differentiation comprises contacting the pluripotent stem cells with a differentiation medium or a series of differentiation mediums. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1A and 1B Robust single and double gene editing of TGFBR2 and CISH in NK cells is depicted. Targeting TGFBR2 and CISH individually and simultaneously in NK cells using CRISPR-Cpf1 generated insertions / deletions (in / del) at both targets in greater than 80% of NK cells, with greater than 90% of edited NK cells surviving 72 hours after editing.

[0073] Figure 2A and 2B Normalization of the spheroid curves is depicted to maintain the same efficacy pattern observed in the non-normalized data, as analyzed in 3 unique donors and 5 independent experiments. Each single knockout (SKO) NK group was significantly more effective than the control NK in reducing SK-OV-3 spheroid size, and the double knockout (DKO) NK group was significantly more effective than the SKO NK group in reducing SK-OV-3 spheroid size. Figure 2A Depicted are analysis of SK-OV-3 spheroids with 10 ng / mL TGFβ at 10:1 E:T (3 donors, 5 independent experiments). Figure 2BWith error bars as SEM. Statistical significance is the result of two-way ANOVA analysis. Two-way ANOVA analysis excluded time points greater than 104 hours in some experiments due to missing time points. Mixed model analysis produced the same or improved statistical significance between groups when considering all time points.

[0074] Figure 3A and Figure 3B Depicted are CISH / TGFBR2 double knockout NK cells demonstrating superior effector function relative to single knockout NK cells or control NK cells even at lower NK effector cell to target cell (E:T) ratios in a SK-OV-3 spheroid assay. Figure 3A Depicted are analysis of SK-OV-3 spheroids with 10 ng / mL TGF-β at 20:1 E:T, as analyzed in 3 unique donors and 5 independent experiments. Figure 3B Depicted is the analysis of SK-OV-3 spheroids at 10:1 E:T with 10 ng / mL TGF-β, as analyzed in 4 unique donors and 7 independent experiments. These marginal differences between the different E:T ratios in all conditions suggest that the effector cell phenotype is driven by the knockout rather than the NK cell to target cell ratio.

[0075] Figure 4A and Figure 4B Depicted are CISH / TGFBR2 double knockout NK cells demonstrating superior effector function relative to single knockout NK cells or control NK cells in a PC-3 spheroid assay, even at lower NK effector cell to target cell (E:T) ratios. Figure 4A Depicted are PC-3 spheroid analysis with 10 ng / mL TGF-β at 20:1 E:T, as analyzed in 3 unique donors and 5 independent experiments. Figure 4B Depicted is the analysis of PC-3 spheroids at 10:1 E:T with 10 ng / mL TGF-β, as analyzed in 4 unique donors and 7 independent experiments. These marginal differences between the different E:T ratios in all conditions suggest that the effector cell phenotype is driven by the knockout rather than the NK cell to target cell ratio.

[0076] Figure 5A and Figure 5B Depicted are CISH / TGFBR2 double knockout NK cells demonstrating superior effector function relative to single knockout NK cells or control NK cells in SK-OV-3 and PC-3 spheroid assays in the absence of any exogenous cytokines. Figure 5ADepicted are analysis of SK-OV-3 spheroids at 10:1 E:T in the absence of any exogenous cytokines, as analyzed in 4 unique donors and 7 independent experiments. Figure 5B Depicted are analysis of PC-3 spheroids at 10:1 E:T in the absence of any exogenous cytokines, as analyzed in 4 unique donors and 7 independent experiments.

[0077] Fig. 6A Depicts the correlation of IFN-γ concentration with NK cell efficacy in spheroid assays. SK-OV-3 spheroids were analyzed at different E:Ts with 10 ng / mL TGF-β and 5 ng / mL IL-15. Analysis at 5:1 and 10:1 E:T was performed in 4 unique donors and 7 independent experiments. Analysis at 20:1 E:T was performed in 3 unique donors and 5 independent experiments.

[0078] Figure 6B Figure 1 shows the correlation between TNF-α concentration and NK cell efficacy in spheroid assays. SK-OV-3 spheroids were analyzed at different E:Ts with 10 ng / mL TGF-β and 5 ng / mL IL-15. Analysis at 5:1 and 10:1 E:T was performed in 4 unique donors and 7 independent experiments. Analysis at 20:1 E:T was performed in 3 unique donors and 5 independent experiments.

[0079] Figure 6C Depicts marker expression in CISH / TGFBR2 double knockout (DKO) NK cells. Harvest control (unedited) and double knockout NK cells for staining 72 hours after editing. Quantify the expression of NK activation markers CD25 and CD69. Compared with control NK cells, double KO NK cells expressed significantly higher levels of activation markers CD25 and CD69.

[0080] Fig.6D Depicted is the measurement of anti-tumor activity of NK cells in an in vivo model. NSG mice received an intraperitoneal injection of 500,000 SKOV3 tumor cells labeled with luciferase. Seven days after tumor implantation, 10 million edited (CISH / TGFBR2 double knockout) or unedited (control) NK cells were injected into the peritoneal cavity of tumor-bearing mice. Tumor burden was monitored weekly by IP administration of luciferin and IVIS imaging. A two-way ANOVA analysis was performed on day 34 to determine statistical significance between control and DKO NK cell groups (****, p<0.0001)

[0081] Fig. 7A Depicted are robust TIGIT single-gene editing achieved in NK cells in 2 independent experiments and 3 unique donors.

[0082] Figure 7B Depicted are robust NKG2A single gene editing achieved in NK cells in 2 independent experiments and 3 unique donors.

[0083] Figure 7C Depicted are robust ADORA2A single gene editing achieved in NK cells in 3 independent experiments and 3 unique donors.

[0084] Fig. 8A and Figure 8B Depicted are TIGIT single knockout NK cells demonstrating superior effector function relative to unedited control NK cells at various effector to target (E:T) ratios in an in vitro spheroid assay. Fig. 8A Depicted is the analysis of tumor spheroids at 20:1 E:T, as analyzed in 2 unique donors and 2 independent experiments. Red object intensity was measured every two hours for 6 days on an Incucyte imaging system. Figure 8B Depicted are tumor spheroid analysis at 1.25:1, 2.5:1, 5:1, 10:1 and 20:1 effector:target ratios, as analyzed in 2 unique donors and 2 independent experiments. Red target intensity is shown 100 hours after addition of NK cells.

[0085] Fig. 9A and Fig. 9B Depicted are NKG2A single knockout NK cells demonstrating superior effector function relative to unedited control NK cells at various effector to target (E:T) ratios in an in vitro spheroid assay. Fig. 9A Depicted is the analysis of tumor spheroids at 20:1 E:T, as analyzed in 2 unique donors and 2 independent experiments. Red object intensity was measured every two hours for 6 days on an Incucyte imaging system. Fig. 9B Depicted are tumor spheroid analysis at 1.25:1, 2.5:1, 5:1, 10:1 and 20:1 E:T, as analyzed in 2 unique donors and 2 independent experiments. Red target intensity is shown 100 hours after addition of NK cells.

[0086] Fig. 10A and Fig. 10B Depicted are ADORA2A single knockout NK cells demonstrating superior effector function relative to unedited control NK cells at various effector to target cell (E:T) ratios in an in vitro spheroid assay. Fig. 10A Depicted is the analysis of tumor spheroids at 20:1 E:T, as analyzed in 2 unique donors and 2 independent experiments. Red object intensity was measured every two hours for 6 days on an Incucyte imaging system. Fig. 10BDepicted are tumor spheroid analysis at 1.25:1, 2.5:1, 5:1, 10:1 and 20:1 E:T, as analyzed in 2 unique donors and 2 independent experiments. Red target intensity is shown 100 hours after addition of NK cells.

[0087] Fig.11 Depicts triple gene editing of TGFbR2 / CISH / TIGIT achieved in NK cells.

[0088] Fig. 12A and Fig. 12B Depicted are TGFbR2 / CISH / TIGIT triple knockout NK cells demonstrating superior effector function relative to unedited control NK cells at various effector to target cell (E:T) ratios in an in vitro spheroid assay. Fig. 12A Depicted is the analysis of tumor spheroids at 20:1 E: T. Red object intensity was measured every two hours for 6 days on an Incucyte imaging system. Fig. 12B Depicted are tumor spheroid analysis at 5:1, 10:1, and 20:1 E:T. Red target intensity is shown 100 hours after addition of NK cells. DETAILED DESCRIPTION

[0089] Some aspects of the present disclosure provide strategies, compositions and methods that can be used for engineering "ready-made" allogeneic cells, which can be used in clinical applications. Some aspects of the present disclosure provide strategies, compositions and methods that can be used for engineering pluripotent or multipotent stem cells (e.g., induced pluripotent stem cells (iPSC) or hematopoietic stem cells (HSC), which can be used to derive differentiated daughter cells, e.g., modified lymphocytes, such as iNK cells). Immune reactivity (both graft-versus-host and host-versus-graft) is a major challenge to the clinical application of allogeneic cells. Some aspects of the present disclosure provide strategies, compositions and methods for engineering the following cells, which solve various aspects of immunoreactivity typically encountered in unmodified cell transplants in an allogeneic environment.

[0090] Some aspects of the present disclosure provide strategies, compositions and methods that can be used to overcome "non-self" host-versus-graft immune reactivity, for example, by removing MHC I and II class functions in target cells, to carry out allogeneic clinical applications. For example, in some embodiments, MHC I and II class functions are achieved by achieving loss of function of B2M (I class) and CIITA (II class) and / or two or more MHC II class α and / or β chains, as described in more detail elsewhere herein.

[0091] Some aspects of the present disclosure provide strategies, compositions and methods that can be used to overcome "missing self" host-versus-graft immune reactivity, for example, by introducing an exogenous expression construct comprising a nucleic acid sequence encoding an NK inhibitory form into a target cell for allogeneic clinical applications. For example, in some embodiments, this "missing self" immune reactivity is addressed by achieving transgenic expression of HLA-G, HLA-E, and / or CD47 in target cells for allogeneic clinical applications.

[0092] Some aspects of the present disclosure provide strategies, compositions and methods that can be used to overcome graft-versus-host T cell receptor (TCR) alloreactivity by removing endogenous TCR function.For example, in some embodiments, there are provided herein strategies, compositions and methods that can be used to produce modified cells for allogeneic clinical applications from pluripotent or multipotent stem cells, including engineering these stem cells to include immunomodulatory modifications as described herein, and then these stem cells are differentiated into cell types for administration to patients in need, such as differentiated into lymphocytes, such as iNK cells for immunotherapy. In some embodiments, pluripotent or multipotent stem cells are derived from cells expressing TCR or comprising rearranged TCR loci, such as derived from T cells, and in some such embodiments, differentiated lymphocytes derived from such engineered stem cells can express TCR or be targets of TCR alloreactivity. In some such embodiments, it is advantageous to achieve the loss of function of endogenous TCR expression products, and the present disclosure provides strategies, compositions and methods that can be used to achieve this loss of function in corresponding cells, such as, by achieving the loss of function of TRAC described in more detail elsewhere herein.

[0093] Some aspects of the present disclosure relate to the generation of modified NK cells (or other lymphocytes) that can be used as therapeutic agents (e.g., in the context of immuno-oncology). For example, compared to non-modified NK cells, at least some modified NK cells provided herein exhibit enhanced NK cell response characteristics, such as enhanced target recognition, enhanced NK cell response levels and / or duration, improved NK cell survival, delayed NK cell exhaustion, enhanced target recognition and / or recognition of targets that are typically not recognized by unmodified NK cells.

[0094] Some aspects of the present disclosure provide compositions, methods and strategies for producing modified NK cells. In some embodiments, such modified NK cells are produced by editing the genome of mature NK cells. In some embodiments, modified NK cells are produced by editing the genome of cells derived from NK cells in vitro or in vivo. In some embodiments, the cells derived from NK cells are stem cells, such as hematopoietic stem cells (HSC) or pluripotent stem cells, such as embryonic stem cells (ES cells) or induced pluripotent stem cells (iPS cells). For example, in some embodiments, modified NK cells are produced by editing the genome of ES cells, iPS cells or hematopoietic stem cells and then differentiating edited stem cells into NK cells. In some embodiments, in the case where the generation of modified NK cells involves differentiation of modified NK cells by iPS cells, genome editing can occur at any suitable time during the generation, maintenance or differentiation of iPS cells. For example, in the case of reprogramming donor cells into iPS cells, the donor cells (e.g., somatic cells, such as, for example, fibroblasts or T lymphocytes) can be subjected to the gene editing methods described herein before being reprogrammed into iPS cells, during the reprogramming procedure, or after the donor cells are reprogrammed into iPS cells.

[0095] NK cells derived from iPS cells are also referred to herein as iNK cells. In some embodiments, the disclosure provides compositions, methods and strategies for generating iNK cells derived from mature cells (also referred to as somatic cells, such as, for example, fibroblasts or peripheral blood cells).

[0096] In certain embodiments, the present disclosure provides compositions, methods and strategies for producing iNK cells derived from mature T cells (T cells that have undergone thymic selection). A sign of mature T cells is the T cell receptor locus of rearrangement. During T cell maturation, the TCR locus undergoes V (D) J rearrangement to produce complete V-domain exons. These rearrangements are retained in the whole process of T cell reprogramming to inducible pluripotent stem (iPS) cells and in the whole process of differentiating the obtained iPS cells into somatic cells.

[0097] One advantage of using T cells for generating iPS cells is that T cells can be edited relatively easily, for example, by CRISPR-based approaches or other gene editing methods.

[0098] Another advantage of using T cells to generate iPS cells is that the rearranged TCR loci allow genetic tracking of individual cells and their daughter cells. If the reprogramming, amplification, cultivation and / or differentiation strategy involves clonal expansion of individual cells in NK cell production, the rearranged TCR loci can be used as genetic markers to clearly identify cells and their daughter cells. This in turn allows characterization of cell populations as true clones, or allows identification of contaminating cells in mixed populations or clonal populations.

[0099] A third advantage of using T cells when generating iNK cells carrying multiple edits is the selection of certain karyotype aberrations associated with chromosomal translocations in T cell cultures. Such aberrations pose a problem when editing cells via CRISPR technology, especially when generating cells carrying multiple edits.

[0100] A fourth advantage of using T cell-derived iPS cells as a starting point for deriving therapeutic lymphocytes is that it allows the expression of pre-screened TCRs in lymphocytes, for example by selecting T cells by binding activity against a specific antigen (e.g., a tumor antigen), reprogramming the selected T cells into iPS cells, and then deriving lymphocytes (e.g., T cells) expressing the TCR from these iPS cells. This strategy also allows the activation of TCRs in other cell types, for example, by genetic or epigenetic strategies.

[0101] A fifth advantage of using T cell-derived iPS cells as the starting point for iNK differentiation is that T cells retain at least a portion of their "epigenetic memory" throughout the reprogramming process, so subsequent differentiation of the same or closely related cell types (such as iNK cells) will be more efficient and / or result in higher quality cell populations compared to methods that use unrelated cells (such as fibroblasts) as the starting point for iNK derivation. Definitions and Abbreviations

[0102] Unless otherwise specified, each of the following terms has the meaning set forth in this section.

[0103] The indefinite articles "a" and "an" refer to at least one of the associated noun and are used interchangeably with the terms "at least one" and "one or more."

[0104] The conjunctions "or" and "and / or" can be used interchangeably as non-exclusive disjuncts.

[0105] "Subject" means a human or non-human animal. A human subject may be of any age (e.g., an infant, child, young adult, or adult), and may suffer from a disease, and may actually have a genetic alteration or a combination of specific genes. Alternatively, a subject may be an animal, the term including but not limited to mammals, and more specifically non-human primates, rodents (e.g., mice, rats, hamsters, etc.), rabbits, guinea pigs, dogs, cats, etc. In certain embodiments of the present disclosure, the subject is a domestic animal, such as a cow, horse, sheep, or goat. In certain embodiments, the subject is poultry.

[0106] The term "treatment (treatment, treat and treating)" refers to a clinical intervention intended to reverse, alleviate, delay the onset of a disease or disorder or one or more symptoms as described herein or to inhibit progression and / or prevent or delay recurrence. Treatment in the form of, for example, modified NK cells or modified NK cell groups as described herein can be administered to a subject after developing one or more symptoms and / or diagnosing a disease. Treatment can be administered in the absence of symptoms, for example, to prevent or delay symptoms or to inhibit the onset or progression of a disease. For example, treatment can be administered to susceptible individuals before the onset of symptoms (for example, in view of genetic or other susceptibility factors). Treatment can also continue after symptoms subside, for example, to prevent or delay its recurrence.

[0107] "Prevent" or "preventing" refers to preventing a disease in a mammal (e.g., a human), including: (a) avoiding or precluding the disease; (b) influencing the tendency toward the disease; or (c) preventing or delaying the onset of at least one symptom of the disease.

[0108] The terms "polynucleotide", "nucleotide sequence", "nucleic acid", "nucleic acid molecule", "nucleic acid sequence" and "oligonucleotide" refer to a series of nucleotide bases (also called "nucleotides") in DNA and RNA, and mean any chain of two or more nucleotides. Polynucleotides, nucleotide sequences, nucleic acids, etc. can be chimeric mixtures or derivatives or modified forms thereof, single-stranded or double-stranded. They can be modified at the base portion, sugar portion or phosphate backbone, for example to improve the stability of the molecule, its hybridization parameters, etc. Nucleotide sequences typically carry genetic information, including but not limited to information used by organelles to make proteins and enzymes. These terms include double-stranded or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotides, and both sense and antisense polynucleotides. These terms also include nucleic acids containing modified bases.

[0109] Conventional IUPAC notation is used in the nucleotide sequences presented herein, as shown in Table 1 below (see also Cornish-Bowden A, Nucleic Acids Res. 1985 May 10; 13(9):3021-30, incorporated herein by reference). However, it should be noted that in those cases where the sequence may be encoded by DNA or RNA, such as in the gRNA targeting domain, "T" means "thymine or uracil". Table 1: IUPAC nucleic acid notation symbol Base A Adenine T Thymine or uracil G Guanine C Cytosine U Uracil K G or T / U M A or C R A or G Y C or T / U S C or G W A or T / U B C, G or T / U V A, C, or G H A, C or T / U D A, G or T / U N A, C, G or T / U

[0110] The terms "protein," "peptide," and "polypeptide" are used interchangeably to refer to a continuous chain of amino acids linked together by peptide bonds. These terms include individual proteins, groups or complexes of proteins associated together, and fragments or portions, variants, derivatives, and analogs of such proteins. Peptide sequences are presented herein using conventional notation, beginning with the amino or N-terminus on the left and proceeding to the carboxyl or C-terminus on the right. Standard single-letter or three-letter abbreviations may be used.

[0111] The term "variant" refers to an entity, such as a polypeptide, polynucleotide, or small molecule, that exhibits significant structural identity to a reference entity, but differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared to the reference entity. In many embodiments, a variant also differs functionally from its reference entity. Typically, whether a particular entity is properly considered a "variant" of a reference entity is based on its degree of structural identity to the reference entity.

[0112] As used herein, the term "endogenous" in the context of nucleic acids (e.g., genes, protein-coding genomic regions, promoters) refers to native nucleic acids or proteins in their natural location, such as within the genome of a cell. In contrast, the term "exogenous" as used herein in the context of nucleic acids such as expression constructs, cDNAs, indels, and nucleic acid vectors refers to nucleic acids that have been artificially introduced into the genome of a cell using, for example, gene editing or genetic engineering techniques (e.g., CRISPR-based editing techniques).

[0113] The terms "RNA-guided nuclease" and "RNA-guided nuclease molecule" are used interchangeably herein. In some embodiments, the RNA-guided nuclease is an RNA-guided DNA endonuclease. In some embodiments, the RNA-guided nuclease is a CRISPR nuclease. Non-limiting examples of RNA-guided nucleases are listed in Table 2 below, and the methods and compositions disclosed herein may use any combination of RNA-guided nucleases disclosed herein or known to those of ordinary skill in the art. One of ordinary skill in the art will be aware of additional nucleases and nuclease variants suitable for use in the context of the present disclosure, and it should be understood that the present disclosure is not limited in this regard. Table 2. RNA-guided nucleases

[0114] In view of the present disclosure, other suitable RNA-guided nucleases (e.g., Cas9 and Cas12 nucleases) will be apparent to those skilled in the art, and the present disclosure is not limited by the exemplary suitable nucleases provided herein. In some embodiments, suitable nucleases are Cas9 or Cpf1 (Cas12a) nucleases. In some embodiments, the present disclosure also includes nuclease variants, such as Cas9 or Cpf1 nuclease variants. Nuclease variants refer to nucleases comprising an amino acid sequence characterized by one or more amino acid substitutions, deletions or additions compared to the wild-type amino acid sequence of the nuclease. Suitable nucleases and nuclease variants may also include purification tags (e.g., polyhistidine tags) and signal peptides, for example, comprising or consisting of a nuclear localization signal sequence. Some non-limiting examples of suitable nucleases and nuclease variants are described in more detail elsewhere herein, and also include those described in PCT application PCT / US2019 / 22374, filed on March 14, 2019 and entitled "Systems and methods for treating hemoglobinopathies", the entire contents of which are incorporated herein by reference.

[0115] In some embodiments, the RNA-guided nuclease is an Acidaminococcus sp. Cpf1 variant (AsCpf1 variant). Based on the present disclosure, suitable Cpf1 nuclease variants (including suitable AsCpf1 variants) will be known or apparent to one of ordinary skill in the art, and include, but are not limited to, Cpf1 variants disclosed herein or others known in the art. For example, in some embodiments, the RNA-guided nuclease is an Acidaminococcus sp. Cpf1RR variant (AsCpf1-RR). In another embodiment, the RNA-guided nuclease is a Cpf1RVR variant. For example, suitable Cpf1 variants include those having an M537R substitution, an H800A substitution, and / or an F870L substitution, or any combination thereof (according to the numbering scheme of the AsCpf1 wild-type sequence).

[0116] As used herein, the term "hematopoietic stem cell" or "definitive hematopoietic stem cell" refers to a CD34+ stem cell that is capable of giving rise to mature myeloid and lymphoid cell types, including T cells, natural killer cells, and B cells.

[0117] As used herein, the term "reprogramming" or "dedifferentiation" or "increasing cell potential" or "increasing developmental potential" refers to a method for increasing cell potential or differentiating cells into a lower differentiation state. For example, compared with the same cells in a non-reprogrammed state, cells with increased cell potential have more developmental plasticity (i.e., can be differentiated into more cell types). In other words, reprogrammed cells are cells in a lower differentiation state than the same cells in a non-reprogrammed state. In certain embodiments, the term "reprogramming" refers to differentiating somatic cells or pluripotent stem cells into pluripotent stem cells, also referred to as induced pluripotent stem cells or iPS cells. Suitable methods for producing iPS cells by somatic cells or pluripotent stem cells are well known to those skilled in the art.

[0118] As used herein, the term "differentiation" is a process in which non-specialized ("non-specialized") or less specialized cells obtain the characteristics of specialized cells such as blood cells or muscle cells. Differentiated cells or differentiation-induced cells are cells that occupy more specialized ("specialized") positions in cell lineages. For example, after being treated with a suitable differentiation factor in a cell culture medium, iPS cells can be differentiated into various higher differentiated cell types, such as neural stem cells or hematopoietic stem cells, lymphocytes, cardiomyocytes and other cell types. Suitable methods, differentiation factors and cell culture medium for differentiating multipotential and multipotent cell types into higher differentiated cell types are well known to those skilled in the art. When applied to differentiation process, the term "specialized" refers to the cell that travels to the following point in the differentiation path, wherein under normal circumstances, it will continue to differentiate into a specific cell type or a subset of a cell type, and under normal circumstances, can not differentiate into different cell types or return to a less differentiated cell type.

[0119] As used herein, the term "differentiation marker", "differentiation marker gene" or "differentiation gene" refers to a gene or protein whose expression indicates cell differentiation occurring in a cell (such as a pluripotent cell). Differentiation marker genes include, but are not limited to, the following genes: CD34, CD4, CD8, CD3, CD56 (NCAM), CD49, CD45; NK cell receptor (differentiation cluster 16 (CD16)), natural killer group-2 member D (NKG2D), CD69, NKp30, NKp44, NKp46, CD158b, FOXA2, FGF5, SOX17, XIST, NODAL, COL3A1, OTX2, DUSP6, EOMES, NR2F2, NR0B1, CXCR4, CYP2B6, GAT A3, GATA4, ERBB4, GATA6, HOXC6, INHA, SMAD6, RORA, NIPBL, TNFSF11, CDH11, ZIC4, GAL, SOX3, PITX2, APOA2, C XCL5, CER1, FOXQ1, MLL5, DPP10, GSC, PCDH10, CTCFL, PCDH20, TSHZ1, MEGF10, MYC, DKK1, BMP2, LEFTY2, HES1, C DX2, GNAS, EGR1, COL3A1, TCF4, HEPH, KDR, TOX, FOXA1, LCK, PCDH7, CD1DFOXG1, LEFTY1, TUJ1, T gene (Brachyury), ZIC1, GATA1, GATA2, HDAC4, HDAC5, HDAC7, HDAC9, NOTCH1, NOTCH2, NOTCH4, PAX5, RBPJ, RUNX1, STAT1, and STAT3.

[0120] As used herein, the term "differentiation marker gene profile" or "differentiation gene profile", "differentiation gene expression profile", "differentiation gene expression signature", "differentiation gene expression panel", "differentiation gene panel" or "differentiation gene signature" refers to the expression or expression level of a plurality of differentiation marker genes.

[0121] As used herein, in the context of cell developmental potential, the term "potential" or "developmental potential" refers to the sum of all developmental options available to a cell (i.e., developmental potential). The continuum of cell potential includes but is not limited to totipotent cells, multipotent cells, pluripotent cells, oligopotent cells, unipotent cells, and terminally differentiated cells.

[0122] As used herein, the term "pluripotency" refers to the ability of cells to form all body or cell body (i.e., embryonic body) pedigrees. For example, embryonic stem cells are a type of pluripotent stem cells that can form cells in three germ layers, i.e., ectoderm, mesoderm, and endoderm. Pluripotency is a continuum of developmental potentials ranging from incomplete or partially pluripotent cells (e.g., epiblast stem cells or EpiSCs) that cannot produce a complete organism to more primitive, more potential cells (e.g., embryonic stem cells or inducible pluripotent stem cells) that can produce a complete organism.

[0123] As used herein, the term "induced pluripotent stem cells" or iPS cells refer to stem cells obtained from differentiated somatic cells (e.g., adult, neonatal or fetal cells) that are reprogrammed through a process called reprogramming into cells capable of differentiating into tissues having all three germ layers or cortexes - mesoderm, endoderm and ectoderm. iPS cells are not found in nature.

[0124] As used herein, the term "embryonic stem cell" refers to a pluripotent stem cell derived from the inner cell mass of an embryonic blastocyst. Embryonic stem cells are pluripotent and produce all derivatives of the three major germ layers, ectoderm, endoderm, and mesoderm, during development. They do not contribute to additional embryonic membranes or placenta, i.e., are not omnipotent.

[0125] As used herein, the term "pluripotent stem cell" refers to a cell with the developmental potential to differentiate into a cell with one or more germ layers (ectoderm, mesoderm and endoderm, but not all three). Therefore, pluripotent cells may also be referred to as "partially differentiated cells". Pluripotent cells are well known in the art, and examples of pluripotent cells include adult stem cells, such as hematopoietic stem cells and neural stem cells. "Multipotent" indicates that a cell can form many types of given lineage cells (but not other lineage cells). For example, pluripotent hematopoietic cells can form many different types of blood cells (red blood cells, white blood cells, platelets, etc.), but cannot form neurons. Therefore, the term "pluripotency" refers to a state in which the degree of developmental potential is lower than that of omnipotent and pluripotent cells.

[0126] Pluripotency can be determined in part by assessing the pluripotency characteristics of the cells. Pluripotency characteristics include, but are not limited to: (i) pluripotent stem cell morphology; (ii) the potential for unlimited self-renewal; (iii) expression of pluripotent stem cell markers, including but not limited to SSEA1 (mouse only), SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / Prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30 and / or CD50; (iv) the ability to differentiate into all three somatic cell lineages (ectoderm, mesoderm, and endoderm); (v) teratoma formation composed of the three somatic cell lineages; and (vi) the formation of embryoid bodies composed of cells from the three somatic cell lineages.

[0127] As used herein, the term "pluripotent stem cell morphology" refers to the classical morphological characteristics of embryonic stem cells. Normal embryonic stem cell morphology is characterized by a round and small shape (with a high nuclear to cytoplasmic ratio), a prominent presence of nucleoli, and typical intracellular spaces. Genome Editing System

[0128] The present disclosure relates to the generation of modified NK cells, for example, the genomes of these NK cells have been modified, or they are derived from pluripotent or multipotent stem cells (e.g., HSC, ES cells, or iPS cells) whose genomes have been modified. The NK cells and stem cells provided herein can be modified using any gene editing technology known to those of ordinary skill in the art, including, for example, by using a genome editing system, such as CRISPR.

[0129] The term "genome editing system" refers to any system with RNA-guided DNA editing activity. The genome editing system disclosed herein includes at least two components adapted from the naturally occurring CRISPR system: guide RNA (gRNA) and RNA-guided nuclease. These two components form a complex that can bind to a specific nucleic acid sequence and edit DNA in or around the nucleic acid sequence, for example by preparing one or more single-strand breaks (SSBs or nicks), double-strand breaks (DSBs) and / or point mutations.

[0130] Naturally occurring CRISPR systems are evolutionarily organized into two classes and five types (Makarova et al., Nat Rev Microbiol. 2011 Jun; 9(6):467-477 (Makarova), incorporated herein by reference), and while the genome editing systems of the present disclosure can be adapted from components of any type or class of naturally occurring CRISPR systems, the embodiments presented herein are generally adapted from Class 2 and Type II or Type V CRISPR systems. Class 2 systems encompass Type II and Type V, which are characterized by relatively large multidomain RNA-guided nuclease proteins (e.g., Cas9 or Cpf1) and one or more guide RNAs (e.g., crRNA and optionally tracrRNA) that form ribonucleoprotein (RNP) complexes that associate (i.e., target) and cleave specific loci that are complementary to the targeting (or spacer) sequence of the crRNA. Genome editing systems according to the present disclosure similarly target and edit cellular DNA sequences, but differ significantly from CRISPR systems found in nature. For example, the single-molecule guide RNAs described herein do not occur in nature, and both the guide RNAs and RNA-guided nucleases according to the present disclosure can incorporate any number of non-naturally occurring modifications.

[0131] Genome editing systems can be implemented in a variety of ways (e.g., administered or delivered to cells or subjects), and different implementations may be suitable for different applications. For example, in certain embodiments, the genome editing system is implemented as a protein / RNA complex (ribonucleoprotein, or RNP), which may be included in a pharmaceutical composition, which optionally includes a pharmaceutically acceptable carrier and / or encapsulating agent, such as lipid or polymer microparticles or nanoparticles, micelles, liposomes, etc. In certain embodiments, the genome editing system is implemented as one or more nucleic acids encoding the above-mentioned RNA-guided nuclease and guide RNA components (optionally with one or more other components); in certain embodiments, the genome editing system is implemented as one or more vectors comprising such nucleic acids, such as viral vectors, such as adeno-associated viruses; and in certain embodiments, the genome editing system is implemented as a combination of any of the foregoing. Other or modified implementations operating according to the principles described herein will be apparent to the skilled person and are within the scope of the present disclosure.

[0132] It should be noted that the genome editing system disclosed herein can target a single specific nucleotide sequence, or can target (and edit in parallel) two or more specific nucleotide sequences by using two or more guide RNAs. Throughout this disclosure, the use of multiple gRNAs is referred to as "multiplexing", and can be used to target multiple unrelated target sequences of interest, or to form multiple SSBs or DSBs within a single target domain, and in some cases, to produce specific edits within such a target domain. For example, International Patent Publication No. WO 2015 / 138510 (Maeder) of Maeder et al. (which is incorporated herein by reference) describes a genome editing system for correcting a point mutation (C.2991+1655A to G) in the human CEP290 gene, which results in the generation of a cryptic splice site, which in turn reduces or eliminates the function of the gene. Maeder's genome editing system utilizes two guide RNAs that target sequences on either side of the point mutation (i.e., flanking) and form DSBs flanking the mutation. This in turn facilitates the deletion of intervening sequences, including the mutation, thereby eliminating the cryptic splice site and restoring normal gene function.

[0133] As another example, WO 2016 / 073990 ("Cotta-Ramusino") by Cotta-Ramusino et al. (incorporated herein by reference) describes a genome editing system utilizing two gRNAs and a Cas9 nickase (Cas9 that makes single-stranded nicks, such as S. pyogenes D10A), an arrangement referred to as a "double nickase system". The double nickase system of Cotta-Ramusino is configured to make two nicks that are offset by one or more nucleotides on the opposite strands of the target sequence, and the nick combination produces a double-strand break with an overhang (5' overhang in the case of Cotta-Ramusino, but 3' overhang is also possible). In some cases, the overhang can in turn promote homology-directed repair events. And as another example, WO 2015 / 070083 to Palestrant et al. ("Palestrant," incorporated herein by reference) describes a gRNA targeting a nucleotide sequence encoding Cas9 (referred to as a "supervisory RNA") that can be included in a genome editing system that contains one or more other gRNAs to allow transient expression of Cas9 that might otherwise be constitutively expressed, for example, in some virally transduced cells. These multiplexing applications are intended to be exemplary rather than limiting, and the skilled artisan will appreciate that other multiplexing applications are generally compatible with the genome editing systems described herein.

[0134] In some cases, the genome editing system can form double-strand breaks, which are repaired by cellular DNA double-strand break mechanisms such as NHEJ or HDR. These mechanisms are described in many documents, such as Davis and Maizels, PNAS, 111 (10): E924-932, March 11, 2014 (Davis) (describing Alt-HDR); Frit et al., DNA Repair [DNA repair] 17 (2014) 81-97 (Frit) (describing Alt-NHEJ); and Iyama and Wilson III, DNA Repair [DNA repair] (Amst.) August 2013; 12 (8): 620-636 (Iyama) (general description of classical HDR and NHEJ pathways).

[0135] If a genome editing system operates by forming a DSB, such a system optionally includes one or more components that promote or contribute to a particular double-strand break repair pattern or a particular repair outcome. For example, Cotta-Ramusino also describes a genome editing system in which a single-stranded oligonucleotide "donor template" is added; the donor template is incorporated into a target region of cellular DNA, which is cut by the genome editing system and can result in changes in the target sequence.

[0136] In certain embodiments, the genome editing system modifies the target sequence without causing single-strand or double-strand breaks, or modifies the expression of genes in or near the target sequence. For example, the genome editing system may include a nuclease guided by RNA fused to a functional domain acting on DNA, thereby modifying the target sequence or its expression. As an example, the RNA-guided nuclease may be connected to (e.g., fused to) a cytidine deaminase functional domain, and may be operated by producing a targeted C to A substitution. Exemplary nuclease / deaminase functions are described in Komor et al. Nature [Nature] 533, 420-424 (May 19, 2016) ("Komor"), which is incorporated by reference. Alternatively, the genome editing system may utilize cleavage-inactivated (i.e., "dead") nucleases, such as dead Cas9 (dCas9), and may be operated by forming a stable complex on one or more targeted regions of cellular DNA, thereby interfering with functions involving one or more targeted regions, including but not limited to mRNA transcription, chromatin remodeling, etc. Guide RNA (gRNA) molecules

[0137] The terms "guide RNA" and "gRNA" refer to any nucleic acid that promotes specific binding (or "targeting") of an RNA-guided nuclease, such as Cas9 or Cpf1, to a target sequence, such as a genomic sequence or a free sequence in a cell. The gRNA can be unimolecular (comprising a single RNA molecule, alternatively referred to as a chimeric molecule), or modular (comprising more than one, and typically two, separate RNA molecules, such as crRNA and tracrRNA, which are typically associated with each other, such as by duplexing). gRNAs and their components are described throughout the literature, for example in Briner et al. (Molecular Cell 56(2), 333-339, October 23, 2014 ("Briner"), incorporated herein by reference) and in Cotta-Ramusino.

[0138] In bacteria and archaea, type II CRISPR systems typically include RNA-guided nuclease proteins (e.g., Cas9), CRISPR RNA (crRNA) including a 5' region complementary to an external sequence, and a trans-activating crRNA (tracrRNA) including a 5' region complementary to the 3' region of crRNA and forming a duplex. Although not intended to be limited to any theory, it is believed that this duplex contributes to the formation of the Cas9 / gRNA complex and is required for the activity of the complex. When the type II CRISPR system is adapted for gene editing, it is found that crRNA and tracrRNA can be joined into a single single molecule or chimeric guide RNA, in a non-limiting example by means of a tetranucleotide (e.g., GAAA) "tetraloop" or "joint" sequence bridging the complementary regions of crRNA (at its 3' end) and tracrRNA (at its 5' end). (Mali et al. Science. 2013 Feb 15;339(6121):823-826 (“Mali”); Jiang et al. Nat Biotechnol. 2013 Mar;31(3):233-239 (“Jiang”); and Jinek et al., 2012 Science. Aug 17;337(6096):816-821 (“Jinek”), all of which are incorporated herein by reference).

[0139] Whether it is a single molecule or a module, the guide RNA includes a "targeting domain" that is completely or partially complementary to a target domain in a target sequence, such as a DNA sequence in a cell genome that is desired to be edited. The targeting domain is referred to in the literature by a variety of names, including but not limited to "guide sequence" (Hsu et al., Nat Biotechnol. [Natural Biotechnology] September 2013; 31 (9): 827-832 ("Hsu"), incorporated herein by reference), "complementarity region" (Cotta-Ramusino), "spacer" (Briner), and collectively referred to as "crRNA" (Jiang). Regardless of the name given to it, the targeting domain is typically 10-30 nucleotides in length, and in certain embodiments is 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and is located at or near the 5' terminus in the case of a Cas9 gRNA, and at or near the 3' terminus in the case of a Cpf1 gRNA.

[0140] In addition to the targeting domain, gRNA typically (but not necessarily, for example, as discussed below) includes multiple domains that can affect the formation or activity of gRNA / Cas9 complexes. For example, as mentioned above, the duplexed structure (also referred to as repeat: anti-repeat duplex) formed by the first and second complementary domains of gRNA interacts with the recognition (REC) leaf of Cas9, and can mediate the formation of Cas9 / gRNA complexes. (Nishimasu et al., Cell [cell] 156, 935-949, February 27, 2014 ("Nishimasu 2014") and Nishimasu et al., Cell [cell] 162, 1113-1126, August 27, 2015 ("Nishimasu 2015"), both incorporated herein by reference). It should be noted that the first and / or second complementary domains may contain one or more polyadenylic acid segments, which can be recognized as termination signals by RNA polymerase. Therefore, the sequence of the first and second complementarity domains is optionally modified to eliminate these segments and facilitate the completion of in vitro transcription of gRNA, for example, by using AG exchange as described in Briner, or by using AU exchange. These and other similar modifications to the first and second complementarity domains are within the scope of the present disclosure.

[0141] Together with the first and second complementarity domains, the Cas9gRNA typically includes two or more other duplexed regions that participate in nuclease activity in vivo but not necessarily in vitro. (Nishimasu 2015). The first stem-loop 1 near the 3' portion of the second complementarity domain is variously referred to as the "proximal domain" (Cotta-Ramusino), "stem-loop 1" (Nishimasu 2014 and 2015), and "nexus" (Briner). One or more other stem-loop structures are typically present near the 3' end of the gRNA, and their number varies by species: S. pyogenes gRNA typically includes 2 3' stem-loops (a total of 4 stem-loop structures, including repeat: anti-repeat duplexes), while S. aureus and other species have only one (a total of 3 stem-loop structures). A description of the conserved stem-loop structures (more generally, and gRNA structures) organized according to species is provided in Briner.

[0142] Although the foregoing description focuses on the gRNA for Cas9, it should be understood that other RNA-guided nucleases have been (or may be) discovered or invented in the future, which utilize gRNAs that are different from those gRNAs described for this point in some aspects. For example, Cpf1 ("CRISPR from Prevotella and Francisella 1") is a recently discovered RNA-guided nuclease that does not require tracrRNA for its function. (Zetsche et al., 2015, Cell [Cell] 163, 759-771 October 22, 2015 ("Zetsche I"), incorporated herein by reference). The gRNA for the Cpf1 genome editing system generally includes a targeting domain and a complementary domain (alternatively referred to as a "handle"). It should also be noted that in the gRNA for Cpf1, the targeting domain is generally present at or near the 3' end, rather than the 5' end as described above in conjunction with Cas9gRNA (the handle is located at or near the 5' end of the Cpf1gRNA).

[0143] Those skilled in the art will appreciate that, although there may be structural differences between gRNAs from different prokaryotic species or between Cpf1 and Cas9 gRNAs, the operating principles of gRNAs are generally consistent. Because of this operational consistency, gRNAs can be broadly defined by their targeting domain sequences, and those skilled in the art will appreciate that a given targeting domain sequence can be incorporated into any suitable gRNA, including single-molecule or chimeric gRNAs, or gRNAs that include one or more chemical modifications and / or sequence modifications (substitutions, additional nucleotides, truncations, etc.). Therefore, for ease of presenting the present disclosure, gRNAs may be described only in terms of their targeting domain sequences.

[0144] More generally, the skilled artisan will appreciate that some aspects of the present disclosure relate to systems, methods, and compositions that can be implemented using a variety of RNA-guided nucleases. For this reason, unless otherwise specified, the term gRNA should be understood to encompass not only those gRNAs that are compatible with a particular species of Cas9 or Cpf1, but also any suitable gRNA that can be used for any RNA-guided nuclease. By way of illustration, in certain embodiments, the term gRNA can include gRNAs used with any RNA-guided nuclease present in a Class 2 CRISPR system (e.g., a Type II or Type V or CRISPR system) or an RNA-guided nuclease derived or adapted therefrom.

[0145] In some embodiments, the guide RNA used comprises a modification compared to a standard gRNA scaffold. Such modifications may include, for example, chemical modifications of a portion of the gRNA (e.g., a core base or a backbone portion). In some embodiments, such modifications may also include the presence of DNA nucleotides within the gRNA, such as inside or outside the targeting domain. In some embodiments, the modification may include an extension of the gRNA scaffold, for example, by adding 1-100 nucleotides to the 3' or 5' end of the guide RNA, including RNA and / or DNA nucleotides, such as at the far end of the targeting domain.

[0146] Typically, gRNA includes glycosyl ribose, which is a 5-membered ring with oxygen. Exemplary modified gRNA may include but is not limited to the replacement of oxygen in ribose (e.g., through sulfur (S), selenium (Se) or alkylene, such as methylene or ethylene); the addition of double bonds (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); the contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); the ring expansion of ribose (e.g., to form a 6-membered ring or 7-membered ring with additional carbon or heteroatoms, such as dehydrohexitol, altritol, mannitol, cyclohexane, cyclohexenyl and morpholino, which also have a phosphoramidate skeleton). Although most of the sugar analogs change in the 2' position, other sites are also suitable for modification, including the 4' position. In certain embodiments, gRNA includes 4'-S, 4'-Se or 4'-C-aminomethyl-2'-O-Me modifications.

[0147] In certain embodiments, deaza nucleotides (e.g., 7-deaza-adenosine) can be incorporated into the gRNA. In certain embodiments, O-alkylated and N-alkylated nucleotides (e.g., N6-methyladenosine) can be incorporated into the gRNA. In certain embodiments, one or more or all nucleotides in the gRNA molecule are deoxynucleotides.

[0148] In certain embodiments, the gRNA used herein may be a modified or unmodified gRNA. In certain embodiments, the gRNA may include one or more modifications. In certain embodiments, one or more modifications may include phosphorothioate bond modification, phosphorodithioate (PS2) bond modification, 2'-O-methyl modification, or a combination thereof. In certain embodiments, one or more modifications may be at the 5' end of the gRNA, at the 3' end of the gRNA, or a combination thereof.

[0149] In certain embodiments, gRNA modifications may comprise one or more phosphorodithioate (PS2) bond modifications.

[0150] In some embodiments, the gRNA used herein includes one or more or a stretch of deoxyribonucleic acid (DNA) bases, also referred to herein as a "DNA extension". In some embodiments, the gRNA used herein includes a DNA extension at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the DNA extension can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, In some embodiments, the DNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA bases long. In some embodiments, the DNA extension may include one or more DNA bases selected from adenine (A), guanine (G), cytosine (C), or thymine (T). In some embodiments, the DNA extension includes the same DNA bases. For example, a DNA extension may include a section of adenine (A) bases. In certain embodiments, a DNA extension may include a section of thymine (T) bases. In certain embodiments, a DNA extension includes a combination of different DNA bases. In certain embodiments, a DNA extension may include a sequence shown in Table 3. In certain embodiments, the gRNA used herein includes a DNA extension and one or more phosphorothioate bond modifications, one or more phosphorodithioate (PS2) bond modifications, one or more 2'-O-methyl modifications, or a combination thereof. In certain embodiments, one or more modifications may be at the 5' end of the gRNA, at the 3' end of the gRNA, or a combination thereof. In certain embodiments, a gRNA including a DNA extension may include a sequence including a DNA extension shown in Table 3. Without wishing to be bound by theory, it is contemplated that any DNA extension may be used herein as long as it does not hybridize with the target nucleic acid targeted by the gRNA and also exhibits increased editing at the target nucleic acid site relative to a gRNA that does not include such a DNA extension.

[0151] In some embodiments, the gRNA used herein includes one or more or a stretch of ribonucleic acid (RNA) bases, also referred to herein as an "RNA extension". In some embodiments, the gRNA used herein includes an RNA extension at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the RNA extension can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 98, 99, or 100 RNA bases in length. For example, in certain embodiments, the RNA extension can be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA bases in length. In certain embodiments, the RNA extension may include one or more RNA bases selected from adenine (rA), guanine (rG), cytosine (rC) or uracil (rU), wherein "r" represents RNA, 2'-hydroxyl. In certain embodiments, the RNA extension includes the same RNA bases. For example, the RNA extension may include a segment of adenine (rA) bases. In certain embodiments, the RNA extension includes a combination of different RNA bases. In certain embodiments, the RNA extension may include the sequence shown in Table 3. In certain embodiments, the gRNA used herein includes RNA extension and one or more phosphorothioate bond modifications, one or more phosphorodithioate (PS2) bond modifications, one or more 2'-O-methyl modifications, or a combination thereof. In certain embodiments, one or more modifications may be at the 5' end of the gRNA, at the 3' end of the gRNA, or a combination thereof. In certain embodiments, the gRNA comprising RNA extension may include the sequence described in Table 3 comprising RNA extension. The gRNA comprising RNA extension at the 5' end of the gRNA may include a sequence disclosed herein. The gRNA comprising RNA extension at the 3' end of the gRNA may include a sequence disclosed herein.

[0152] It is contemplated that the gRNA used herein may also include RNA extension and DNA extension. In certain embodiments, both RNA extension and DNA extension may be at the 5' end of the gRNA, the 3' end of the gRNA, or a combination thereof. In certain embodiments, the RNA is extended at the 5' end of the gRNA, and the DNA is extended at the 3' end of the gRNA. In certain embodiments, the RNA is extended at the 3' end of the gRNA, and the DNA is extended at the 5' end of the gRNA.

[0153] In some embodiments, a gRNA comprising a modification (eg, a DNA extension at the 5' end) is complexed with an RNA-guided nuclease (eg, AsCpf1 nuclease) to form an RNP, which is then used to edit a target cell, such as a NK cell.

[0154] Exemplary suitable 5' extensions for Cpf1 guide RNA are provided in the following table:

[0155] Table 3: gRNA 5' extension

[0156] Additional suitable gRNA modifications will be apparent to one of ordinary skill in the art based on this disclosure. Suitable gRNA modifications include, for example, those described in PCT application PCT / US2018 / 054027, filed on October 2, 2018, and entitled “MODIFIED CPF1 GUIDE RNA”; PCT application PCT / US2015 / 000143, filed on December 3, 2015, and entitled “GUIDE RNA WITH CHEMICAL MODIFICATIONS”; PCT application PCT / US2016 / 026028, filed on April 5, 2016, and entitled “CHEMICALLY MODIFIED GUIDE RNA FOR CRISPR / CAS-MEDIATED GENEREGULATION”; and PCT application PCT / US2016 / 036029, filed on September 23, 2016, and entitled “NUCLEASE-MEDIATED GENOME EDITING PCT Application No. PCT / US2016 / 053344, entitled "Nuclease-Mediated Genome Editing of Primary Cells and Enrichment thereof"; the entire contents of each of which are incorporated herein by reference. gRNA design

[0157] Methods for target sequence selection and validation and off-target analysis have been described previously (e.g., Mali; Hsu; Fu et al., 2014 Nat biotechnol 32(3):279-84, Heigwer et al., 2014 Nat methods 11(2):122-3; Bae et al. (2014) Bioinformatics 30(10):1473-5; and Xiao A et al. (2014) Bioinformatics 30(8):1180-1182. Each of these references is incorporated herein by reference. As a non-limiting example, gRNA design can include the use of software tools to optimize the selection of potential target sequences corresponding to the user's target sequence, for example to minimize overall off-target activity across the genome. While off-target activity is not limited to cleavage, the efficiency of cleavage at each off-target sequence can be predicted, for example, using an experimentally derived weighting scheme. These and other guide selection methods are described in detail in Maeder and Cotta-Ramusino.

[0158] In certain embodiments, one or more or all nucleotides in the gRNA molecule are modified. Strategies for modifying gRNA are described in WO 2019 / 152519, published on August 8, 2019, the entire contents of which are expressly incorporated herein by reference.

[0159] Provided herein (for example, in the following table) are non-limiting examples of guide RNAs suitable for certain embodiments included in the present disclosure. One of ordinary skill in the art will be able to envision suitable guide RNA sequences for specific nucleases (such as Cas9 or Cpf-1 nucleases) with the disclosure of the targeting domain sequence as a DNA or RNA sequence. For example, a guide RNA comprising a targeting sequence consisting of RNA nucleotides will include an RNA sequence corresponding to a targeting domain sequence provided as a DNA sequence, and this contains uracil, instead of a thymidine nucleotide. For example, a guide RNA comprising a targeting domain sequence consisting of RNA nucleotides and described by a DNA sequence TCTGCAGAAATGTTCCCCGT (SEQ ID NO:__) will have a targeting domain of a corresponding RNA sequence UCUGCAGAAAUGUUCCCCGU (SEQ ID NO:__). As is apparent to those skilled in the art, this targeting sequence will be connected to a suitable guide RNA scaffold (for example, a crRNA scaffold sequence or a chimeric crRNA / tracerRNA scaffold sequence). Suitable gRNA scaffold sequences are known to those of ordinary skill in the art. For AsCpf1, for example, a suitable scaffold sequence comprises the sequence UAAUUUCUACUCUUGUAGAU (SEQ ID NO:__), added to the 5' end of the targeting domain. In the example above, this would result in a Cpf1 guide RNA having the sequence UAAUUUCUACUCUUGUAGAUUCUGCAGAAAUGUUCCCCGU (SEQ ID NO:__). One skilled in the art will further appreciate how to modify such a guide RNA, for example, by adding a DNA extension (e.g., in the example above, adding a 25-mer DNA extension as described herein would result in, for example, a guide RNA having the sequence ATGTGTTTTTGTCAAAAGACCTTTTrUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArUrUrCrUrGrCrArGrArArUrGrUrUrCrCrCrCrGrU (SEQ ID NO:__). It should be understood that the exemplary targeting sequences provided herein are not limiting, and that additional suitable sequences (e.g., variants of the specific sequences disclosed herein) will be apparent to one skilled in the art based on this disclosure, given the general knowledge in the art.

[0160] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting TIGIT (TIGIT gRNA). In some embodiments, the gRNA targeting TIGIT is one or more of the gRNAs described in Table 4. Table 4: TIGIT gRNA

[0161] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting ADORA2a (ADORA2a gRNA). In some embodiments, the gRNA targeting ADORA2a is one or more of the gRNAs described in Table 5. Table 5. ADORA2a gRNA

[0162] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting TGFβR2 (TGFβR2gRNA). In some embodiments, the gRNA targeting TGFβR2 is one or more of the gRNAs described in Table 6. Table 6. TGFbetaR2 gRNA

[0163] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting CISH (CISH gRNA). In some embodiments, the gRNA targeting CISH is one or more of the gRNAs described in Table 7. Table 7. CISH gRNA

[0164] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting B2M (B2M gRNA). In some embodiments, the gRNA targeting B2M is one or more of the gRNAs described in Table 8. Table 8: B2M gRNA

[0165] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting NKG2A (NKG2A gRNA). In some embodiments, the gRNA targeting NKG2A is one or more of the gRNAs described in Table 9. Table 9: NKG2A gRNA

[0166] In some embodiments, the gRNA used in the present disclosure is a gRNA targeting PD1. In some embodiments, the gRNA used in the present disclosure is a gRNA targeting PD1. The gRNAs decorated with B2M and PD1 used in the present disclosure are further described in WO 2015161276 and WO 2017152015 by Welstead et al. ("Welstead"); both are incorporated herein by reference in their entirety. RNA-guided nuclease

[0167] RNA-guided nucleases according to the present disclosure include, but are not limited to, naturally occurring CRISPR nucleases of class 2, such as Cas9 and Cpf1, and other nucleases derived or obtained therefrom. In terms of function, RNA-guided nucleases are defined as those nucleases that: (a) interact (e.g., complex) with gRNA; and (b) associate with gRNA or optionally cleave or modify a target region of DNA, the target region comprising (i) a sequence complementary to the targeting domain of the gRNA, and optionally, (ii) another sequence called a "protospacer adjacent motif" or "PAM", which is described in more detail below. In illustrating the following examples, RNA-guided nucleases can be defined in a broad sense based on their PAM specificity and cleavage activity, even though there may be variation between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. The skilled person will appreciate that some aspects of the present disclosure relate to systems, methods, and compositions that can be implemented using any suitable RNA-guided nuclease with a certain PAM specificity and / or cleavage activity. For this purpose, unless otherwise indicated, the term RNA-guided nuclease should be understood as a general term and is not limited to any particular type (e.g., Cas9 vs. Cpf1), species (e.g., S. pyogenes vs. S. aureus), or variant (e.g., full-length vs. truncated or split; naturally occurring PAM specificity vs. engineered PAM specificity, etc.) of RNA-guided nuclease.

[0168] The name of the PAM sequence is derived from its sequential relationship to a "protospacer" sequence, which is complementary to the gRNA targeting domain (or "spacer sequence"). Together with the protospacer, the PAM sequence defines the target region or sequence of a specific RNA-guided nuclease / gRNA combination.

[0169] Various RNA-guided nucleases may require different sequential relationships between the PAM and the protospacer. For example, the Cas9 nuclease recognizes a PAM sequence 3' to the protospacer, whereas

[0170] On the other hand, Cpf1 usually recognizes the PAM sequence 5' of the protospacer.

[0171] In addition to recognizing the specific order orientation of PAM and protospacers, RNA-guided nucleases can also recognize specific PAM sequences. For example, Staphylococcus aureus Cas9 recognizes the PAM sequence of NNGRRT or NNGRRV, where N residues are close to the 3' of the region recognized by the gRNA targeting domain. Streptococcus pyogenes Cas9 recognizes the NGG PAM sequence. And the new killer Francisella (F.novicida) Cpf1 recognizes the TTN PAM sequence. The PAM sequences of multiple RNA-guided nucleases have been identified, and the strategy for identifying novel PAM sequences has been described in Shmakov et al., 2015, Molecular Cell [Molecular Cell] 60, 385-397, November 5, 2015. It should also be noted that an engineered RNA-guided nuclease can have a PAM specificity that is different from the PAM specificity of a reference molecule (e.g., in the case of an engineered RNA-guided nuclease, the reference molecule can be a naturally occurring variant from which the RNA-guided nuclease is derived, or a naturally occurring variant that has maximal amino acid sequence homology to the engineered RNA-guided nuclease).

[0172] In addition to their PAM specificity, RNA-guided nucleases can be characterized by their DNA cleavage activity: naturally occurring RNA-guided nucleases typically form DSBs in the target nucleic acid, but engineered variants have been generated that only generate SSBs (discussed above) (Ran and Hsu et al., Cell 154(6), 1380-1389, Sept. 12, 2013 ("Ran"), incorporated herein by reference), or that do not cleave at all. Cas9

[0173] The crystal structures of Streptococcus pyogenes Cas9 have been determined (Jinek 2014) as well as the crystal structures of Staphylococcus aureus Cas9 in complex with a single-molecule guide RNA and target DNA (Nishimasu 2014; Anders 2014; and Nishimasu 2015).

[0174] The naturally occurring Cas9 protein comprises two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe; each lobe comprises a specific structural and / or functional domain. The REC lobe comprises an arginine-rich bridge helix (BH) domain, and at least one REC domain (e.g., a REC1 domain and optionally a REC2 domain). The REC lobe does not share structural similarities with other known proteins, indicating that it is a unique functional domain. Without wishing to be bound by any theory, mutational analysis suggests a special functional role for the BH and REC domains: the BH domain appears to play a role in gRNA: DNA recognition, while the REC domain is thought to interact with the repeat: anti-repeat duplex of the gRNA and mediate the formation of the Cas9 / gRNA complex.

[0175] The NUC lobe comprises a RuvC domain, an HNH domain and a PAM interaction (PI) domain. The RuvC domain shares structural similarity with members of the retroviral integrase superfamily and cuts the non-complementary (i.e. bottom) strand of the target nucleic acid. It can be formed from two or more split RuvC motifs (e.g., RuvC I, RuvCII and RuvCIII in Streptococcus pyogenes and Staphylococcus aureus). At the same time, the HNH domain is structurally similar to the HNN endonuclease motif and cuts the complementary (i.e. top) strand of the target nucleic acid. As the name implies, the PI domain contributes to PAM specificity.

[0176] While some functions of Cas9 are associated with (but not necessarily entirely dependent on) specific domains described above, these and other functions may be mediated or influenced by other Cas9 domains or multiple domains on either lobe. For example, in S. pyogenes Cas9, as described in Nishimasu 2014, the gRNA repeat:anti-repeat duplex falls into the groove between the REC lobe and the NUC lobe, and the nucleotides in the duplex interact with amino acids in the BH, PI, and REC domains. Some nucleotides in the first stem-loop structure also interact with amino acids in multiple domains (PI, BH, and REC1), as do some nucleotides in the second and third stem-loops (RuvC and PI domains). Cpf1

[0177] The crystal structure of Acidaminococcus sp. Cpf1 in complex with crRNA and a double-stranded (ds) DNA target including a TTTN PAM sequence has been solved by Yamano et al. (Cell [Cell]. 2016 May 5; 165(4):949-962 (Yamano), incorporated herein by reference). Cpf1, like Cas9, has two lobes: a REC (recognition) lobe and a NUC (nuclease) lobe. The REC lobe includes REC1 and REC2 domains, which lack similarity to any known protein structure. At the same time, the NUC lobe includes three RuvC domains (RuvC-I, -II and -III) and a BH domain. However, in contrast to Cas9, the Cpf1REC lobe lacks an HNH domain and includes other domains that also lack similarity to known protein structures: a structurally unique PI domain, three wedge-shaped (WED) domains (WED-I, -II, and -III), and a nuclease (Nuc) domain.

[0178] Although Cas9 and Cpf1 share structural and functional similarities, it is understood that certain Cpf1 activities are mediated by domains that are distinct from any Cas9 domain. For example, cleavage of the complementary strand of the target DNA appears to be mediated by the Nuc domain, which is sequentially and spatially distinct from the HNH domain of Cas9. In addition, the non-targeting portion (handle) of the Cpf1 gRNA adopts a pseudoknot structure rather than the stem-loop structure formed by the repeat: anti-repeat duplex in the Cas9 gRNA. Modification by RNA-guided nucleases

[0179] The RNA-guided nucleases described above have activities and properties that are useful for a variety of applications, but the skilled artisan will appreciate that RNA-guided nucleases may also be modified in certain circumstances to alter cleavage activity, PAM specificity, or other structural or functional characteristics.

[0180] Referring first to modifications that alter cleavage activity, mutations that reduce or eliminate NUC intralobular domain activity have been described above. Exemplary mutations that can be made in the RuvC domain, in the Cas9HNH domain, or in the Cpf1Nuc domain are described in Ran and Yamano, and in Cotta-Ramusino. Typically, mutations that reduce or eliminate activity in one of the two nuclease domains result in RNA-guided nucleases with nickase activity, but it should be noted that the type of nickase activity varies depending on which domain is inactivated. As an example, inactivation of the RuvC domain or the Cas9HNH domain results in a nickase.

[0181] For Streptococcus pyogenes (Kleinstiver et al., Nature. 2015 Jul 23; 523(7561): 481-5 (Kleinstiver I)) and Staphylococcus aureus (Kleinstiver et al., Nat Biotechnol. 2015 Dec; 33(12): 1293-1298 (Klienstiver II)), modifications of PAM specificity relative to naturally occurring Cas9 reference molecules have been described by Kleinstiver et al. Kleinstiver et al. have also described modifications that improve the targeting fidelity of Cas9 (Nature, 2016 Jan 28; 529, 490-495 (Kleinstiver III)). Each of these references is incorporated herein by reference.

[0182] RNA-guided nucleases have been split into two or more parts as described by Zetsche et al. (Nat Biotechnol. 2015 Feb;33(2):139-42 (Zetsche II), incorporated by reference) and Fine et al. (Sci Rep. 2015 Jul 1;5:10777 (Fine), incorporated by reference).

[0183] In certain embodiments, the RNA-guided nuclease can be size-optimized or truncated, for example, by one or more deletions that reduce the size of the nuclease while still retaining gRNA association, target and PAM recognition, and cleavage activity. In certain embodiments, the RNA-guided nuclease is covalently or non-covalently bound to another polypeptide, nucleotide, or other structure, optionally via a linker. Exemplary bound nucleases and linkers are described in Guilinger et al., Nature Biotechnology 32, 577-582 (2014), which is incorporated herein by reference for all purposes.

[0184] The RNA-guided nuclease may also optionally include a tag, such as, but not limited to, a nuclear localization signal, to facilitate the RNA-guided nuclease protein to move into the nucleus. In certain embodiments, the RNA-guided nuclease may incorporate a C-terminal and / or N-terminal nuclear localization signal. Nuclear localization sequences are known in the art and are described in Maeder and other literature.

[0185] The foregoing list of modifications is intended to be exemplary, and the skilled artisan will appreciate from this disclosure that other modifications may be possible or desirable in certain applications. Thus, for the sake of brevity, the exemplary systems, methods, and compositions of the present disclosure are presented with reference to specific RNA-guided nucleases, but it is understood that the RNA-guided nucleases used may be modified in a manner that does not change their operating principles. Such modifications are within the scope of the present disclosure.

[0186] Exemplary suitable nuclease variants include, but are not limited to, AsCpf1 variants comprising an M537R substitution, an H800A substitution, and / or an F870L substitution, or any combination thereof (according to the numbering scheme of the AsCpf1 wild-type sequence). Other suitable modifications of the AsCpf1 amino acid sequence are known to those of ordinary skill in the art. Some exemplary sequences of wild-type AsCpf1 and AsCpf1 variants are provided below.

[0187] His-AsCpf1-sNLS-sNLS H800A amino acid sequence (SEQ ID NO: [XX])

[0188]

[0189] Cpf1 variant 1 amino acid sequence (SEQ ID NO: [XX])

[0190]

[0191] Cpf1 variant 2 amino acid sequence (SEQ ID NO: [XX])

[0192]

[0193] Cpf1 variant 3 amino acid sequence (SEQ ID NO: 1096)

[0194]

[0195] Cpf1 variant 4 amino acid sequence (SEQ ID NO: 1097)

[0196]

[0197] Cpf1 variant 5 amino acid sequence (SEQ ID NO: 1107)

[0198]

[0199] Cpf1 variant 6 amino acid sequence (SEQ ID NO: 1108)

[0200]

[0201] Cpf1 variant 7 amino acid sequence (SEQ ID NO: [[XX]])

[0202]

[0203] Exemplary AsCpf1 wild-type amino acid sequence (SEQ ID NO: [[XX]]):

[0204] Nucleic acid encoding an RNA-guided nuclease

[0205] Provided herein are nucleic acids encoding RNA-guided nucleases (e.g., Cas9, Cpf1, or functional fragments thereof). Exemplary nucleic acids encoding RNA-guided nucleases have been previously described (see, e.g., Cong 2013; Wang 2013; Mali 2013; Jinek 2012).

[0206] In some cases, the nucleic acid encoding the RNA-guided nuclease can be a synthetic nucleic acid sequence. For example, the synthetic nucleic acid molecule can be chemically modified. In certain embodiments, the mRNA encoding the RNA-guided nuclease will have one or more (e.g., all) of the following properties: it can be capped; polyadenylated; and substituted with 5-methylcytidine and / or pseudouridine.

[0207] The synthetic nucleic acid sequence can also be codon optimized, for example, at least one uncommon codon or less common codon has been replaced by a common codon. For example, the synthetic nucleic acid can guide the synthesis of an optimized messenger mRNA (e.g., optimized for expression in a mammalian expression system (e.g., described herein)). Examples of codon-optimized Cas9 coding sequences are presented in Cotta-Ramusino.

[0208] Additionally, or alternatively, the nucleic acid encoding the RNA-guided nuclease can comprise a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art. Functional analysis of candidate molecules

[0209] Candidate RNA-guided nucleases, gRNAs, and complexes thereof can be evaluated by standard methods known in the art. See, e.g., Cotta-Ramusino. The stability of the RNP complex can be evaluated by differential scanning fluorimetry, as described below. Differential Scanning Fluorescence (DSF)

[0210] The thermal stability of ribonucleoprotein (RNP) complexes containing gRNA and RNA-guided nucleases can be measured by DSF. The DSF technique measures the thermal stability of proteins, which can be increased under favorable conditions (such as the addition of binding RNA molecules, such as gRNA).

[0211] The DSF assay can be performed according to any suitable protocol and can be used in any suitable environment, including but not limited to (a) testing different conditions (e.g., different stoichiometric ratios of gRNA: RNA-guided nuclease protein, different buffer solutions, etc.) to identify optimal conditions for RNP formation; and (b) testing modifications of RNA-guided nucleases and / or gRNAs (e.g., chemical modifications, sequence changes, etc.) to identify those modifications that improve RNP formation or stability. One readout of the DSF assay is the shift in the melting temperature of the RNP complex; a relatively high shift indicates that the RNP complex is more stable (and may therefore have higher activity or more favorable formation kinetics, degradation kinetics, or another functional feature) relative to a reference RNP complex characterized by a lower shift. When the DSF assay is arranged as a screening tool, a threshold melting temperature shift can be specified so that the output is one or more RNPs with a melting temperature shift equal to or above the threshold. For example, the threshold can be 5°C-10°C (e.g., 5°, 6°, 7°, 8°, 9°, 10°) or higher, and the output can be one or more RNPs characterized by a melting temperature shift greater than or equal to the threshold.

[0212] Two non-limiting examples of DSF assay conditions are set forth below:

[0213] To determine the optimal solution for forming RNP complexes, water + 10x SYPRO Cas9 at a fixed concentration (e.g., 2 μM) in a 384-well plate (Life Technologies catalog number S-6650) was dispensed into a 384-well plate. Equimolar amounts of gRNA diluted in solutions with different pH and salt were then added. After incubation at room temperature for 10 minutes and brief centrifugation to remove any bubbles, the plates were plated using a Bio-Rad CFX384 TM Real-TimeSystem C1000Touch TMThe thermal cycler and Bio-Rad CFX Manager software ran a gradient from 20°C to 90°C with a temperature increase of 1°C every 10 seconds.

[0214] The second assay consisted of mixing different concentrations of gRNA with a fixed concentration (e.g., 2 μM) of Cas9 in the optimal buffer from assay 1 above and incubating in a 384-well plate (e.g., at room temperature for 10 minutes). Add an equal volume of optimal buffer + 10x SYPRO (Life Technologies Catalog No. S-6650), and the plates were After brief centrifugation to remove any air bubbles, the samples were sealed using Bio-Rad CFX384 TM Real-Time System C1000Touch TM The thermal cycler and Bio-Rad CFX Manager software ran a gradient from 20°C to 90°C with a temperature increase of 1°C every 10 seconds. Genome editing strategies

[0215] In various embodiments of the present disclosure, the above-mentioned genome editing system is used to produce edits (i.e., changes) in a targeted region of DNA obtained in or from a cell. Various strategies for producing specific edits are described herein, and these strategies are generally described in terms of the desired repair outcome, the number and location of individual edits (e.g., SSB or DSB), and the target sites of such edits.

[0216] Genome editing strategies involving the formation of SSBs or DSBs are characterized by repair outcomes, which include: (a) deletion of all or part of the targeted region; (b) insertion or replacement in all or part of the targeted region; or (c) interruption of all or part of the targeted region. This grouping is not intended to be limiting or to be bound to any particular theory or model, but is provided only for ease of presentation. The skilled person will understand that the listed outcomes are not mutually exclusive and that some repairs may lead to other outcomes. Unless otherwise specified, the description of a particular editing strategy or method should not be understood as requiring a specific repair outcome.

[0217] The replacement of the targeted region generally involves replacing all or part of the existing sequence in the targeted region with a homologous sequence, for example, by gene correction or gene conversion, and the two repair results are mediated by the HDR path. HDR is promoted by using a donor template, which can be single-stranded or double-stranded, as described in more detail below. The single-stranded or double-stranded template can be exogenous, in which case it will promote gene correction, or the template can be endogenous (for example, a homologous sequence in the cell genome) to promote gene conversion. The exogenous template can have an asymmetric overhang (that is, the portion complementary to the DSB site in the template can be offset in the 3' or 5' direction, rather than being located in the center of the donor template), such as described by Richardson et al. (Nature Biotechnology [Natural Biotechnology] 34, 339-344 (2016) (Richardson), incorporated by reference). In the case where the template is single-stranded, it can correspond to the complementary (top) or non-complementary (bottom) strand of the targeted region. Gene constructs

[0218] In some aspects, the present disclosure provides complex editing strategies, and the resulting modified cells with complex genomic alterations, that allow for the generation of advanced NK cell products for clinical applications (e.g., for immuno-oncology therapeutic approaches).

[0219] In some embodiments, the genomic alteration is introduced by using one or more HDR expression constructs. In some embodiments, the genomic alteration is introduced by using one or more HDR expression constructs. In some embodiments, the one or more HDR expression constructs comprise one or more donor HDR templates. In some embodiments, the one or more donor HDR templates comprise one or more expression cassettes encoding one or more cDNAs. In some embodiments, the donor HDR template comprises one expression cassette. In some embodiments, the donor HDR template comprises two expression cassettes. In some embodiments, the donor HDR template comprises three expression cassettes. In some embodiments, the donor HDR template comprises four expression cassettes. In some embodiments, the donor HDR template comprises five expression cassettes. In some embodiments, the donor HDR template comprises six expression cassettes. In some embodiments, the donor HDR template comprises seven expression cassettes. In some embodiments, the donor HDR template comprises eight expression cassettes. In some embodiments, the donor HDR template comprises nine expression cassettes. In some embodiments, the donor HDR template comprises ten expression cassettes. In some embodiments, the one or more expression cassettes are monocistronic. In some embodiments, the one or more expression cassettes are bicistronic.

[0220] In some embodiments, one or more expression cassettes comprise one cDNA. In some embodiments, one or more expression cassettes comprise two cDNAs. In some embodiments, one or more expression cassettes comprise three cDNAs. In some embodiments, one or more expression cassettes include four cDNAs. In some embodiments, one or more expression cassettes comprise five cDNAs. In some embodiments, one or more expression cassettes comprise six cDNAs. In some embodiments, one or more expression cassettes comprise seven cDNAs. In some embodiments, one or more expression cassettes comprise eight cDNAs. In some embodiments, one or more expression cassettes comprise nine cDNAs. In some embodiments, one or more expression cassettes comprise ten cDNAs. In some embodiments, one or more expression cassettes comprise one or more cDNAs separated by a 2A sequence. In some embodiments, one or more expression cassettes comprise two cDNAs separated by a 2A sequence. In some embodiments, one or more expression cassettes comprise three cDNAs separated by a 2A sequence.

[0221] In some embodiments, the HDR expression construct comprises one or more cDNAs driven by a heterologous promoter.

[0222] In some embodiments, the one or more expression cassettes comprise cDNA for expressing one or more genes listed in Table 10.

[0223] In some embodiments, the HDR expression construct comprises one or more donor templates for inserting inactivating mutations in the target gene, wherein the gene product has less or no function (partial or complete inactivation). In some embodiments, the HDR expression construct comprises one or more donor templates for inserting inactivating mutations in the target gene, wherein the gene product has no function (complete inactivation).

[0224] In some embodiments, the modified cells of the present disclosure comprise at least one exogenous nucleic acid construct encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of two or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of three or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of four or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of five or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of six or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of seven or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of eight or more exogenous nucleic acid constructs encoding cDNAs of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of nine or more exogenous nucleic acid constructs encoding cDNAs of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of ten or more exogenous nucleic acid constructs encoding cDNAs of one or more genes listed in Table 10.

[0225] In some embodiments, the modified NK cells of the present disclosure comprise at least one exogenous nucleic acid construct encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of two or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of three or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of four or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of five or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of six or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of seven or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of eight or more exogenous nucleic acid constructs encoding cDNAs of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of nine or more exogenous nucleic acid constructs encoding cDNAs of one or more genes listed in Table 10. In some embodiments, the modified cells of the present disclosure comprise any combination of ten or more exogenous nucleic acid constructs encoding cDNAs of one or more genes listed in Table 10.

[0226] In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least one or more genes listed in Table 11, or any combination of two or more thereof. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least two or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least three or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least four or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least five or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least six or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least seven or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least eight or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least nine or more genes listed in Table 11. In some embodiments, the modified cells of the disclosure exhibit loss of function of at least ten or more of the genes listed in Table 11.

[0227] In some embodiments, the modified NK cells of the present disclosure exhibit loss of function of at least one or more genes listed in Table 11, or any combination of two or more thereof. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least two or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least three or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least four or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least five or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least six or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least seven or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least eight or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure exhibit loss of function of at least nine or more genes listed in Table 11. In some embodiments, the modified cells of the disclosure exhibit loss of function of at least ten or more of the genes listed in Table 11.

[0228] In some embodiments, the modified cells of the present disclosure comprise at least one exogenous nucleic acid construct encoding the cDNA of one or more genes listed in Table 10, and exhibit loss of function of at least one gene listed in Table 11. In some embodiments, the modified cells of the present disclosure comprise any combination of two or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10 and at least one gene listed in Table 11. In some embodiments, the modified cells of the present disclosure comprise at least one exogenous nucleic acid construct encoding the cDNA of one or more genes listed in Table 10 and loss of function of two or more genes listed in Table 11. In some embodiments, the modified cells of the present disclosure comprise two or more exogenous nucleic acid constructs encoding the cDNA of one or more genes listed in Table 10 and loss of function of two or more genes listed in Table 11.

[0229] In some cases, gene conversion and gene correction are facilitated by forming one or more nicks in or around the targeted region, as described in Ran and Cotta-Ramusino. In some cases, a dual nickase strategy is used to form two offset SSBs, which in turn form a single DSB with an overhang (e.g., a 5' overhang).

[0230] Disruption and / or deletion of all or part of the targeted sequence can be achieved by a variety of repair outcomes. As an example, a sequence can be deleted by simultaneously creating two or more DSBs flanking the targeted region, which are then excised upon repair of the DSBs, as described for the LCA10 mutation in Maeder. As another example, a sequence can be interrupted prior to repair by a deletion created by forming a double-strand break with a single-stranded overhang, followed by exonucleolytic processing of the overhang.

[0231] A specific subset of target sequence disruptions is mediated by the formation of indels within the targeted sequence, where the repair outcome is typically mediated by the NHEJ pathway (including Alt-NHEJ). NHEJ is known as the "error-prone" repair pathway due to its association with indel mutations. However, in some cases, DSBs are repaired by NHEJ and do not alter the sequence around them (so-called "perfect" or "scarless" repair); this typically requires perfect ligation of both ends of the DSB. At the same time, indels are thought to result from enzymatic processing of the DNA free ends prior to ligation, which adds and / or removes nucleotides in one or both strands of one or both free ends.

[0232] Since the enzymatic processing of free DSB ends can be stochastic, indel mutations are often variable, occur along a distribution, and may be affected by a variety of factors, including the specific target site, the cell type used, the genome editing strategy used, etc. Even so, it is possible to cause limited generalization about indel formation: the deletion formed by repairing a single DSB is most often in the range of 1-50bp, but may reach greater than 100-200bp. The insertion formed by repairing a single DSB is often shorter and often includes short repeats of sequences closely surrounding the break site. However, it is possible to obtain large insertions, and in these cases, the inserted sequence has usually been traced back to other regions of the genome or to plasmid DNA present in the cell.

[0233] Indel mutations and genome editing systems configured to produce indels can be used, for example, to interrupt target sequences when a specific final sequence is not required and / or when frameshift mutations can be tolerated. It can also be used in an environment that prefers a specific sequence, as long as some desired sequences often occur preferentially through the repair of SSB or DSB at a given site. Indel mutations are also tools that can be used to evaluate or screen the activity of a specific genome editing system and its components. In these and other environments, indels can be characterized by the following: (a) its relative and absolute frequency in the genome of cells contacted with the genome editing system, and (b) distribution of numerical differences relative to unedited sequences, such as ±1, ±2, ±3, etc. As an example, in a lead-finding environment, multiple gRNAs can be screened based on indel readouts under controlled conditions to identify those gRNAs that most effectively drive cutting at the target site. It can be selected to generate indels at a threshold frequency or at a frequency higher than a threshold or to generate guidance for a specific distribution of indels for further research and development. Indel frequencies and distributions can also be used as readouts to evaluate different genome editing system implementations or configurations and delivery methods, for example by keeping the gRNA constant and varying certain other reaction conditions or delivery methods. Multiple strategies

[0234] Although the exemplary strategies discussed above focus on the repair results mediated by a single DSB, the genome editing system according to the present disclosure can also be used to generate two or more DSBs in the same locus or in different loci. Editing strategies involving the formation of multiple DSBs or SSBs are described in, for example, Cotta-Ramusino. In some embodiments, in the case of multiple edits in the genome of NK cells or cells derived from NK cells, these edits are performed at the same time or at a closely approached time. In some such embodiments, two or more genome edits are achieved by two or more different RNA-guided nucleases. For example, one of these genome edits can be achieved by saCas9 (in conjunction with the corresponding saCas9 guide RNA), and different genome edits can be achieved by Cpf1 (in conjunction with the corresponding Cpf1 guide RNA). In some embodiments, in the context of multiple genome editing methods, compared with using the same RNA-guided nuclease for two or more edits, it is advantageous to use different RNA-guided nucleases, for example, it allows to reduce the possibility or frequency of undesirable effects (such as off-target cutting), as well as the occurrence of genomic translocations. Donor template design

[0235] Donor template design is described in detail in the literature, for example in Cotta-Ramusino. DNA oligomer donor templates (oligodeoxynucleotides or ODNs) can be single-stranded (ssODN) or double-stranded (dsODN), can be used to promote HDR-based DSB repair, and are particularly useful for introducing changes into a target DNA sequence, inserting a new sequence into a target sequence, or completely replacing a target sequence.

[0236] Whether single-stranded or double-stranded, the donor template generally includes regions homologous to regions of DNA within or near (e.g., flanking or adjacent) the target sequence to be cleaved. These homologous regions are referred to herein as "homology arms" and are schematically shown below: [5' homology arm]-[alternative sequence]-[3' homology arm].

[0237] Homologous arms can have any suitable length (if only one homology arm is used, including 0 nucleotides), and 3' and 5' homology arms can have the same length or can have different lengths. The selection of appropriate homology arm length may be affected by a variety of factors, such as the desire to avoid homology or microhomology with certain sequences (such as Alu repeats or other extremely common elements). For example, the 5' homology arm can be shortened to avoid sequence repeat elements. In other embodiments, the 3' homology arm can be shortened to avoid sequence repeat elements. In some embodiments, the 5' and 3' homology arms can be shortened simultaneously to avoid including certain sequence repeat elements. In addition, some homology arm designs can improve editing efficiency or increase the frequency of desired repair results. For example, Richardson et al. (Nature Biotechnology [Natural Biotechnology] 34, 339-344 (2016) (Richardson), incorporated by reference) found that the relative asymmetry of the 3' and 5' homology arms of the single-stranded donor template affects the repair rate and / or result.

[0238] The replacement sequence in the donor template has been described in other documents (including Cotta-Ramusino et al.). The replacement sequence can be any suitable length (if the desired repair result is a deletion, then including 0 nucleotides), and typically includes 1, 2, 3 or more sequence modifications relative to the naturally occurring sequence in the cell that needs to be edited. A common sequence modification involves changing the naturally occurring sequence to repair a mutation, which is associated with a disease or condition that needs to be treated. Another common sequence modification involves changing one or more sequences, which are complementary to or encode the PAM sequence of the nuclease guided by RNA or the targeting domain of one or more gRNAs for generating SSB or DSB, to reduce or eliminate repeated cleavage of the target site after the replacement sequence is incorporated into the target site.

[0239] If a linear ssODN is used, it can be configured to (i) anneal to a nicked strand of a target nucleic acid, (ii) anneal to an intact strand of a target nucleic acid, (iii) anneal to a plus strand of a target nucleic acid, and / or (iv) anneal to a minus strand of a target nucleic acid. The ssODN can have any suitable length, such as about, at least, or no more than 150-200 nucleotides (e.g., 150, 160, 170, 180, 190, or 200 nucleotides).

[0240] It should be noted that template nucleic acid can also be a nucleic acid vector, such as a viral genome or circular double-stranded DNA, such as a plasmid. The nucleic acid vector comprising a donor template can include other coding or non-coding elements. For example, the template nucleic acid can be delivered as part of the viral genome (e.g., in AAV or lentiviral genomes), including certain genomic backbone elements (e.g., in the case of the AAV genome, terminal inverted repeats) and optionally including other sequences of the nucleases guided by encoding gRNA and / or RNA. In certain embodiments, the donor template can be adjacent to or flanked by a target site identified by one or more gRNAs to facilitate formation of free DSBs at one or both ends of the donor template, and the donor template can participate in repairing the corresponding SSBs or DSBs formed in the cell DNA using the same gRNA. Exemplary nucleic acid vectors suitable for use as donor templates are described in Cotta-Ramusino.

[0241] Regardless of which format is used, the template nucleic acid can be designed to avoid undesirable sequences. In certain embodiments, one or both homology arms can be shortened to avoid overlapping with certain sequence repeat elements (e.g., Alu repeats, LINE elements, etc.). Quantitative measurement of on-target gene editing

[0242] It should be noted that the genome editing system disclosed herein allows detection and quantitative measurement of on-target gene editing results, including targeted integration. The compositions and methods described herein can rely on the use of donor templates comprising 5' homology arms, cargo, one or more priming sites, 3' homology arms, and optionally filled sequences. For example, the international patent publication number WO2019 / 014564 of Ramusino et al. (Ramusino), which is incorporated herein in its entirety by reference, describes a composition and method for quantitatively analyzing on-target gene editing results (including targeted integration events) by embedding one or more primer binding sites (i.e., priming sites) substantially identical to the priming sites present in the targeted genomic DNA locus (i.e., target nucleic acid) into the donor template. The priming site is embedded in the donor template so that when homologous recombination of the donor template with the target nucleic acid occurs, the successful targeted integration of the donor template integrates the priming site from the donor template into the target nucleic acid, so that at least one amplicon can be produced, so as to quantitatively determine the on-target editing result.

[0243] In some embodiments, the target nucleic acid comprises a first priming site (P1) and a second priming site (P2), and the donor template comprises a load sequence, a first priming site (P1'), and a second priming site (P2'), wherein P2' is located at the 5' of the load sequence, wherein P1' is located at the 3' of the load sequence (i.e., A1--P2'--N--P1'--A2), wherein P1' is substantially identical to P1, and wherein P2' is substantially identical to P2. After accurate homology-driven targeted integration, three amplicons are generated using a single PCR reaction with two oligonucleotide primers. The first amplicon, amplicon X, is generated from the primer binding sites (P1 and P2) initially present in the genomic DNA, and sequencing can be performed to analyze the on-target editing events (e.g., insertions, deletions, gene conversions) that do not result in targeted integration. After homology-driven targeted integration, the remaining two amplicons are mapped to 5' and 3' connections. The second amplicon, amplicon Y, is generated from the nucleic acid sequence amplification between P1 and P2' after the targeted integration event at the target nucleic acid, thereby amplifying the 5' connection. The third amplicon, amplicon Z, is generated from the amplification of the nucleic acid sequence between P1' and P2 after the targeted integration event at the target nucleic acid, thereby amplifying the 3' connection. In addition to the information about the fidelity of the targeted integration, the sequencing of these amplicons also provides a quantitative assessment of the targeted integration at the target nucleic acid. To avoid any inherent bias in the size of the amplicon, a filler sequence can be optionally included in the donor template to keep all three expected amplicon lengths the same. Implementation of genome editing systems: Delivery, formulation and route of administration

[0244] As discussed above, the genome editing system of the present disclosure can be implemented in any suitable manner, meaning that the components of such systems (including but not limited to RNA-guided nucleases, gRNAs, and optional donor template nucleic acids) can be delivered, formulated, or administered in any suitable form or combination of forms, thereby causing transduction, expression, or introduction of the genome editing system and / or causing the desired repair results in cells, tissues, or subjects. According to the genome editing system of the present disclosure, a variety of gRNAs, a variety of RNA-guided nucleases, and other components, such as proteins, can be incorporated, and based on the principles shown in the system of the present disclosure, a variety of implementations will be understood by technicians. In some embodiments, the genome editing system of the present disclosure is delivered to cells as a ribonucleoprotein (RNP) complex. In some embodiments, one or more RNP complexes are delivered to cells sequentially or simultaneously in any order.

[0245] Nucleic acids encoding various elements of the genome editing system according to the present disclosure may be administered to a subject or delivered to a cell by methods known in the art or as described herein. For example, DNA encoding the nuclease guided by RNA and / or DNA encoding gRNA and donor template nucleic acid may be delivered by, for example, a vector (e.g., a virus or non-viral vector), a non-vector-based method (e.g., using naked DNA or DNA complexes) or a combination thereof. In some embodiments, the genome editing system of the present disclosure is delivered by AAV.

[0246] Nucleic acids encoding genome editing systems or components thereof can be delivered directly to cells as naked DNA or RNA, for example, by transfection or electroporation, or can be conjugated to molecules (e.g., N-acetylgalactosamine) that promote uptake by target cells (e.g., erythrocytes, HSCs). In some embodiments, the genome editing systems of the present disclosure are delivered to cells by electroporation.

[0247] A promising solution to improve the cell therapy process includes delivering active proteins directly into human cells. The protein delivery agent Feldan Shuttle is a protein-based delivery agent designed for cell therapy (Del'guidice et al., PLoS One [Public Library of Science Comprehensive]. 2018 Apr 4; 13(4): e0195558; incorporated herein by reference in its entirety). In some embodiments, the genome editing system of the present disclosure is delivered into cells via Feldan Shuttle.

[0248] The modified cells of the present disclosure can be administered by any known route of administration known in the art at the time of filing this application. In some embodiments, the modified cells of the present disclosure are administered intravenously (IV). In some embodiments, the modified NK cells of the present disclosure are administered intravenously (IV).

[0249] As used herein, "dose" refers to a specific amount of a pharmacologically active material administered to a subject for a given period of time. Unless otherwise indicated, the described doses refer to NK cells with complex genomic alterations that allow for the production of advanced NK cell products for clinical applications. In some embodiments, the dose of modified NK cells refers to an effective amount of modified NK cells. For example, in some embodiments, the dose or effective amount of modified NK cells refers to about 1 x 10 9 -5x 10 9 Modified NK cells or approximately 2x10 9 -5x 10 9 In some embodiments, the dose or effective amount of modified NK cells refers to about 3 x 10 9 -5x 109 Modified NK cells or approximately 4 x 10 9 -5x 10 9 Modified NK cells. Generation of modified iNK cells

[0250] Some aspects of the present disclosure relate to the generation of genetically modified NK cells derived from stem cells (e.g., pluripotent cells such as HSC, or pluripotent stem cells such as ES cells or iPS cells). In some embodiments, when genetically modified iNK cells are derived from iPS cells, iPS cells are derived from somatic cell donor cells. In some embodiments, when genetically modified iNK cells are derived from iPS cells, iPS cells are derived from pluripotent donor cells, such as HSC.

[0251] The genome editing present in the final iNK cell can be performed at any stage of the process of reprogramming the donor cell to the iPS cell state, during the iPS cell state, and / or at any stage of the process of differentiating the iPS cell to the iNK state (e.g., an intermediate state, such as an iPS cell-derived HSC state, or even until or in the final iNK cell state). In some embodiments, one or more genome editings present in the modified iNK cells provided herein are performed before the donor cell is reprogrammed to the iPS cell state. In some embodiments, all editings present in the modified iNK cells provided herein are performed at the same time, at a close proximity of time, and / or at the same cell stage (e.g., at the donor cell stage, during the reprogramming process, at the iPS cell stage, or during the differentiation process). In some embodiments, two or more editings present in the modified iNK cells provided herein are performed at different times and / or different cell stages of the reprogramming / differentiation process. For example, in some embodiments, a kind of editing is performed at the donor cell stage, and different editings are performed at the iPS cell stage; in some embodiments, a kind of editing is performed at the reprogramming stage, and different editings are performed at the iPS cell stage. These examples are provided to illustrate some of the strategies provided herein and are not intended to be limiting.

[0252] A variety of cell types can be used as donor cells, which can be subjected to reprogramming, differentiation and genome editing strategies for deriving modified iNK cells provided herein. The donor cells to be subjected to reprogramming, differentiation and genome editing strategies provided herein can be any suitable cell type. For example, the donor cell can be a pluripotent stem cell or a differentiated cell, such as a somatic cell, such as a fibroblast or a T lymphocyte.

[0253] In certain embodiments, the donor cell is a human cell. In certain embodiments, the donor cell is a non-human primate cell. In certain embodiments, the donor cell is a mammalian cell. In certain embodiments, the donor cell is a somatic cell. In certain embodiments, the donor cell is a stem cell or a progenitor cell. In certain embodiments, the donor cell is not a part of a human embryo, and its derivation does not involve destroying a human embryo.

[0254] In some embodiments, provided herein are iNK cells and methods for deriving such iNK cells, which have one or more genomic changes (e.g., knockout of undesirable genes for immuno-oncology treatment methods, and / or knock-in of exogenous nucleic acids, such as encoding expression constructs of gene products desired for immuno-oncology treatment methods). In some embodiments, iNK cells are derived from iPS cells, which are in turn derived from somatic cell donor cells. Any suitable somatic cell can be used to produce iPS cells, which then produce iNK cells. Suitable strategies for deriving iPS cells from various somatic cell donor cell types and known in the art have been described. In some embodiments, somatic cell donor cells are fibroblasts. In some embodiments, somatic cell donor cells are mature T cells.

[0255] For example, in some embodiments, the somatic cell donor cell that derives iPS cells and subsequently derives iNK cells is a mature T cell (a T cell that has undergone thymic selection). A sign of mature T cells is the T cell receptor locus of rearrangement. During T cell maturation, the TCR locus undergoes V (D) J rearrangement to produce complete V-domain exons. These rearrangements are retained in the whole process of T cell reprogramming to inducible pluripotent stem (iPS) cells and in the whole process of the iPS cells obtained being differentiated into somatic cells.

[0256] In certain embodiments, the donor somatic cells are CD8 + T cells, CD8 + Natural T cells, CD4 + Central memory T cells, CD8 + Central memory T cells, CD4 + Effector memory T cells, CD4 + Effector memory T cells, CD4 + T cells, CD4 + Stem cell memory T cells, CD8 + Stem cell memory T cells, CD4 + Helper T cells, regulatory T cells, cytotoxic T cells, natural killer T cells, CD4+ naive T cells, TH17CD4 + T cells, TH1CD4 + T cells, TH2CD4+ T cells, TH9CD4 + T cells, CD4 + Foxp3 + T cells, CD4 + CD25 + CD127 - T cells or CD4 + CD25 + CD127 - Foxp3 + T cells.

[0257] An advantage of using T cells for producing iPS cells is that T cells can be edited relatively easily, for example, by methods based on CRISPR or other gene editing methods. Another advantage of using T cells to generate iPS cells is that the rearranged TCR loci allow genetic tracking of individual cells and their daughter cells. If reprogramming, amplification, cultivation and / or differentiation strategies involve clonal expansion of individual cells in NK cell production, the rearranged TCR loci can be used as genetic markers to clearly identify cells and their daughter cells. This in turn allows characterization of cell populations as true clones, or allows identification of contaminated cells in mixed populations or clonal populations.

[0258] A third advantage of using T cells when generating iNK cells carrying multiple edits is the selection of certain karyotype aberrations associated with chromosomal translocations in T cell cultures. Such aberrations pose a problem when editing cells via CRISPR technology, especially when generating cells carrying multiple edits.

[0259] A fourth advantage of using T cell-derived iPS cells as a starting point for deriving therapeutic lymphocytes is that it allows the expression of pre-screened TCRs in lymphocytes, for example by selecting T cells by binding activity against a specific antigen (e.g., a tumor antigen), reprogramming the selected T cells into iPS cells, and then deriving lymphocytes (e.g., T cells) expressing the TCR from these iPS cells. This strategy also allows the activation of TCRs in other cell types, for example, by genetic or epigenetic strategies.

[0260] A fifth advantage of using T cell-derived iPS cells as the starting point for iNK differentiation is that T cells retain at least a portion of their "epigenetic memory" throughout the reprogramming process, so subsequent differentiation of the same or closely related cell types (such as iNK cells) will be more efficient and / or result in higher quality cell populations compared to methods that use unrelated cells (such as fibroblasts) as the starting point for iNK derivation.

[0261] In certain embodiments, the donor cell being manipulated, e.g., the cell being reprogrammed and / or the cell being genome edited, is a long-term hematopoietic stem cell, a short-term hematopoietic stem cell, a multipotent progenitor cell, a lineage-restricted progenitor cell, a lymphoid progenitor cell, a myeloid progenitor cell, a common myeloid progenitor cell, an erythroid progenitor cell, a megakaryocyte erythroid progenitor cell, a retinal cell, a photoreceptor cell, a rod cell, a cone cell, a retinal pigment epithelial cell, a trabecular meshwork cell, a cochlear hair cell, an outer hair cell, an inner hair cell, an alveolar epithelial cell, a bronchial epithelial cell, an alveolar epithelial cell, a lung epithelial progenitor cell, a striated muscle cell, a cardiomyocyte, a muscle satellite cell, a neuron, a neuronal stem cell, a mesenchymal stem cell, an induced pluripotent stem cell (iPS), an embryonic stem cell, a fibroblast, a monocyte-derived macrophage or a dendritic cell, a megakaryocyte, a neutrophil, an eosinophil, a basophil, a mast cell, a reticulocyte, a B cell, e.g., a progenitor B cell (progenitor B cells, pre-B cells, progenitor B cells (Pro B cells), memory B cells, plasma B cells, gastrointestinal epithelial cells, bile duct epithelial cells, pancreatic duct epithelial cells, intestinal stem cells, hepatocytes, hepatic stellate cells, Kupffer cells, osteoblasts, osteoclasts, adipocytes, preadipocytes, pancreatic islet cells (e.g., β cells, α cells, δ cells), pancreatic exocrine cells, Schwann cells or oligodendrocytes.

[0262] In certain embodiments, the donor cell is a circulating blood cell, for example, a reticulocyte, a megakaryocyte erythroid progenitor (MEP), a myeloid progenitor (CMP / GMP), a lymphoid progenitor (LP), a hematopoietic stem cell / progenitor (HSC), or an endothelial cell (EC). In certain embodiments, the donor cell is a bone marrow cell (e.g., a reticulocyte, an erythroid cell (e.g., an erythroblast), a MEP cell, a myeloid progenitor (CMP / GMP), a LP cell, an erythroid progenitor (EP), an HSC, a multipotent progenitor (MPP), an endothelial cell (EC), a hemogenic endothelial (HE) cell, or a mesenchymal stem cell). In certain embodiments, the donor cell is a myeloid progenitor (e.g., a common myeloid progenitor (CMP) or a granulocyte macrophage colony stimulating factor progenitor (GMP)). In certain embodiments, the donor cell is a lymphoid progenitor, for example, a common lymphoid progenitor (CLP). In certain embodiments, the donor cell is an erythroid progenitor (e.g., a MEP cell). In certain embodiments, the donor cell is a hematopoietic stem / progenitor cell (e.g., a long-term HSC (LT-HSC), a short-term HSC (ST-HSC), an MPP cell, or a lineage-restricted progenitor cell (LRP)). In certain embodiments, the donor cell is a CD34 + Cells, CD34 + CD90 + Cells, CD34 +CD38 - Cells, CD34 + CD90 + CD49f + CD38 - CD45RA - Cells, CD105 + Cells, CD31 + , or CD133 + cells, or CD34 + CD90 + CD133 + In certain embodiments, the donor cells are cord blood CD34 + HSPC, umbilical vein endothelial cells, umbilical artery endothelial cells, amniotic fluid CD34 + cells, amniotic fluid endothelial cells, placental endothelial cells, or placental hematopoietic CD34 + In certain embodiments, the donor cells are mobilized peripheral blood CD34 + Cells (after the patient is treated with a mobilizing agent, e.g., G-CSF or Plerixafor). In certain embodiments, the donor cells are peripheral blood endothelial cells.

[0263] In some embodiments, the donor cell is a dividing cell. In other embodiments, the donor cell is a non-dividing cell.

[0264] In some embodiments, modified iNK cells produced by the methods and strategies for reprogramming, differentiation and editing provided herein are administered to subjects in need, e.g., in the context of immuno-oncology treatment methods. In some embodiments, donor cells or cells at any stage of the reprogramming, differentiation and editing strategies provided herein can be maintained in culture medium or stored (e.g., in liquid nitrogen) using any suitable method known in the art, e.g., for subsequent characterization or administration to subjects in need. Cell reprogramming

[0265] Compared with the same cell in a non-reprogrammed state, a cell with increased cell potential has more developmental plasticity (i.e., can differentiate into more cell types). In other words, a reprogrammed cell is a cell in a lower state of differentiation than the same cell in a non-reprogrammed state.

[0266] Reprogramming of the cells of the present disclosure can be performed by utilizing several methods. Examples of some methods for reprogramming the somatic cells of the present disclosure are described in, but not limited to, Valamehr et al., WO 2017 / 078807 ("Valamehr") and Mendlein et al. WO 2010 / 108126 ("Mendlein"), which are hereby incorporated by reference in their entirety.

[0267] Briefly, a method for directing differentiation of pluripotent stem cells to cells of the definitive hematopoietic lineage may include: (i) contacting pluripotent stem cells with a composition comprising a BMP activator and, optionally, bFGF, to initiate differentiation and expansion of mesodermal cells from the pluripotent stem cells; (ii) contacting the mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, wherein the composition is optionally free of a TGFβ receptor / ALK inhibitor, to initiate differentiation and expansion of mesodermal cells with definitive HE potential from the mesodermal cells; (iii) contacting the mesodermal cells with definitive HE potential with the following composition: The composition comprises a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6 and IL11; and optionally a Wnt pathway activator, wherein the composition optionally does not contain a TGFβ receptor / ALK inhibitor to initiate differentiation of mesodermal cells derived from pluripotent stem cells with definitive hemogenic endothelial potential and expand definitive hemogenic endothelium; and optionally subjecting the pluripotent stem cells, pluripotent stem cell-derived mesodermal cells, mesodermal cells with hemogenic endothelium, and / or definitive hemogenic endothelium to a low oxygen tension between about 2% and about 10%.

[0268] In some embodiments of the method for directing the differentiation of pluripotent stem cells to the cell of deterministic hematopoietic lineage, the method further comprises contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor and a ROCK inhibitor, wherein the composition does not contain a TGFβ receptor / ALK inhibitor, to inoculate and amplify the pluripotent stem cells. In certain embodiments, the pluripotent stem cells are iPSCs. In certain embodiments, iPSCs are naive iPSCs. In certain embodiments, iPSCs comprise one or more genetic imprints, and the one or more genetic imprints contained in the iPSCs are retained in the hematopoietic cells derived from the pluripotent stem cells differentiated therefrom.

[0269] In some embodiments of the method for directing differentiation of pluripotent stem cells to cells of the definitive hematopoietic lineage, the differentiation of pluripotent stem cells to cells of the hematopoietic lineage is performed without generating embryoid bodies and in a monolayer culture format.

[0270] In some embodiments of the above methods, the obtained pluripotent stem cell-derived definitive hemogenic endothelial cells are CD34+. In some embodiments, the obtained definitive hemogenic endothelial cells are CD34+CD43-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CD43-CXCR4-CD73-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CXCR4-CD73-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CD43-CD93-. In some embodiments, the definitive hemogenic endothelial cells are CD34+CD93-.

[0271] In some embodiments of the above methods, the method further comprises (i) contacting the pluripotent stem cell-derived definitive hemogenic endothelium with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of VEGF, bFGF, SCF, Flt3L, TPO and IL7; and optionally a BMP activator; to initiate differentiation of the definitive hemogenic endothelium to pre-T cell progenitors; and optionally (ii) contacting these pre-T cell progenitors with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L and IL7, but without VEGF, bFGF, TPO, BMP activator and ROCK inhibitor, to initiate differentiation of these pre-T cell progenitors to T cell progenitors or T cells. In some embodiments of the method, the pluripotent stem cell-derived T cell progenitors are CD34+CD45+CD7+. In some embodiments of the method, the pluripotent stem cell-derived T cell progenitors are CD45+CD7+.

[0272] In some other embodiments of the above-mentioned method for directing the differentiation of pluripotent stem cells to cells of the hematopoietic lineage, the method further comprises: (i) contacting the pluripotent stem cell-derived definitive hemogenic endothelium with the following composition, the composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of VEGF, bFGF, SCF, Flt3L, TPO, IL3, IL7 and IL15; and optionally a BMP activator to initiate the differentiation of the definitive hemogenic endothelium to pre-NK cell progenitor cells; and optionally (ii) contacting the pluripotent stem cell-derived pre-NK cell progenitor cells with the following composition, the composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, IL3, IL7 and IL15, wherein the culture medium does not contain one or more of VEGF, bFGF, TPO, BMP activator and ROCK inhibitor to initiate the differentiation of pre-NK cell progenitor cells to NK cell progenitor cells or NK cells. In some embodiments, the pluripotent stem cell-derived NK progenitor cells are CD3-CD45+CD56+CD7+. In some embodiments, the pluripotent stem cell-derived NK cells are CD3-CD45+CD56+, and optionally further defined by NKp46+, CD57+, and CD16+.

[0273] In yet other embodiments of the above method for directing differentiation of pluripotent stem cells to NK cells, the method further comprises knocking out the gene Nrg1 in the pluripotent stem cells.

[0274] In some embodiments, the present disclosure provides a method for generating pluripotent stem cell-derived T lineage cells, comprising: (i) contacting pluripotent stem cells with a composition comprising a BMP activator and, optionally, bFGF, to initiate differentiation and expansion of mesodermal cells from pluripotent stem cells; (ii) contacting the mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, but without a TGFβ receptor / ALK inhibitor, to initiate differentiation and expansion of mesodermal cells with definitive HE potential from mesodermal cells; (iii) contacting mesodermal cells with definitive HE potential with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; and, optionally, a Wnt pathway activator; wherein the composition does not contain a TGFβ receptor / ALK inhibitor to initiate differentiation and expansion of mesodermal cells with definitive HE potential from mesodermal cells. mesodermal cells differentiate and expand definitive hemogenic endothelium; (iv) contacting the definitive hemogenic endothelium with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of VEGF, bFGF, SCF, Flt3L, TPO and IL7; and optionally a BMP activator; to initiate differentiation of the definitive hemogenic endothelium to pre-T cell progenitors; and (v) contacting the pre-T cell progenitors with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L and IL7, wherein the composition is free of one or more of VEGF, bFGF, TPO, BMP activator and ROCK inhibitor; to initiate differentiation of the pre-T cell progenitors to T cell progenitors or T cells; and optionally subjecting the seeded pluripotent stem cells, mesodermal cells, mesodermal cells with definitive HE potential, and / or definitive hemogenic endothelium to a low oxygen tension of between about 2% and about 10%. In some embodiments, group II of the above method further comprises: contacting iPSC with a composition comprising a MEK inhibitor, a GSK3 inhibitor and a ROCK inhibitor but without a TGFβ receptor / ALK inhibitor to inoculate and expand pluripotent stem cells; and / or wherein these pluripotent stem cells. In some embodiments, the pluripotent stem cells are iPSCs. In some embodiments of the method, the differentiation of pluripotent stem cells to T cell lineages does not produce embryoid bodies, and is a monolayer culture form.

[0275] In some embodiments, the present disclosure provides a method for generating pluripotent stem cell-derived NK lineage cells, comprising: (i) contacting pluripotent stem cells with a composition comprising a BMP activator and optionally bFGF to initiate differentiation and expansion of mesodermal cells from pluripotent stem cells; (ii) contacting mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, and optionally without a TGFβ receptor / ALK inhibitor, to initiate differentiation and expansion of mesodermal cells with definitive HE potential from mesodermal cells; (iii) contacting mesodermal cells with definitive HE potential with a composition comprising one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; a ROCK inhibitor; optionally a Wnt pathway activator; and optionally without a TGFβ receptor / ALK inhibitor, to initiate differentiation of mesodermal cells derived from pluripotent stem cells with definitive HE potential and expansion of definitive hemogenic endothelium derived from pluripotent stem cells; (iv) contacting the pluripotent stem cell-derived definitive hemogenic endothelium with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of VEGF, bFGF, SCF, Flt3L, TPO, IL3, IL7 and IL15, and optionally a BMP activator to initiate differentiation of the pluripotent stem cell-derived definitive hemogenic endothelium to pre-NK cell progenitors; and (v) contacting the pluripotent stem cell-derived pre-NK cell progenitors with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, IL3, IL7 and IL15, but without one or more of VEGF, bFGF, TPO, BMP activator and ROCK inhibitor to initiate differentiation of the pluripotent stem cell-derived pre-NK cell progenitors to pluripotent stem cell-derived NK cell progenitors or NK cells; and optionally subjecting the seeded pluripotent stem cells, pluripotent stem cell-derived mesoderm cells, and / or definitive hemogenic endothelium to a low oxygen tension of between about 2% and about 10%. In some embodiments, the method for producing the NK lineage cells derived from the pluripotent stem cells of group II further comprises contacting iPSC with a composition comprising a MEK inhibitor, a GSK3 inhibitor and a ROCK inhibitor but without a TGFβ receptor / ALK inhibitor to inoculate and expand iPSC. In some embodiments, iPSC is a naive iPSC. In some embodiments, the method for producing the NK lineage cells derived from the pluripotent stem cells does not produce embryoid bodies, and is a monolayer culture form.

[0276] In some embodiments, the present disclosure provides a method for generating definitive hemogenic endothelium derived from pluripotent stem cells, the method comprising: (i) contacting iPSCs with a composition comprising a BMP activator and, optionally, bFGF, to initiate differentiation of pluripotent stem cells and expansion of pluripotent stem cell-derived mesoderm cells; (ii) contacting pluripotent stem cell-derived mesoderm cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, and optionally without a TGFβ receptor / ALK inhibitor, to initiate differentiation of pluripotent stem cell-derived mesoderm cells and expansion of pluripotent stem cell-derived mesoderm cells with definitive HE potential; (iii) contacting pluripotent stem cell-derived mesoderm cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, and optionally without a TGFβ receptor / ALK inhibitor, to initiate differentiation of pluripotent stem cell-derived mesoderm cells and expansion of pluripotent stem cell-derived mesoderm cells with definitive HE potential; The pluripotent stem cell-derived mesodermal cells with definitive HE potential are contacted with a composition comprising one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6 and IL11; a ROCK inhibitor; and optionally a Wnt pathway activator, and optionally without a TGFβ receptor / ALK inhibitor, to initiate differentiation of the pluripotent stem cell-derived mesodermal cells with definitive HE potential and expand the pluripotent stem cell-derived definitive hemogenic endothelium; and optionally subjecting the seeded pluripotent stem cells, pluripotent stem cell-derived mesodermal cells, and / or definitive hemogenic endothelium to a low oxygen tension of between about 2% and about 10%. In some embodiments, the above method for generating pluripotent stem cell-derived definitive hemogenic endothelium further comprises: contacting the iPSC with a composition comprising a MEK inhibitor, a GSK3 inhibitor and a ROCK inhibitor but without a TGFβ receptor / ALK inhibitor to seed and expand the iPSC; and / or wherein the iPSC is a naive iPSC. In some embodiments, the iPSC comprises one or more genetic imprints, and the one or more genetic imprints contained in the iPSC are retained in the definitive hemogenic endothelial cells derived from the pluripotent stem cells differentiated therefrom. In some embodiments, the above method of differentiating iPSC into definitive hemogenic endothelial cells does not produce embryoid bodies and is a monolayer culture format.

[0277] In some embodiments, the present disclosure provides a method for generating multipotent progenitor cells derived from pluripotent stem cells of the hematopoietic lineage, the method comprising: (i) contacting iPSCs with a composition comprising a BMP activator and, optionally, bFGF, to initiate differentiation and expansion of pluripotent stem cell-derived mesodermal cells from iPSCs; (ii) contacting pluripotent stem cell-derived mesodermal cells with a composition comprising a BMP activator, bFGF, and a GSK3 inhibitor, but without a TGFβ receptor / ALK inhibitor, to initiate differentiation and expansion of mesodermal cells with definitive HE potential from mesodermal cells; (iii) contacting mesodermal cells with definitive HE potential with a composition comprising a ROCK inhibitor; one or more growth factors and cytokines selected from the group consisting of bFGF, VEGF, SCF, IGF, EPO, IL6, and IL11; and, optionally, a Wnt pathway activator, wherein the composition does not contain a TGFβ receptor / ALK inhibitor. (iv) contacting the definitive hemogenic endothelium with a composition comprising a BMP activator, a ROCK inhibitor, one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L and IL11 to initiate differentiation of the definitive hemogenic endothelium into pre-HSC; and (v) contacting the pre-HSC with a composition comprising a BMP activator, one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6 and IL11, but without a ROCK inhibitor, to initiate differentiation of the pre-HSC into hematopoietic multipotent progenitor cells; and optionally subjecting the seeded pluripotent stem cells, mesoderm cells, and / or definitive hemogenic endothelium to a low oxygen tension of between about 2% and about 10%. In certain embodiments, the above-mentioned method for producing the hematopoietic multipotent progenitor cell derived from pluripotent stem cells further comprises contacting the pluripotent stem cells with a composition comprising a MEK inhibitor, a GSK3 inhibitor and a ROCK inhibitor but without a TGFβ receptor / ALK inhibitor, to inoculate and amplify the pluripotent stem cells. In certain embodiments, the pluripotent stem cells are iPSCs. In certain embodiments, the iPSCs are naive iPSCs. In certain embodiments, the iPSCs comprise one or more genetic imprints, and the one or more genetic imprints included in the iPSCs are retained in the hematopoietic multipotent progenitor cells derived from the pluripotent stem cells differentiated therefrom. In certain embodiments, the above-mentioned method is used to differentiate pluripotent stem cells into hematopoietic multipotent progenitor cells without producing embryoid bodies, and is a monolayer culture form.

[0278] In some embodiments, the present disclosure provides a composition comprising: one or more cell populations produced by the culture platform disclosed herein: (i) CD34+ definitive hemogenic endothelium (iCD34) derived from pluripotent stem cells, wherein iCD34 cells have the ability to differentiate into multipotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NK cells, NKT cells and B cells, and wherein iCD34 cells are CD34+CD43-; (ii) definitive hemogenic endothelium (iHE), wherein iHE cells are CD34+, and at least one of CD43-, CD93-, CXCR4-, CD73- and CXCR4-CD73-; (iii) definitive HSC derived from pluripotent stem cells, wherein iHSCs are CD34+CD45+; (iv) hematopoietic pluripotent stem cells; (i) iMPP progenitor cells, wherein iMPP cells are CD34+CD45+; (v) T cell progenitor cells, wherein T cell progenitor cells are CD34+CD45+CD7+ or CD34-CD45+CD7+; (vi) T cells, wherein T cells are CD45+CD3+CD4+ or CD45+CD3+CD8+; (vii) NK cell progenitor cells, wherein NK cell progenitor cells are CD45+CD56+CD7+; (viii) NK cells, wherein NK cells are CD3-CD45+CD56+, and optionally further defined by NKp46+, CD57+ and CD16+; (ix) NKT cells, wherein NKT cells are CD45+Vα24Jα18+CD3+; and (x) B cells, wherein B cells are CD45+CD19+.

[0279] In some embodiments, the present disclosure provides one or more of the following cell lines or clonal cells generated using the methods disclosed herein: (i) CD34+ definitive hemogenic endothelium (iCD34) derived from pluripotent stem cells, wherein iCD34 cells have the ability to differentiate into multipotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NK cells and NKT cells, and wherein iCD34 cells are CD34+CD43-; (ii) definitive hemogenic endothelium (iHE), wherein the iHE cell line or clonal cell is CD34+, and at least one of CD43-, CD93-, CXCR4-, CD73- and CXCR4-CD73-; (iii) definitive HSC, wherein the iHSC is CD34+CD45+; (iv) hematopoietic multipotent progenitor cells (iMP P), wherein iMPP cells are CD34+CD45+; (v) T cell progenitors, wherein T cell progenitors are CD34+CD45+CD7+ or CD34-CD45+CD7+; (vi) T cells, wherein T cells are CD45+CD3+CD4+ or CD45+CD3+CD8+; (vii) NK cell progenitors, wherein NK cell progenitors are CD45+CD56+CD7+; (viii) NK cells, wherein NK cells are CD3-CD45+CD56+, and optionally further defined by NKp46+, CD57+ and CD16+; (ix) NKT cells, wherein NKT cells are CD45+Vα24Jα18+CD3+; and (x) B cells, wherein B cells are CD45+CD19+.

[0280] In some embodiments, the present disclosure provides methods for promoting hematopoietic self-renewal, reconstitution or engraftment using one or more of the following cell populations, cell lines or clonal cells produced by the disclosed methods: pluripotent stem cell-derived (i) CD34+ definitive hemogenic endothelium (iCD34), wherein iCD34 cells have the ability to differentiate into multipotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NK cells and NKT cells, and wherein iCD34 cells are CD34+CD43-; (ii) definitive hemogenic endothelium (iHE), wherein the iHE cell line or clonal cell is CD34+, and at least one of CD43-, CD93-, CXCR4-, CD73- and CXCR4-CD73-; (iii) definitive HSC, wherein the iHSC is CD34+CD45+; (iv) iv) hematopoietic multipotent progenitor cells, wherein iMPP cells are CD34+CD45+; (v) T cell progenitor cells, wherein T cell progenitor cells are CD34+CD45+CD7+ or CD34-CD45+CD7+; (vi) T cells, wherein T cells are CD45+CD3+CD4+ or CD45+CD3+CD8+; (vii) NK cell progenitor cells, wherein NK cell progenitor cells are CD45+CD56+CD7+; (viii) NK cells, wherein NK cells are CD3-CD45+CD56+, and optionally further defined by NKp46+, CD57+ and CD16+; (ix) NKT cells, wherein NKT cells are CD45+Vα24Jα18+CD3+; and (x) B cells, wherein B cells are CD45+CD19+.

[0281] In some embodiments, the present disclosure provides a method for generating hematopoietic lineage cells with enhanced therapeutic properties, and the method includes: obtaining iPSCs comprising one or more genetic imprints; and directing the differentiation of iPSCs to hematopoietic lineage cells. The differentiation-directed step further includes: (i) contacting pluripotent stem cells with a composition comprising a BMP pathway activator and optionally bFGF to obtain mesodermal cells; and (ii) contacting these mesodermal cells with a composition comprising a BMP pathway activator, bFGF, and a WNT pathway activator to obtain mesodermal cells with definitive hemogenic endothelial (HE) potential, wherein these mesodermal cells with definitive hemogenic endothelial (HE) potential are capable of providing hematopoietic lineage cells. Preferably, there is no step of forming embryoid bodies, mesodermal cells and mesodermal cells with definitive HE potential are obtained in steps (i) and (ii), and the obtained hematopoietic lineage cells include definitive hemogenic endothelial cells, hematopoietic stem cells and progenitor cells (HSC), hematopoietic multipotent progenitor cells (MPP), pre-T cell progenitor cells, pre-NK cell progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NK cells, NKT cells or B cells. In addition, the hematopoietic lineage cells retain the genetic imprints contained in iPSCs for differentiation direction.

[0282] In some embodiments, the differentiation-directed step of the above method further comprises: (i) contacting the mesodermal cells with definitive HE potential with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells; (ii) contacting the definitive HE cells with a composition comprising a BMP activator and optionally a ROCK inhibitor and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L and IL11 to obtain hematopoietic multipotent progenitor cells (MPP); (iii) contacting the definitive HE cells with a composition comprising comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L and IL7; and optionally one or more of BMP activators, ROCK inhibitors, TPO, VEGF and bFGF, to obtain pre-T cell progenitors, T cell progenitors and / or T cells; or (iv) contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7 and IL15, and optionally one or more of BMP activators, ROCK inhibitors, VEGF and bFGF, to obtain pre-NK cell progenitors, NK cell progenitors and / or NK cells.

[0283] In short, the method may include reprogramming mature source T or B cells to obtain induced pluripotent stem cells (iPSC); and detecting the presence of specific V (D) J recombination in iPSC or hematopoietic lineage cells derived therefrom, which is the same as that contained in mature T or B cells used to produce iPSC. In some embodiments, the above method further includes separating iPSC or hematopoietic lineage cells containing V (D) J recombination identical to mature source T or B cells. In some embodiments, the above method includes obtaining mature source T or B cells for reprogramming before reprogramming source cells; and determining V (D) J recombination specific for mature source T or B cells contained in immunoglobulin (Ig) or T cell receptor (TCR).

[0284] "Pluripotency factor" or "reprogramming factor" refers to an agent that can increase the developmental potential of a cell, alone or in combination with other agents. Pluripotency factors include, but are not limited to, polynucleotides, polypeptides, and small molecules that can increase the developmental potential of a cell. Exemplary pluripotency factors include, for example, transcription factors and small molecule reprogramming agents.

[0285] Many various cell types from all three germ layers have been shown to be suitable for somatic cell reprogramming, including but not limited to liver and stomach (Aoi et al., 2008); pancreatic β cells (Stadtfeld et al., 2008); mature B lymphocytes (Hanna et al., 2008); human skin fibroblasts (Takahashi et al., 2007; Yu et al., 2007; Lowry et al., 2008; Aasen et al., 2008); meningeal cells (Qin et al., 2008); neural stem cells (DiSteffano et al., 2008); and neural progenitor cells (Eminli et al., 2008). Therefore, the present disclosure contemplates, in part, methods for reprogramming and / or programming cells from any cell lineage.

[0286] The present disclosure contemplates, in part, altering the potency of a cell by contacting the cell with one or more repressors and / or activators to modulate the epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or half-life and / or protein activity of components of cellular pathways associated with determining or influencing the potency of the cell.

[0287] Therefore, in various embodiments, the present disclosure uses predictable and highly controlled gene expression methods, as discussed elsewhere herein, which enable ex vivo or in vivo reprogramming or dedifferentiation and programming or differentiation of somatic cells. As described above, however, intentional genetic engineering of cells is not preferred because it changes the cell genome and may cause genetic or epigenetic abnormalities. In contrast, the compositions and methods of the present disclosure provide repressors and / or activators that non-genetically change the potential of cells by mimicking the endogenous developmental potential pathways of cells to achieve reprogramming and / or programming of cells. Small molecules in reprogramming

[0288] Reprogramming of somatic cells into induced pluripotent stem cells has been achieved by retroviral infection of defined genes (eg, Oct-3 / 4, Sox-2, Klf-4, c-Myc, and Lin28, etc.) in combination with small molecules.

[0289] In certain embodiments, present disclosure provides a method for changing the potential of a cell, the method comprising contacting a cell with one or more repressors and / or activators or a composition comprising the same, wherein the one or more repressors and / or activators regulate at least one component of the cell path associated with the potential of the cell, thereby changing the potential of the cell. In a specific embodiment, one or more repressors and / or activators regulate one or more components of the cell path associated with the potential of the cell, thereby changing the potential of the cell. In certain embodiments, one or more repressors and / or activators regulate one or more components of the cell path associated with the potential of the cell, thereby changing the potential of the cell. In certain related embodiments, the regulation of the one or more components is synergistic, and increases the overall efficacy of the potential of the cell. Compared with the basic potential state, the potential of the cell can be changed to more potential states (for example, from differentiated cells to multipotent, multipotent or omnipotent cells) or less potential states (for example, from omnipotent, multipotent or omnipotent cells to differentiated somatic cells). In still other embodiments, the potential of the cell can be changed more than once. For example, cells can be first reprogrammed to more potential states, then programmed to specific somatic cells.

[0290] In another embodiment, the method of the present disclosure provides increasing the potency of a cell, wherein the cell is reprogrammed or dedifferentiated to a pluripotent state, comprising contacting the cell with a composition comprising one or more repressors and / or activators, wherein the one or more repressors and / or activators modulate at least one component of a cellular pathway associated with the pluripotency of the cell, thereby increasing the potency of the cell to a pluripotent state.

[0291] In certain embodiments, a method of increasing the potential of a cell to a pluripotent state comprises contacting the cell with one or more repressors and / or activators, wherein the one or more repressors and / or activators modulate at least one component of a cellular pathway associated with the potency of the cell, thereby increasing the potential of the cell to a pluripotent state.

[0292] In another specific embodiment, the method of increasing the potential of a cell to a pluripotent state comprises contacting the cell with one or more repressors and / or activators, wherein the one or more repressors and / or activators modulate at least one component of a cellular pathway associated with the potential of the cell, thereby increasing the potential of the cell to a pluripotent state.

[0293] In certain embodiments, the method of increasing the potency of a cell further comprises the step of contacting the totipotent cell, pluripotent cell, or multipotent cell with a second composition, wherein the second composition modulates at least one component of the cell's potency pathway to reduce the totipotency, pluripotency, or multipotency of the cell and differentiates the cell into a mature somatic cell.

[0294] In another related embodiment, the present disclosure provides a method of reprogramming a cell, the method comprising contacting the cell with a composition comprising one or more repressors and / or activators, wherein the one or more repressors and / or activators regulate at least one component of one or more cellular pathways associated with cell reprogramming, thereby reprogramming the cell.

[0295] In other embodiments, the present disclosure provides a method of differentiating a cell into a cell in a more potent state, the method comprising contacting the cell with a composition comprising one or more activators, wherein one or more repressors and / or activators modulate at least one component of one or more cellular pathways associated with dedifferentiation of the cell into a more potent state, thereby dedifferentiating the cell into a non-potent state.

[0296] According to various embodiments of the present disclosure, the repressor can be an antibody or antibody fragment, an antibody, a transbody, a DNA enzyme, ssRNA, dsRNA, mRNA, antisense RNA, a ribozyme, an antisense oligonucleotide, a primary miRNA, shRNA, an antagonist, an aptamer, siRNA, dsDNA, ssDNA; a polypeptide or its active fragment, a peptide mimetic, a peptoid or a small organic molecule. Polypeptide-based repressors include but are not limited to fusion polypeptides. Polypeptide-based repressors also include transcriptional repressors, which can further be fusion polypeptides and / or artificially designed transcriptional repressors as described elsewhere herein.

[0297] According to other various embodiments, the activator can be an antibody or antibody fragment, mRNA, bifunctional antisense oligonucleotide, dsDNA, a polypeptide or an active fragment thereof, a peptide mimetic, a peptoid, or a small organic molecule.

[0298] In some embodiments, a repressor regulates at least one component of a cellular potency pathway by: a) repressing the at least one component; b) derepressing the repressor of the at least one component; or c) repressing an activator of the at least one component. In related embodiments, one or more repressors may regulate at least one component of a pathway associated with cellular potency by: a) derepressing the at least one component; b) repressing the at least one component; or c) derepressing an activator of the at least one component.

[0299] In certain embodiments, one or more repressors regulate at least one component of a cellular pathway associated with cellular potency by: a) repressing a histone methyltransferase or repressing the epigenetic state, chromatin structure, transcription, mRNA splicing, post-translational modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity of at least one component; or b) derepressing a demethylase or activating the epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity of at least one component.

[0300] In related embodiments, the activator modulates at least one component of a cellular pathway associated with cellular potency by: a) activating the at least one component; b) activating a repressor of a repressor of the at least one component; or c) activating an activator of the at least one component.

[0301] In certain embodiments, one or more activators modulate at least one component by: a) activating a histone demethylase or activating an epigenetic state, chromatin structure, transcription, mRNA splicing, post-translational modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity of the at least one component; or b) activating a repressor of a histone methyltransferase or activating a repressor of the epigenetic state, chromatin structure, transcription, mRNA splicing, post-transcriptional modification, mRNA stability and / or half-life, translation, post-translational modification, protein stability and / or half-life, and / or protein activity of the at least one component.

[0302] In various other embodiments, the present disclosure contemplates, in part, a method of reprogramming a cell, the method comprising contacting the cell with one or more repressors, wherein the one or more repressors modulate at least one component of a cellular pathway associated with cell reprogramming, thereby reprogramming the cell.

[0303] In various other embodiments, the present disclosure contemplates, in part, a method of reprogramming a cell, the method comprising contacting the cell with a composition comprising one or more activators, wherein the one or more activators modulate at least one component of a cellular pathway associated with cell reprogramming, thereby reprogramming the cell.

[0304] Although some exemplary methods for reprogramming / NK cell differentiation are provided herein, these are exemplary and are not meant to limit the scope of the present disclosure. Based on the present disclosure, in view of the knowledge in the art, other suitable methods for reprogramming / NK cell differentiation are obvious to those skilled in the art. Methods for culturing NK cells on feeder layers or with feeder cells are described in detail, for example, in EP 3184109 to Valamehr et al. ("Valamehr"), which is incorporated herein by reference in its entirety.

[0305] Generally, any type of NK cell population can be cultured using a variety of methods and devices. The selection of culture equipment is generally based on the scale and purpose of the culture. The scale-up of cell culture preferably involves the use of a dedicated device. For example, devices for large-scale clinical-grade NK cell production are described in detail in Spanholtz et al. (PLoS ONE [Public Library of Science Comprehensive] 2010; 5: e9221) and Sutlu et al. (Cytotherapy [Cell Therapy] 2010, Online Preview 1-12).

[0306] The above-described method for ex vivo culturing of a NK cell population can in particular obtain a cultured NK cell population. Types of Editing

[0307] Some aspects of the present disclosure provide complex editing strategies, and the resulting NK cells with complex genomic changes, which allow the production of advanced NK cell products for clinical applications (e.g., for immuno-oncology treatment methods). In certain embodiments, the modified NK cells provided herein can be used as ready-made clinical solutions for patients suffering from or diagnosed with hyperproliferative diseases (e.g., cancer). In certain embodiments, compared with unmodified NK cells, modified NK cells show enhanced survival rate, proliferation, NK cell response level, NK cell response duration, resistance to NK cell exhaustion and / or target recognition. For example, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of a chimeric antigen receptor (CAR) of interest, e.g., a CAR targeting mesothelin, EGFR, HER2 and / or MICA / B; expression of a CD16 variant, e.g., hnCD16; expression of an IL15 / IL15RA fusion; loss of function of TGFβ receptor 2 (TGFβR2); and / or expression of a dominant negative TGFβR2 variant; loss of function of ADORA2A; loss of function of B2M; expression of HLA-G; loss of function of CIITA; loss of function of PD1; loss of function of TIGIT; and / or loss of function of CISH; or any combination of two or more thereof.

[0308] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0309] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; expression of soluble MICA and / or MICB; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0310] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; expression of soluble MICA and / or MICB; expression of exogenous IL-12; expression of exogenous IL-18; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0311] In some embodiments, the modified NK cells provided herein may comprise genome editing resulting in the following in the modified NK cells: expression of an exogenous CD16 variant, such as hnCD16; expression of an exogenous IL15 / IL15RA fusion; expression of exogenous HLA-G; expression of exogenous DN-TGFβR2; expression of exogenous IL-12; expression of exogenous IL-18; loss of function of TGFβR2; loss of function of B2M; loss of function of PD1; loss of function of TIGIT; and / or loss of function of ADORA2A.

[0312] The modified NK cells may exhibit one or more edits in their genome that result in loss of function of a target gene and / or one or more modifications that result in gain of function or overexpression of a gene product (e.g., a protein) from an exogenous nucleic acid construct (e.g., an expression construct) comprising a cDNA encoding the gene product that is integrated into the genome of the modified NK cells or provided extrachromosomally (e.g., in the form of an episomal expression construct).

[0313] Loss of function of a target gene is characterized by decreased expression of the target gene based on genomic modifications (e.g., RNA-guided nuclease-mediated cleavage in the target gene) that result in inactivation of the encoded gene product or reduction in its expression or function.

[0314] A gain of function of a gene product is characterized by increased expression of a gene product (e.g., a protein) in a cell (also referred to herein as overexpression), which can include, for example, increased expression levels of a gene product, or expression of a gene product in a cell that does not endogenously express the gene product, such as from an endogenous gene.

[0315] In some embodiments, the increase of gene products is achieved by introducing an exogenous nucleic acid construct encoding a gene product into a cell, for example, an exogenous nucleic acid construct comprising a cDNA encoding a gene product under the control of a heterologous promoter. In some embodiments, the exogenous nucleic acid construct is integrated into a specific locus by, for example, HDR-mediated gene editing, as described in more detail elsewhere herein. Methods for achieving loss of function editing and methods for achieving increased expression of gene products, such as by RNA-guided nuclease technology, are well known to those of ordinary skill in the art.

[0316] Table 10 below provides some exemplary gene products, one or more of which may be overexpressed in the modified NK cells provided in some embodiments of the present disclosure: Table 10:

[0317] Table 11 below provides some exemplary target genes, one or more of which exhibit loss of function in the modified NK cells provided in some embodiments of the present disclosure. Table 11:

[0318] The present disclosure includes modified NK cells that exhibit any edits and / or increased expression of gene products listed in Tables 7 and 8 in combination, as well as any combination of such edits and / or increased expression of gene products listed in these tables. For example, it is understood that the present disclosure includes embodiments in which modified NK cells are provided, which include a single edit listed in Table 10 or Table 11, for example, loss of function of ADORA2A, or loss of function of B2M, or increased expression of HLA-G, etc. It is understood that the present disclosure includes embodiments in which modified NK cells are provided, which include a single edit listed in Table 11 and increased expression of gene products listed in Table 10, for example, loss of function of ADORA2A or loss of function of B2M; and increased expression of HLA-G. It is also understood that the present disclosure includes embodiments in which modified NK cells are provided, which include two or more edits listed in Table 11, and increased expression of a single gene product listed in Table 10. It is also understood that the disclosure includes embodiments in which modified NK cells are provided that comprise a single edit listed in Table 11 and increased expression of two or more gene products listed in Table 10. It is also understood that the disclosure includes embodiments in which modified NK cells are provided that comprise two or more edits listed in Table 11 and increased expression of two or more gene products listed in Table 10.

[0319] To illustrate some of the configurations of modified NK cells included in the present disclosure, some exemplary non-limiting embodiments are provided below and elsewhere herein. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A. In some embodiments, modified NK cells are provided, which exhibit loss of function of B2M. In some embodiments, modified NK cells are provided, which exhibit loss of function of TGFbRII. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A and B2M. In some embodiments, modified NK cells are provided, which exhibit gain of function of hnCD16. In some embodiments, modified NK cells are provided, which exhibit gain of function of CAR, such as CAR binding to Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1 or different targets, for example, as disclosed herein or otherwise known in the art. In some embodiments, modified NK cells are provided, which exhibit gain of function of HLA-G. In some embodiments, modified NK cells are provided, which exhibit gain of function of single-chain IL-15 / IL-15R fusion protein. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A and B2M and gain of function of hnCD16. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A and B2M and gain of function of CAR, such as CAR binding to Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1 or different targets, for example, as disclosed herein or otherwise known in the art. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A and B2M and gain of function of HLA-G. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A and B2M and gain of function of single-chain IL-15 / IL-15R fusion protein. In some embodiments, modified NK cells are provided, which exhibit loss of function of ADORA2A and B2M, and gain of function of hnCD16 and dominant negative TGFbRII variants. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of CAR (e.g., CAR binding to Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1 or a different target, e.g., as disclosed herein or otherwise known in the art) and dominant negative TGFbRII variants. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of HLA-G and dominant negative TGFbRII variants.In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of single-chain IL-15 / IL-15R fusion protein and dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A, CISH and B2M, and gain of function of hnCD16 and HLA-G. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A and B2M, and gain of function of single-chain IL-15 / IL-15R fusion protein, HLA-G and dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of hnCD16 and dominant negative TGFbRII variant. In some embodiments, modified NK cells are provided, which exhibit loss of function of TIGIT and B2M, and gain of function of CAR (e.g., CAR binding to Her2, EGFR, alpha folate receptor, CEA, cMET, MUC1, mesothelin, ROR1 or different targets, e.g., as disclosed herein or otherwise known in the art) and dominant negative TGFbRII variants. In some embodiments, modified NK cells are provided, which exhibit loss of function of TIGIT and B2M, and gain of function of HLA-G and dominant negative TGFbRII variants. In some embodiments, modified NK cells are provided, which exhibit loss of function of TIGIT and B2M, and gain of function of single-chain IL-15 / IL-15R fusion protein and dominant negative TGFbRII variants. In some embodiments, modified NK cells are provided, which exhibit loss of function of TIGIT, CISH and B2M, and gain of function of hnCD16 and HLA-G. In some embodiments, modified NK cells are provided that exhibit loss of function of TIGIT and B2M, and gain of function of single-chain IL-15 / IL-15R fusion protein, HLA-G, and dominant negative TGFbRII variants. In some embodiments, modified NK cells are provided that exhibit loss of function of ADORA2A, TIGIT, PD-1, and B2M, and gain of function of single-chain IL-15 / IL-15R fusion protein, HLA-G, and dominant negative TGFbRII variants.

[0320] It should be understood that the exemplary embodiments provided herein are intended to illustrate some examples of NK cells included in the present disclosure. For the sake of brevity, additional configurations are not described in detail here, but based on this disclosure, such embodiments will be immediately obvious to those skilled in the art. Chimeric Antigen Receptor (CAR)

[0321] As used herein, the term "chimeric antigen receptor" or "CAR" refers to a receptor protein that has been modified to give the cell expressing the CAR a new ability to target a specific protein. In the context of the present disclosure, NK cells modified to include a CAR can be used for immunotherapy against a target and destroy cells associated with a disease or disorder, such as cancer cells.

[0322] Purpose CAR includes but is not limited to CAR targeting mesothelin, EGFR, HER2 and / or MICA / B. So far, CAR T cell therapy targeting mesothelin has shown early efficacy evidence in Phase I clinical trials of subjects with mesothelioma, non-small cell lung cancer and breast cancer (NCT02414269). Similarly, CAR targeting EGFR, HER2 and MICA / B showed promise in early studies (see, e.g., Li et al. (2018), Cell Death & Disease [Cell Death and Disease], 9 (177); Han et al. (2018) Am. J. Cancer Res. [American Journal of Cancer Research], 8 (1): 106-119; and Demoulin 2017) Future Oncology [Future Oncology], 13 (8); the entire contents of each of which are expressly incorporated herein by reference).

[0323] CAR is well known to those of ordinary skill in the art, and includes, for example, those described in the following: WO 13 / 063419 (mesothelin), WO 15 / 164594 (EGFR), WO 13 / 063419 (HER2), WO 16 / 154585 (MICA and MICB), the entire contents of each of which are expressly incorporated herein by reference. Any suitable CAR, NK-CAR or other binding agent for targeting cells (e.g., NK cells, such as cells associated with a disease or disorder) can be expressed in modified NK cells provided herein. Exemplary CAR and binding agents include, but are not limited to, binding to the following CAR and adhesives: BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptides (i.e., E7), EBV viral peptides, CD70, WT1, CEA, EGFRvIII, IL13Rα2, and GD2, CA125, CD7, EpCAM, Muc16, CD30. Based on the present disclosure and the general knowledge in the art, it is obvious to those skilled in the art that other suitable CARs and binding agents for the modified NK cells provided herein are used. These other suitable CARs include Davies and Maher, Adoptive T-cell Immunotherapy of Cancer Using Chimeric Antigen Receptor-Grafted T Cells [Adoptive T Cell Immunotherapy of Cancer Using Chimeric Antigen Receptor-Grafted T Cells], Archivum Immunologiae et Therapiae Experimentalis 58 (3): Those described in Figure 3 of 165-78 (2010), the entire contents of which are incorporated herein by reference.

[0324] In some embodiments, the modified NK cells may comprise CAR and CD16 variants (e.g., hnCD16), or comprise CAR and no CD16 variants. Any cell expressing CD16 or its variants will be suitable for combination therapy with monoclonal antibodies (e.g., monoclonal antibodies used in cancer treatment) or Fc fusion proteins targeting pathological cells. Knock-in and knock-out

[0325] In some embodiments, the modified cells may express one or more of the following: exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, loss of function of TGFβR2, exogenous DN-TGFβR2, and / or loss of function of ADORA2A. In yet another embodiment, the modified cells may comprise loss of function of B2M, exogenous HLA-G, loss of function of CIITA, loss of function of PD1, loss of function of TIGIT, or loss of function of CISH.

[0326] In some embodiments, the modified cells may express one or more of the following: exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0327] In some embodiments, the modified cells may express one or more of the following: exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, soluble MICA and / or MICB, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0328] In some embodiments, the modified cells may express one or more of the following: exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, exogenous IL-12, exogenous IL-18, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0329] In some embodiments, the modified cells may express one or more of the following: exogenous hnCD16, exogenous IL-15, exogenous IL-15RA, exogenous HLA-G, exogenous DN-TGFβR2, exogenous IL-12, exogenous IL-18, soluble MICA and / or MICB, loss of function of TGFβR2, loss of function of B2M, loss of function of PD1, loss of function of TIGIT, and / or loss of function of ADORA2A.

[0330] As used herein, the term "expression" refers to the process of producing a polypeptide, including transcription and translation. Expression can be increased by, for example, a variety of methods, including: increasing the number of genes encoding polypeptides, increasing the transcription of genes (e.g., by placing the genes under the control of constitutive promoters), increasing the translation of genes, knocking out competitive genes, or combinations and / or other methods of these.

[0331] As used herein, the term "knock-in" refers to the addition of a target gene to a genetic locus of a cell.

[0332] As used herein, the term "knockout" refers to an inactivating mutation in a target gene, wherein the product of the target gene comprises a loss of function.

[0333] As used herein, the term "loss of function" refers to an inactivating mutation in a target gene, wherein the gene product has less or no function (partial or complete inactivation). As used herein, the term "loss of function" refers to an inactivating mutation in a target gene, wherein the gene product has no function (complete inactivation).

[0334] As used herein, the term "hnCD16a" refers to a high affinity, non-cleavable variant of CD16, a low affinity Fcγ receptor involved in antibody-dependent cellular cytotoxicity (ADCC). Typically, CD16 is cleaved during ADCC - hnCD16CAR does not undergo this cleavage, thereby maintaining the ADCC signal longer. In some embodiments, hnCD16a is disclosed in Blood 2016 128:3363, the entire contents of which are expressly incorporated herein by reference.

[0335] As used herein, the term "MICA / B" refers to MHC class I chain-related proteins A (MICA) and B (MICB), which are polymorphic proteins induced during cell stress, damage or (malignant) transformation, and act as 'kill me' signals through natural killer group 2 member D receptors expressed on cytotoxic lymphocytes. MICA / B is considered to be non-constitutively expressed by healthy normal cells, but expression has been reported for most tumor types. An exemplary sequence of MICA is provided in NG_034139.1, and an exemplary sequence of MICB is provided in NG_021405.1.

[0336] As used herein, the term "AAVSI" refers to adeno-associated integration site 1.

[0337] As used herein, the term "2A" refers to a self-cleaving 2A peptide.

[0338] As used herein, the term "TGFβRII" or "TGFβR2" refers to a transmembrane protein with a protein kinase domain that forms a heterodimeric complex with TGF-β receptor type-1 and binds TGF-β. The receptor / ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of genes associated with cell proliferation, cell cycle arrest, wound healing, immunosuppression, and tumorigenesis. Exemplary sequences of TGFβRII are listed in KR 710923.1, NM_001024847.2, and NM_003242.5.

[0339] As used herein, the term "DN-TGFβRII" refers to a dominant negative TGFβ receptor II (which can be expressed by a NK-specific promoter). TGFβRII plays an important role in T cell differentiation, and KO in iPSCs will prevent CD34+ differentiation; KO will have to be done later, but DN can be expressed by a NK-specific promoter (turned on after CD34+ differentiation). In some embodiments, DN-TGFβRII is disclosed in: Immunity. 2000 Feb; 12(2): 171-81, the entire contents of which are expressly incorporated herein by reference.

[0340] The strategies that tumor cells use to protect themselves from the effects of TGF-β can be manipulated to mask tumor-specific cytotoxic T lymphocytes (CTLs) from the inhibitory effects of TGF-β secreted by tumors. Tumor-specific CTLs expressing dominant negative TGFβ receptor II (e.g., TGFβRIIDNR sequences) have selective functional and survival advantages over unmodified CTLs in the presence of TGF-β secreting tumors (Bollard et al., 2002 Blood. May 1, 2002; 99(9):3179-87; incorporated herein by reference in its entirety). Therefore, in some embodiments, the modified cells of the present disclosure express DN-TGFβRII constructs. In some embodiments, the DN-TGFβRII construct is driven by the EF1a long promoter. In some embodiments, the DN-TGFβRII construct is knocked into the ADORA2A locus using Streptococcus pyogenes gRNA. In some embodiments, the DN-TGFβRII construct comprises a TGFβRIIDNR sequence, followed by a 2A sequence, and further followed by a truncated EGFR sequence (EGFRt) to enable tracking of cells that effectively express the construct. In some embodiments, the DN-TGFβRII construct is produced as a long single-stranded DNA molecule. In some embodiments, the DN-TGFβRII construct is delivered to cells in RNP. In some embodiments, the DN-TGFβRII construct is delivered to cells by AAV delivery (e.g., by AAV6).

[0341] As used herein, the term "neural cell adhesion molecule" (NCAM), also known as CD56, refers to a homophilic binding glycoprotein expressed on the surface of neurons, glia and skeletal muscle and certain cells of the hematopoietic system. The expression of CD56 is associated with natural killer cells, but is not limited thereto. Exemplary sequences of NCAM are provided in NM_000615.6, NM_181351.4, NM_001076682.3, NM_001242608.1, and NM_001242607.1.

[0342] As used herein, the term "CISH" refers to a cytokine-inducible SH2-containing protein, see, e.g., Delconte et al., Nat Immunol. 2016 Jul; 17(7):816-24; incorporated herein by reference in its entirety. An exemplary sequence of CISH is set forth as NG_023194.1.

[0343] As used herein, the term "IL-15 / IL15RA" or "interleukin-15" (IL-15) refers to a cytokine that has structural similarity to interleukin-2 (IL-2). Like IL-2, IL-15 binds to and signals through a complex consisting of the IL-2 / IL-15 receptor β chain (CD122) and the common γ chain (γ-C, CD132). Following infection by one or more viruses, mononuclear phagocytes (and some other cells) secrete IL-15. This cytokine induces cell proliferation of natural killer cells; i.e., cells of the innate immune system whose primary role is to kill virus-infected cells. The IL-15 receptor α (IL15RA) specifically binds IL15 with very high affinity and is able to bind IL-15 independently of the other subunits. This property is shown to allow IL-15 to be produced by one cell, internalized by another cell, and then presented to third-party cells. IL15RA has been reported to increase cell proliferation and expression of the apoptosis inhibitors BCL2L1 / BCL2-XL and BCL2. An exemplary sequence for IL-15 is provided in NG_029605.2, and an exemplary sequence for IL-15RA is provided in NM_002189.4.

[0344] IL-15 is a key cytokine that promotes NK cell growth and homeostasis maintenance of memory T cells. IL-15 and its receptor chain IL-15Ra are essential for NK survival and do not stimulate regulatory T cells. IL-15 / IL-15Ra binds to the β and γ subunits of the IL-2 receptor, thereby activating JAK1 / 3 and STAT5. In some embodiments, the modified cells (e.g., NK cells) disclosed herein express exogenous IL-15 / IL-15Ra. In some embodiments, exogenous IL-15 / IL-15Ra is expressed as a membrane-bound IL15.IL15Ra complex, as described in Imamura et al., Blood. 2014 Aug 14; 124(7): 1081-8 and Hurton LV et al., PNAS, 2016; incorporated herein by reference in their entirety. In some embodiments, exogenous IL-15 / IL-15Ra is expressed as a soluble IL15Ra.IL15 complex, as described in Mortier E et al., JBC 2006; Bessard A, Mol Cancer Ther [Molecular Cancer Therapeutics] 2009; and Desbois M, JI 2016; incorporated herein by reference in its entirety. In some embodiments, the modified cells (e.g., NK cells) of the present disclosure express membrane-bound IL15.IL15Ra complexes and soluble IL15Ra.IL15 complexes. In some embodiments, the modified cells (e.g., NK cells) of the present disclosure express membrane-bound forms of the IL15.IL15Ra complex with a cleavable linker. Knockout of CISH is associated with further promotion of IL-15 signaling, as described in Delconte P, Nat Immunol [Natural Immunology] 2016; incorporated herein by reference in its entirety. In some embodiments, the modified cells (e.g., NK cells) of the present disclosure express loss of function of CISH. In some embodiments, the modified cells (eg, NK cells) of the disclosure express exogenous IL-15 / IL-15Ra and loss of function of CISH.

[0345] As used herein, the term "ADORA2A" refers to a member of the superfamily of adenosine A2A receptor encoding guanine nucleotide binding protein (G protein) coupled receptors (GPCRs), which are subdivided into classes and subtypes. These receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. The protein is an adenosine receptor of the A2A subtype, using adenosine as a preferred endogenous agonist, preferentially interacting with the G (s) and G (olf) families of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, brain and kidney blood flow, immune function, pain regulation and sleep. It is implicated in pathophysiological conditions, such as inflammatory diseases and neurodegenerative disorders. An exemplary sequence of ADORA2a is provided in NG_052804.1.

[0346] As used herein, the term "B2M" (β2 microglobulin) refers to a serum protein found associated with the major histocompatibility complex (MHC) class I heavy chain on the surface of almost all nucleated cells. The protein has a predominantly β-pleated sheet structure and can form amyloid fibrils under some pathological conditions. The encoded antimicrobial protein exhibits antibacterial activity in amniotic fluid. An exemplary sequence of B2M is set forth as NG_012920.2.

[0347] As used herein, the term "CD32B" refers to the low affinity immunoglobulin gamma Fc region receptor II-b protein, which is encoded by the FCGR2B gene in humans. See, e.g., Rankin-CT et al., CD32B, the human inhibitory Fc-gamma receptor IIB, as a target for monoclonal antibody therapy of B-cell lymphoma. Blood 2006 108(7):2384-91, the entire contents of which are incorporated herein by reference.

[0348] As used herein, the term "CD47", sometimes also referred to as "integrin-associated protein" (IAP), refers to a transmembrane protein encoded by the CD47 gene in humans. CD47 belongs to the immunoglobulin superfamily, is a partner with membrane integrins, and also binds to ligands thrombospondin-1 (TSP-1) and signal regulatory protein α (SIRPα). CD47 serves as a signal for macrophages, allowing CD47-expressing cells to escape macrophage attack. See, e.g., Deuse-T et al., Nature Biotechnology [Natural Biotechnology] 2019 37: 252-258, the entire contents of which are incorporated herein by reference.

[0349] As used herein, the term "HLA-E" refers to the HLA class I histocompatibility antigen, alpha chain E, sometimes also referred to as MHC class I antigen E. In humans, HLA-E protein is encoded by the HLA-E gene. Human HLA-E is a non-classical MHC class I molecule characterized by limited polymorphism and lower cell surface expression than its classical paralogs. The class I molecule is a heterodimer composed of a heavy chain and a light chain (β-2 microglobulin). The heavy chain is anchored in the membrane. HLA-E binds to a restricted subset of peptides derived from the leader peptides of other class I molecules. HLA-E expressing cells escape allogeneic responses and lysis by NK cells. See, e.g., Geornalusse-G et al., Nature Biotechnology [Nature Biotechnology] 2017 35 (8), the entire contents of which are incorporated herein by reference. An exemplary sequence of the HLA-E protein is provided in NM_005516.6.

[0350] In some embodiments, two or more HLA class II histocompatibility antigen α chain genes and / or two or more HLA class II histocompatibility antigen α chain genes are knocked out in the modified lymphocytes provided herein, for example, by genome editing. For example, in some embodiments, two or more HLA class II histocompatibility antigen α chain genes selected from HLA-DQA1, HLA-DRA, HLA-DPA1, HLA-DMA, HLA-DQA2, and HLA-DOA are knocked out. For example, in some embodiments, two or more HLA class II histocompatibility antigen β chain genes selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5 are knocked out. See, e.g., Crivello et al., J Immunol. 2019, Jan, ji1800257; DOI: https: / / doi.org / 10.4049 / jimmunol.1800257 , the entire contents of which are incorporated herein by reference.

[0352] As used herein, the term "HLA-G" refers to a non-classical class I heavy chain paralog of HLA. The class I molecule is a heterodimer consisting of a heavy chain and a light chain (β-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal placental cells. HLA-G is a ligand for the NK cell inhibitory receptor KIR2DL4, so through the trophoblast, the expression of this HLA defends it against NK cell-mediated death. See, for example, Favier et al., Tolerogenic Function of Dimeric Forms of HLA-G Recombinant Proteins: A Comparative Study In Vivo [HLA-G recombinant protein dimer form tolerance original function: in vivo comparative study] PLOS One [Public Library of Science Comprehensive] 2011, the entire contents of which are incorporated herein by reference. An exemplary sequence of HLA-G is set forth as NG_029039.1.

[0353] As used herein, the term "CIITA" refers to a protein located in the nucleus that acts as a positive regulator of class II major histocompatibility complex gene transcription and is referred to as the "master control factor" for expressing these genes. The protein also binds GTP and uses GTP to promote its own transport into the nucleus. Once in the nucleus, it does not bind DNA, but uses intrinsic acetyltransferase (AT) activity to act in a coactivator-like manner. Mutations in this gene have been associated with naked lymphocyte syndrome type II (also referred to as hereditary MHC class II deficiency or HLA class II deficiency combined immunodeficiency), and susceptibility to rheumatoid arthritis, multiple sclerosis, and possible myocardial infarction increases. See, e.g., Chang et al., J ExpMed [Experimental Medicine Journal] 180: 1367-1374; and Chang et al., Immunity [immunity]. February 1996; 4 (2): 167-78, the entire contents of each of which are incorporated herein by reference. The exemplary sequence of CIITA is set forth as NG_009628.1.

[0354] As used herein, the term "PD1" programmed cell death protein 1, also known as CD279 (differentiation cluster 279), refers to a protein found on the surface of cells that has the following effects: regulating the immune system's response to human cells by downregulating the immune system, and promoting self-tolerance by inhibiting T cell inflammatory activity. This can prevent autoimmune diseases, but it can also prevent the immune system from killing cancer cells. PD-1 is an immune checkpoint that guards against autoimmunity through two mechanisms. First, it promotes apoptosis (programmed cell death) of antigen-specific T cells in lymph nodes. Secondly, it reduces the apoptosis of regulatory T cells (anti-inflammatory, suppressive T cells). The exemplary sequence of PD1 is set forth as NM_005018.3.

[0355] As used herein, the term "TIGIT" refers to a member of the PVR (poliovirus receptor) family of protein immunoglobulins. The product of this gene is expressed on several types of T cells, including follicular B helper T cells (TFH). The protein has been shown to bind to PVR with high affinity; it is believed that this binding helps to assist the interaction between TFH and dendritic cells to regulate T cell-dependent B cell responses. An exemplary sequence of TIGIT is set forth in NM_173799.4.

[0356] As used herein, the term "NLRC5" refers to a NOD-like receptor family 5 intracellular protein containing a CARD domain, which plays a role in the immune system. NLRC5 is a pattern recognition receptor potentially implicated in innate immunity to viruses by regulating interferon activity. An exemplary sequence of NLRC5 is set forth as NM_032206.4.

[0357] As used herein, the term "CTLA4" refers to a member of the immunoglobulin superfamily that transmits inhibitory signals to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. An exemplary sequence of CTLA4 is set forth as AF414120.1.

[0358] As used herein, the term "LAG3" refers to lymphocyte activation protein 3, which belongs to the Ig superfamily and contains four extracellular Ig-like domains. An exemplary sequence of LAG3 is set forth as NM_002286.6.

[0359] As used herein, the term "CBLB" refers to an E3 ubiquitin-protein ligase that promotes proteosome-mediated protein degradation by transferring ubiquitin from an E2 ubiquitin conjugating enzyme to a substrate. The encoded protein is involved in the regulation of immune responses by limiting activation of the T cell receptor, the B cell receptor, and the high affinity immunoglobulin epsilon receptor. An exemplary sequence of CBLB is set forth as KR 709533.1.

[0360] As used herein, the term "NKG2A" refers to a protein belonging to the killer cell lectin-like receptor family, also known as the NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This protein family is characterized by the presence of type II membrane orientation and C-type lectin domains. The protein forms a complex with another family member, KLRD1 / CD94, and is implicated in recognizing MHC class I HLA-E molecules in NK cells. See, e.g., Kamiya-T et al., J ClinInvest [Clinical Research Journal] 2019 https: / / doi.org / 10.1172 / JCI123955, the entire contents of which are incorporated herein by reference. An exemplary sequence of NKG2A is set forth as AF461812.1.

[0361] As used herein, the term "CCR5" refers to a member of the beta chemokine receptor family, which is predicted to be a seven-transmembrane protein similar to a G protein-coupled receptor. The protein is expressed by T cells and macrophages and is known to be an important co-receptor for macrophage-tropic viruses (including HIV) to enter host cells. An exemplary sequence of CCR5 is set forth as U54994.1.

[0362] As used herein, the term "SOCS" refers to a family of genes involved in inhibiting the JAK-STAT signaling pathway.

[0363] As used herein, the term "BIM" refers to a pro-apoptotic member of the BCl-2 protein family, which interacts with other members of the BCL-2 protein family (including BCL2, BCL2L1 / BCL-X(L) and MCL1) and acts as an apoptosis activator.

[0364] As used herein, the term "FAS" refers to a member of the TNF receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death.

[0365] As used herein, the term "GITR" refers to tumor necrosis factor receptor superfamily member 18 (TNFRSF18), also known as activation-inducible TNFR family receptor (AITR) or glucocorticoid-induced TNFR-related protein. It is involved in the interaction between activated T lymphocytes and endothelial cells and in the regulation of T cell receptor-mediated cell death.

[0366] As used herein, the term "sortilin" refers to the VPS10-related sortilin family of proteins.

[0367] As used herein, the term "TIM3" refers to T cell immunoglobulin and mucin domain-containing protein-3 (TIM-3), which is encoded by the HAVCR2 gene in humans.

[0368] As used herein, the term "CD96" or "TACTILE" refers to a type I membrane protein that plays a role in the adhesion interactions of activated T and NK cells during the late stages of the immune response.

[0369] As used herein, the term "IL1R8" refers to a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory protein.

[0370] As used herein, the terms "KIR2DL1," "KIR2DL2," and "KIR2DL3" refer to killer cell immunoglobulin-like receptors (KIRs), which are transmembrane glycoproteins expressed by natural killer cells and T-cell subsets.

[0371] As used herein, the term "CDK8" refers to a member of the cyclin-dependent protein kinase (CDK) family that functions as a regulator of cell cycle progression.

[0372] As used herein, the term "CXCR3" refers to a G protein-coupled receptor that is selective for three chemokines called CXCL9 / Mig (monokine induced by interferon-g), CXCL10 / IP10 (interferon-g inducible 10 kDa protein), and CXCL11 / I-TAC (interferon-inducible T cell alpha-chemoattractant).

[0373] As used herein, the term "CCR7" refers to a member of the G protein-coupled receptor family. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes.

[0374] As used herein, the term "EP4" refers to a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T cell factor signaling.

[0375] As used herein, the term "IL-2" refers to interleukin-2, a secreted cytokine important for the proliferation of T and B lymphocytes.

[0376] As used herein, the term "IL-12" refers to interleukin-12, a cytokine that acts on T cells and natural killer cells.

[0377] As used herein, the term "IL-18" refers to interleukin-18, a pro-inflammatory cytokine primarily involved in polarized T helper 1 (Th1) and natural killer (NK) cell immune responses.

[0379] As used herein, the term "CXCR1" refers to a member of the G-protein coupled receptor family. This protein is a receptor for interleukin 8 (IL8).

[0380] As used herein, the term "CX3CR1" refers to a transmembrane protein and chemokine involved in leukocyte adhesion and migration.

[0381] As used herein, the term "mTRAIL" refers to a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein preferentially induces apoptosis in transformed and tumor cells.

[0382] As used herein, the term "TOSO" refers to the Fc fragment of the IgM receptor

[0383] As used herein, the term "CD16" refers to the receptor for the Fc portion of immunoglobulin G, and is involved in the removal of antigen-antibody complexes from the circulation as well as other antibody-dependent responses.

[0384] In some embodiments, modified cells are provided herein, which exhibit a loss of function of TRAC. The term "TRAC" refers to a T cell receptor alpha subunit (constant region) encoded by the TRAC locus. Cells exhibiting a loss of function of TRAC do not express T cell receptors (TCR). In some embodiments, modified cells are provided herein, for example, pluripotent or multipotent stem cells or their differentiated daughter cells (e.g., iNK cells), derived from cells expressing TCR or derived from cells with rearranged endogenous TCR loci, for example, derived from T cells. In some embodiments, such cells include modifications that achieve a loss of function of TRAC, and therefore do not express functional TCR. Based on this disclosure, suitable methods and compositions for achieving a loss of function of TRAC are apparent to those of ordinary skill in the art. These methods and compositions include, but are not limited to, those disclosed in PCT application PCT / US2015 / 026504, entitled “CRISPR-CAS-related methods, compositions and components for cancer immunotherapy”; PCT application PCT / US2016 / 024353, entitled “CRISPR-CAS-related methods, compositions and components”; and PCT application PCT / US2017 / 020598, entitled “CRISPR-CPF1-related methods, compositions and components for cancer immunotherapy”; the entire contents of each of which are incorporated herein by reference.

[0385] The present disclosure specifically includes variants of the above-mentioned genes and CARs, including variants with at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% percent identity to the gene sequences identified above. As used herein, the term "percentage (%) sequence identity" or "percentage (%) identity" (also including "homology") is defined as the percentage of amino acid residues or nucleotides in the candidate sequence that are identical to the amino acid residues or nucleotides in the reference sequence after alignment and introduction of gaps (if necessary) to achieve maximum percentage sequence identity and without considering any conservative substitutions as part of sequence identity. In addition to manual work, optimal alignment of compared sequences can be generated by the following: the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. [Advances in Applied Mathematics] 2, 482; the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. [Journal of Molecular Biology] 48, 443; the similarity search method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 85, 2444; or computer programs that use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLASTN and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0386] Knock-ins and knock-outs can be performed by genome editing techniques known to those skilled in the art, including CRISPR / Cas technology. Single cutting as well as multiple editing strategies are suitable for achieving the desired product configurations provided herein, and such strategies are described herein or otherwise known to those of ordinary skill in the art.

[0387] In some embodiments, exemplary modified cells (e.g., modified pluripotent cells or their differentiation progeny, such as iNK cells or other modified lymphocyte types) are assessed for their ability to escape the immune system of a non-autologous host (e.g., a patient in need of immunotherapy). In some embodiments, this assessment includes in vitro assays. Suitable in vitro assays for this assessment are known to those of ordinary skill in the relevant art, and include but are not limited to mixed lymphocyte reactivity (MLR) assays. This assay and other suitable assays are described in, for example, Abbas et al., Cellular and Molecular Immunology [Cellular and Molecular Immunology], 7th edition, ISBN 9781437735734, the entire contents of which are incorporated herein by reference. In view of this disclosure, other suitable assays will be apparent to technicians. How to use

[0388] A variety of diseases can be improved by introducing the modified cells of the present invention into a subject. Examples of diseases include, but are not limited to, cancer, including, but are not limited to, solid tumors, including, but are not limited to, tumors of the brain, prostate, breast, lung, colon, uterus, skin, liver, bone, pancreas, ovary, testis, bladder, kidney, head, neck, stomach, cervix, rectum, larynx, or esophagus; and hematologic malignancies, including, but are not limited to, acute and chronic leukemias, lymphomas, multiple myeloma, and myelodysplastic syndrome.

[0389] Particular embodiments of the invention relate to methods for treating a subject in need by administering to the subject a composition comprising any of the cells described herein. In particular embodiments, the terms "treating / treatment" and the like as used herein generally mean obtaining the desired pharmacological and / or physiological effects. The effect may be preventive in terms of preventing a disease in whole or in part, and may be therapeutic in terms of partial or complete cure of the disease and / or the adverse effects attributable to the disease. As used herein, "treatment" encompasses the treatment of any disease in a mammal, and includes: preventing the disease from occurring in a subject who may be susceptible to the disease but has not yet been diagnosed with the disease; inhibiting the disease, i.e., preventing its development; or alleviating the disease, i.e., causing the disease to regress. The therapeutic agent or composition may be administered before, during, or after the onset of the disease or injury. Treatment of an ongoing disease to stabilize or reduce adverse clinical symptoms in a patient is of particular interest.

[0390] In a particular embodiment, the subject suffers from a disease, illness and / or injury that can be treated, improved and / or improved by cell therapy. Some embodiments encompass the following, the subject requiring cell therapy is a subject suffering from damage, disease or illness, and cell therapy (such as a therapy in which a cell material is applied to a subject) can treat, improve, improve and / or reduce the severity of at least one symptom associated with the damage, disease or illness. Some embodiments encompass the following, the subject requiring cell therapy includes but is not limited to a candidate for bone marrow or stem cell transplantation, a subject receiving chemotherapy or radiation therapy, a subject suffering from hyperproliferative disorders or cancer (such as hyperproliferative disorders or cancer of the hematopoietic system) or a subject at risk of suffering from this, a subject suffering from a tumor (such as a solid tumor) or a subject at risk of developing this, a subject suffering from a viral infection or a disease associated with a viral infection or a subject at risk of suffering from this.

[0391] Therefore, the present invention further provides a pharmaceutical composition comprising a hematopoietic lineage cell derived from a pluripotent cell prepared by the methods and compositions disclosed herein, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable medium. In some embodiments, the pharmaceutical composition comprises T cells derived from pluripotent cells prepared by the methods and compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises NK cells derived from pluripotent cells prepared by the methods and compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises CD34 HE cells derived from pluripotent cells prepared by the methods and compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises HSCs derived from pluripotent cells prepared by the methods and compositions disclosed herein.

[0392] In addition, the present invention provides therapeutic uses of the above-mentioned pharmaceutical composition by introducing the composition into a subject suitable for adoptive cell therapy, wherein the subject suffers from an autoimmune disorder; a malignant blood disease; a solid tumor; or an infection associated with HIV, RSV, EBV, CMV, adenovirus or BK polyomavirus.

[0393] The isolated pluripotent stem cell-derived hematopoietic lineage cells may have at least 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% T cells, NK cells, NKT cells, CD34+HE cells or HSCs. In some embodiments, the isolated pluripotent stem cell-derived hematopoietic lineage cells have about 95% to about 100% T cells, NK cells, NKT cells, CD34+HE cells or HSCs. In some embodiments, the present invention provides a pharmaceutical composition having purified T cells, NK cells, NKT cells, CD34+HE cells or HSCs, such as a composition having an isolated cell population of about 95% T cells, NK cells, NKT cells, CD34+HE cells or HSCs for treating a subject in need of cell therapy.

[0394] In some embodiments, the pharmaceutical composition comprises an isolated cell population of pluripotent stem cell-derived hematopoietic lineage cells, wherein the cell population has less than about 0.1%, 0.5%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, or 30% iPSC-derived T cells, NK cells, NKT cells, CD34+HE cells, or HSCs. In some embodiments, the isolated cell population of derived hematopoietic lineage cells may have more than about 0.1%, 0.5%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, or 30% T cells, NK cells, NKT cells, CD34+HE cells, or HSCs. In other embodiments, the isolated cell population of derived hematopoietic lineage cells may have about 0.1% to about 1%, about 1% to about 3%, about 3% to about 5%, about 10%-about 15%, about 15%-20%, about 20%-25%, about 25%-30%, about 30%-35%, about 35%-40%, about 40%-45%, about 45%-50%, about 60%-70%, about 70%-80%, about 80%-90%, about 90%-95%, or about 95% to about 100% T cells, NK cells, NKT cells, CD34+ HE cells, or HSCs.

[0395] In particular embodiments, the derived hematopoietic lineage cells may have about 0.1%, about 1%, about 3%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, or about 100% T cells, NK cells, NKT cells, CD34+ HE cells, or HSCs.

[0396] As will be appreciated by those of ordinary skill in the art, both autologous and allogeneic immune cells can be used for cell therapy. Autologous cell therapy can reduce infection, reduce the probability of GvHD and rapidly reconstitute immunity. Allogeneic cell therapy can have an immune-mediated graft-versus-malignancy (GVM) effect and reduce relapse rates. Based on the specific conditions of the patient or subject in need of cell therapy, those of ordinary skill in the art will be able to determine which specific therapy to administer.

[0397] In a specific embodiment, the derived hematopoietic lineage cells of the pharmaceutical composition of the present invention are allogeneic to the subject. In a specific embodiment, the derived hematopoietic lineage cells of the pharmaceutical formulation of the present invention are autologous to the subject. For autologous transplantation, the isolated cell population of the derived hematopoietic lineage cells is fully or partially HLA matched to the patient. In another embodiment, the derived hematopoietic lineage cells are not HLA matched to the subject.

[0398] The derived hematopoietic lineage cells provided by the present invention can be administered to a subject without ex vivo or in vitro expansion prior to administration. In a specific embodiment, the separated cell population of the derived hematopoietic lineage cells is conditioned and treated ex vivo with one or more treatment agents to obtain immune cells with improved therapeutic potential. The conditioned derived hematopoietic lineage cells can be washed to remove one or more treatment agents, and the improved cell population is administered to the patient without further in vitro expansion of the cell population.

[0399] In other embodiments, the invention provides an isolated cell population of derived hematopoietic lineage cells that is amplified prior to conditioning an isolated cell population or subpopulation of T lymphocytes with one or more treatment agents. An isolated cell population of derived hematopoietic lineage cells can be recombinantly generated to express TCR, CAR or other proteins.

[0400] For genetically engineered derived hematopoietic lineage cells expressing recombinant TCRs or CARs, either before or after genetic modification of the cells, these cells can be activated and expanded using methods described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005. cancer

[0401] Cancers that are suitable therapeutic targets for the present disclosure include cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, eye, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testicles, tongue, or uterus. Furthermore, the cancer may specifically be of the following histological types, although it is not limited to these: malignant neoplasms; carcinoma; undifferentiated carcinoma; giant cell carcinoma and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatricoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; mixed hepatocellular and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma of adenomatous polyps; adenocarcinoma of familial polyposis; solid carcinoma; malignant carcinoid; bronchioalveolar adenocarcinoma; papillary adenocarcinoma; chromophobecarcinoma; acidophil carcinoma; oxyphilicadenocarcinoma; basophilic granulocyte carcinoma; clear cell adenocarcinoma; granulocytic carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma sclerosing carcinoma; adrenocortical carcinoma; endometrioid carcinoma; carcinoma of skin appendages; apocrine adenocarcinoma; sebaceous gland carcinoma; cerumen gland carcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma with squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma cell tumor; malignant granulocytoma; malignant androblastoma; sertoli cell carcinoma; malignant Leydig cell tumor; malignant lipid cell tumor malignant paraganglioma; malignant extramammary paraganglioma; pheochromocytoma; glomus tumor; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma of giant pigmented nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mixed tumor of Muller; Wilms' tumor; hepatoblastoma; carcinosarcoma; malignant stromal tumor; malignant Brenner's tumor; malignant phyllodes tumor of the breast; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; malignant ovarian thyroid tumor; choriocarcinoma; malignant mesonephroblastoma; angiosarcoma; malignant hemangioendothelioma; Kaposi's sarcoma; malignant hemangiopericytoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma;malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma; malignant odontogenic tumor; ameloblastic odontoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroglioma; primitive neuroectodermal tumor; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant neurilemmoma; malignant granulocyte leukemia; lymphocytic leukemia; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant small lymphocytic lymphoma; malignant diffuse large cell lymphoma; malignant follicular lymphoma; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.

[0402] In some embodiments, the cancer is breast cancer. In another embodiment, the cancer is colon cancer. In another embodiment, the cancer is gastric cancer. In another embodiment, the cancer is RCC. In another embodiment, the cancer is non-small cell lung cancer (NSCLC).

[0403] In some embodiments, solid cancer indications that can be treated with the modified NK cells provided herein (alone or in combination with one or more additional cancer treatment modalities) include: bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian cancer / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical cancer and HPV+ head and neck cancer, oral cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, and soft tissue sarcoma;

[0404] In some embodiments, hematological cancer indications that can be treated with the modified NK cells provided herein (alone or in combination with one or more additional cancer treatment modalities) include: ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

[0405] As used herein, the term "cancer" (also interchangeably with the terms "hyperproliferation" and "neoplasm") refers to cells with autonomous growth capacity, i.e., abnormal states or conditions characterized by rapid proliferating cell growth. Cancerous disease states can be classified as pathological, i.e., characterizing or constituting a disease state, such as malignant tumor growth, or can be classified as non-pathological, i.e., deviating from normal but unrelated to a disease state, such as cell proliferation associated with wound repair. The term is intended to include all types of cancerous growth or carcinogenic processes, metastatic tissues or malignantly transformed cells, tissues or organs, regardless of histopathological type or invasive stage. The term "cancer" includes malignancies of various organ systems, such as those affecting the lungs, breasts, thyroid, lymph, gastrointestinal tract and urinary tract, and adenocarcinomas including the following malignancies, such as most colon cancers, renal cell carcinomas, prostate cancers and / or testicular tumors, non-small cell lung cancers, small intestinal cancers and esophageal cancers. The term "cancer" is recognized in the art and refers to malignancies of epithelial or endocrine tissues, including respiratory cancer, gastrointestinal cancer, urogenital cancer, testicular cancer, breast cancer, prostate cancer, endocrine cancer, and melanoma. Exemplary cancers include cancers formed by tissues of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term "cancer" also includes carcinosarcoma, for example, which includes malignant tumors composed of cancerous and sarcomatous tissues. "Adenocarcinoma" refers to a cancer derived from glandular tissue or a cancer in which tumor cells form a recognizable glandular structure. The term "sarcoma" is recognized in the art and refers to a mesenchymal derived malignant tumor.

[0406] Examples of cell proliferation and / or differentiation disorders of the lung include, but are not limited to, tumors such as bronchogenic carcinomas, including paraneoplastic syndromes, bronchioloalveolar carcinoma, neuroendocrine tumors such as bronchogenic carcinoma, mixed tumors, metastatic tumors, and pleural tumors, including solitary fibrous tumor (pleural fibroma) and malignant mesothelioma.

[0407] Examples of mammary cell proliferation and / or differentiation disorders include, but are not limited to, proliferative breast diseases, including, for example, epithelial hyperplasia, sclerosing adenosis, and small duct papillomas; tumors, such as stromal tumors, such as fibroadenomas, phyllodes tumors of the breast, and sarcomas, and epithelial tumors, such as large duct papillomas; breast cancer, including in situ (non-invasive) carcinoma, including ductal carcinoma in situ (including Paget's disease) and lobular carcinoma in situ, and invasive (infiltrating) carcinoma, including, but not limited to, invasive ductal carcinoma, invasive lobular carcinoma, medullary carcinoma, colloid (mucinous) carcinoma, tubular carcinoma, and invasive papillary carcinoma, and mixed malignant neoplasms. The disorder of the male breast includes, but is not limited to, male breast enlargement and carcinoma.

[0408] Examples of cell proliferation and / or differentiation disorders involving the colon include, but are not limited to, colon neoplasms, such as non-neoplastic polyps, adenomas, familial syndromes, colorectal carcinogenesis, colorectal cancer, and carcinoid tumors.

[0409] Examples of cancer or neoplastic disorders, in addition to those described above, include, but are not limited to, fibrosarcoma, myosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendothelial cell sarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, ovarian cancer, prostate cancer, uterine cancer, head and neck cancer, skin cancer, brain cancer, squamous cell carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystic fibrosis, ulcerative colitis ... Adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocarcinoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular cancer, small cell lung cancer, non-small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, leukemia, lymphoma, or Kaposi sarcoma.

[0410] In this context, useful secondary or adjunctive therapeutic agents contemplated include, but are not limited to, chemotherapeutic agents including alkylating agents such as thiotepa and Cyclophosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquinone, meturedopa, and uredopa; ethyleneimines and methylamelamines, including hexamethylmelamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylomelamine; polyacetyl groups (especially bullatacin and bullatacinone); delta-9-tetrahydrocannabinol (dronabinol, ); β-lapachone; lapachol; colchicine; betulinic acid; camptothecin (including the synthetic analogue topotecan CPT-11 (irinotecan, ), acetylcamptothecin, scopolamine, and 9-aminocamptothecin); bryostatin; callystatin; CC-1065 (including its synthetic analogs of adolesine, carzelesin, and biszelesin); podophyllotoxin; podophyllic acid; teniposide; cryptophycins (particularly cryptophycin 1 and cryptophycin 8); pyralidin; duocarmycin (including synthetic analogs, KW-2189, and CB1-TM1); eleutherobin; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards (e.g., chlorambucil), naphthyl mustard, chlorophosphamide, estramustine, ifosfamide, dichloromethyldiethylamine, mechlorethamine hydrochloride oxide hydrochloride), melphalan, nebixin, phenesterine, phenylephrine, trofosfamide, uracil nitrogen mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gamma 1I and calicheamicin omega 1I (see, e.g., Agnew, Chem. Intl. Ed. Engl., 33:183-186 (1994)). 94)); danemycins, including danemycin A; esperamicin; and neocarzinostatin chromophores and related chromoprotein enediyne antibiotic chromophores), aclarubicin, actinomycin, anthramycin, azaserine, bleomycin, cactinomycin, carabicin, carminomycin, chromomycin, actinomycin D, daunomycin, detopicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including Morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HCl liposome injection and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, mexilomycin, mitomycins (such as mitomycin C), mycophenolic acid, nogamycin, olivetomycin, peplomycin, porphyromycin, puromycin, triferric doxorubicin, rhodorubicin, streptozotocin, streptozotocin, tuberculocidin, ubenimex, netastatin, daunorubicin; antimetabolites, such as methotrexate, gemcitabine Tegafur Capecitabine Epothilone and 5-fluorouracil (5-FU); folic acid analogs such as dimethoate, methotrexate, pteropterin, and trimesat; purine analogs such as fludarabine, 6-mercaptopurine, thiopurine, and thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens such as calusterone, drostanolone propionate, cyclothiocarb, melastosane, and testolactone; antiadrenal agents such as aminoglutethimide, mitotane, and trilostane; folic acid supplements such as folinic acid (folinic acid) acid; aceglucuronide; aldophosphamide glycoside; aminolevulinic acid; anthuracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demeclocycline; diacronitrone; elformithine; elliptinium acetate; ethoxydimidine; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansine, such as maytansine and ansamitocin; mitoguanidine; mitoxantrone; mopidanmol; nitraerine; pentostatin; mustard; pirarubicin; losoxantrone; 2-ethylhydrazine; methylprocarbazine; Polysaccharide complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizoran; spirogermanium; tenuazonic acid; triethyleneimine quinone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verrucosporin A, baculosporin A, and anguidine); urethane; vindesine Dacarbazine; mannitol mustard; dibromomannitol; dibromodulan; pipobroman; gacytosine; arabinoside ("Ara-C"); thiotepa; taxanes, such as paclitaxel ABRAXANET TM ) and docetaxel Chlorambucil; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs, such as cisplatin and carboplatin; vinblastine platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine Oxaliplatin; leucovovin; vinorelbine Noxol; edatrexate; daunorubicin; aminopterin; cyclosporine, sirolimus, rapamycin, rapalog, ibandronate; topoisomerase inhibitor RFS2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; CHOP, which is the abbreviation for cyclophosphamide, doxorubicin, vinblastine and prednisolone combination therapy, and FOLFOX, which is oxaliplatin (ELOXATIN TM ) in combination with 5-FU, folinic acid; antiestrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including Tamoxifen), Raloxifene Droloxifene, 4-hydroxytamoxifen, troloxifene, keoxifene, LY117018, onapristone, and toremifene Antiprogestins; estrogen receptor downregulators (ERDs); estrogen receptor antagonists, such as fulvestrant Agents that work to suppress or shut down the ovaries, for example, luteinizing hormone-releasing hormone (LHRH) agonists such as leuprolide acetate ( and ), goserelin acetate, buserelin acetate, and triptorelin acetate; other antiandrogens, such as flutamide, nilutamide, and bicalutamide; and aromatase inhibitors, which inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazole, aminoglutethimide, megestrol acetate Exemestane Formestane, fadrozole, voruzole Letrozole and anastrozole Bisphosphonates, such as clodronate (e.g. or ), etidronate NE-58095, zoledronic acid / zoledronate Alendronate Pamidronate Tiludronate Risedronate Troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); aptamers, such as described in U.S. Pat. No. 6,344,321, which is incorporated herein by reference in its entirety; anti-HGF monoclonal antibodies (e.g., AV299 from Aveo, AMG102 from Amgen); truncated mTOR variants (e.g., CGEN241 from Compugen); protein kinase inhibitors that block mTOR-induced pathways (e.g., ARQ197 from Arqule, XL880 from Exelexis, SGX523 from SGX Pharmaceuticals, MP470 from Supergen, PF2341066 from Pfizer); vaccines, such as Vaccines and gene therapy vaccines, e.g. vaccine, Vaccines and vaccines; topoisomerase 1 inhibitors (eg, ); rmRH (e.g., ); lapatinib ditosylate (a small molecule inhibitor of ErbB-2 and EGFR dual tyrosine kinases, also known as GW572016); COX-2 inhibitors, such as celecoxib ( 4-(5-(4-methylphenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl)benzenesulfonamide; and pharmaceutically acceptable salts, acids or derivatives of any one of the foregoing.

[0411] Other compounds effective for treating cancer are known in the art, and other compounds suitable for use with the compositions and methods of the present disclosure described herein are described, for example, in "Physicians Desk Reference, 62nd ed. Oradell, N.J.: Medical Economics Co., 2008", Goodman & Gilman, "The Pharmacological Basis of Therapeutics, 11th ed. McGraw-Hill, 2005", "Remington: The Science and Practice of Pharmacy, 20th ed. Baltimore, Md.: Lippincott Williams & Wilkins, 2000.", and "The Merck Index, 14th ed. White House, N.J.: Merck Research Laboratories, 2006", the relevant portions of which are incorporated herein by reference.

[0412] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0413] Throughout the specification, unless the context requires otherwise, the words "comprise / comprises and comprising" will be understood to imply the inclusion of the stated steps or elements or groups of steps or elements, but not the exclusion of any other steps or elements or groups of steps or elements. "Consisting of" is intended to include, but is not limited to, any elements following the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory, and no other elements may be present. "Consisting essentially of" is intended to include any elements listed after the phrase, and is limited to other elements that do not interfere with or contribute to the activity or action specified by the disclosure for the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, while no other elements are optional, and may or may not be present depending on whether they affect the activity or action of the listed elements.

[0414] The above-mentioned different embodiments can be combined to provide other embodiments. All U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications cited in this specification and / or listed in the application data sheet are incorporated herein by reference in their entirety. The content of database entries, such as the NCBI nucleotide or protein database entries provided herein, are incorporated herein by reference in their entirety. If the database entry is subject to changes over time, the content of the application date of the present application is incorporated herein by reference. If necessary, the aspects of the embodiments can be modified to provide another embodiment with the concept of adopting different patents, applications and publications.

[0415] These and other changes can be made to the embodiments in light of the above detailed description. In general, in the following claims, the terms used should not be interpreted as limiting the claims to the specific embodiments disclosed in the specification and claims, but should be interpreted to include all possible embodiments along with the full scope of equivalent rights to which the claims are entitled. Therefore, the claims are not limited by this disclosure. Examples

[0416] The following examples are merely illustrative and are not intended to limit the scope or content of the present disclosure in any way. Example 1: Generation of modified iNK cells from iPS cells

[0417] The use of iPS cell technology to implement complex editing strategies and subsequent derivation of iNK cells or other lymphocytes enables, for example, the generation of iNK cells that express a CAR of interest (such as mesothelin, EGFR, HER2, and MICA / B) and / or have one or more edits from List A and / or Table 10 and one or more edits from List B and / or Table 11.

[0418] List A: Enhanced exogenous expression of CD16 variants, such as hnCD16a, a high affinity, uncleavable variant of CD16 - a low affinity Fcy receptor involved in antibody-dependent cellular cytotoxicity (ADCC). Typically, CD16 is cleaved by proteases during ADCC - hnCD16CAR does not undergo this cleavage, thereby maintaining the ADCC signal longer. Exogenous expression of IL-15 / IL 15RA Loss of function of TGFbR2, or exogenous expression of a dominant negative variant of TGFbR2 (dominant negative TGFβ receptor II is expressed from an NK-specific promoter to interfere with the role of TGFbRII in the differentiation of CD34 cells that can be derived from iPS cells and are typically used as a cell type for differentiating heme lineages like NK cells) Loss of function of ADORA2A

[0419] List B: Loss of function of B2M (e.g., elimination of MHC class I expression by targeting B2M expression) Exogenous expression of HLA-G Loss of function of CIITA (e.g., ablation of MHC class II expression by targeting CIITA) Loss of function of PD1 Loss of function of TIGIT Loss of function of CISH (cytokine-inducible SH2-containing protein)

[0420] Loss of function preferably comprises complete elimination of surface expression of the corresponding protein.

[0421] For example, iNK cells with exogenous expression of CAR and CD16 variants (e.g., hnCD16) or with exogenous expression of CAR and no exogenous expression of CD16 variants can be produced. Cells that do not express CAR but express CD16 variants can also be produced. Any cell expressing CD16 or its enhanced variant (e.g., hnCD16) will be suitable for combined therapy with monoclonal antibodies (e.g., used in cancer treatment) or Fc fusion proteins targeting pathological cells.

[0422] If more than two transgenes are being knocked in, a polycistronic expression construct or a 2A construct may be advantageous to avoid having to insert a separate construct for each transgene.

[0423] Such iNK cells can be used for various immunotherapy applications, including but not limited to the treatment of proliferative diseases, such as certain forms of cancer. When using the above-mentioned CAR, applications in breast cancer, colon cancer, gastric cancer, renal cell carcinoma and NSCLC are envisioned. The altered surface molecule library of such cells can also successfully treat solid tumors, which have proven to be difficult for current NK cell-based strategies.

[0424] Exemplary iNK cells obtained from the reprogrammed somatic cells (or their progeny) comprise one or more (e.g., one or more, two or more, three or more, four or more, five or more, or six or more) of the following characteristics: - they contain rearranged endogenous TCR loci (e.g., TCRα VJ and / or TCRβ V(D)J segment rearrangements and complete V-domain exons); - They do not express endogenous T cell co-receptors such as CD3, CD4 and / or CD8; - They express NK cell biomarkers such as: CD56 (NCAM), CD49 and / or CD45; NK cell receptor immunoglobulin gamma Fc region receptor III (FcγRIII, cluster of differentiation 16 (CD16)); Natural killer group-2 member 0 (NKG2D, MICAIB stress ligand receptor); CD69; natural cytotoxicity receptors (e.g., NKp30; NKp44; NKp46; and / or CD158b); or any combination of two or more of these; - They can express: Chimeric antigen receptor (CAR), Non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcyRIII, CD16) Interleukin 15 (IL-15) pathway agonists, such as interleukin-15 (IL-15), interleukin 15 receptor (IL-15R) or variants thereof (e.g., constitutively active variants of IL-15R, such as IL-15R fused to an IL-15R agonist (IL-15RA)); other interleukin pathway agonists are also contemplated (alternatively or in combination with IL-15 pathway agonists), such as interleukin 2 (IL-2) pathway agonists, such as IL-2, interleukin 2 receptor (IL-2R) or variants thereof (e.g., constitutively active variants of IL-2R, such as IL-2R fused to an IL-2R agonist (IL- 2RA) fused to an IL-2R); and / or an interleukin 12 (IL12) pathway agonist, such as IL-12, an interleukin 12 receptor (IL-12R), or a variant thereof (e.g., a constitutively active variant of IL-12R, such as an IL-12R fused to an IL-12R agonist (IL-12RA)); combinations of two or more interleukins are also contemplated, such as an IL-15 pathway agonist or a combination of an IL-2 agonist and an IL-12 agonist, such as an IL-15R fused to an IL-15R agonist (IL-15RA) in combination with an IL-12R fused to an IL-12R agonist (IL-15RA). Human leukocyte antigen G (HLA-G); or any combination of two or more thereof; Human leukocyte antigen E (HLA-E) ·Leukocyte surface antigen cluster of differentiation CD47 (CD47) ·and - They may show loss of function of: Transforming growth factor beta receptor 2 (TGFbetaR2, for example by modification of the coding sequence or by expression of a dominant negative variant); Adenosine A2a receptor (ADORA2A); T cell immunoreceptor with Ig and ITIM domains (TIGIT); Beta-2 microglobulin (B2M); Major histocompatibility complex class II transactivator (CIITA); Programmed cell death protein 1 (PD-1, CD279), or expression of PD-1 antagonists; Cytokine-inducible SH2-containing protein (CISH); Natural killer cell receptor NKG2A (natural killer group 2A); Two or more HLA class II histocompatibility antigen alpha chain genes, and / or two or more HLA class II histocompatibility antigen beta chain genes; Cluster of differentiation 32B (CD32B, FCGR2B); or any combination of two or more thereof.

[0425] It is expected that by minimizing the number of edits, a specific combination of these features will be achieved, such as iNK cells expressing CAR, IL-15, and HLA-G and exhibiting loss of function of B2M and PD-1. For example, an expression construct encoding CAR can be inserted into the B2M locus, and an expression construct encoding IL-15 and HLA-G can be inserted into the B2M locus. Similar strategies will apply to other combinations.

[0426] iNK cells can be used as a monotherapy, and those expressing CAR (e.g., CAR binding to mesothelin, EGFR or HER2) will be particularly suitable for treatment methods for cells that specifically target the surface antigens that express CAR binding. Some of the envisioned iNK cells may also be suitable for combined treatment methods, for example, in combination with monoclonal antibodies targeting cancer cells.

[0427] In some embodiments, the generation of iPS cells will include obtaining donor cells (e.g., somatic cells) from healthy donor individuals. In some embodiments, it is confirmed that the donor cell or cell population is karyotype normal, and does not show the expression of genes or gene combinations known to be associated with pathological states (e.g., malignant states). In some embodiments, somatic cells are edited and then reprogrammed to a pluripotent state. In some embodiments, somatic cells are reprogrammed and edited simultaneously. In some embodiments, somatic cells are reprogrammed, and the resulting pluripotent cells are edited. In some embodiments, the generation of iPS cells includes clonal expansion of reprogrammed cell lines, characterization of multiple such cloned iPS cell lines, and selection of systems containing all desired edits while having normal karyotypes.

[0428] The final product for clinical use is a population of iNK cells carrying corresponding editing. After administration to a subject, the number of cells will be sufficient to elicit the desired immune response. The exact number will depend on the specific desired clinical outcome, the patient and disease to be treated, and other factors, and may vary greatly. It is expected that the range of suitable cell populations for administration may be from about 1,000 cells to about 100,000,000 cells. The iNK cell population for clinical use should be free of remaining stem cells, such as iPS cells expressing Oct-4 and / or Sox2, and ideally should be free of or contain only a minimum amount of cells containing free expression constructs, such as free expression constructs used during T cell reprogramming; cells that do not express the desired cell markers and overexpressed surface molecules should be free of or contain no more than 1%, 5%, or 10%. Example 2: Using T cells as Cell sources for complex editing strategies and subsequent derivation of iNK cells

[0429] The use of T cells as a cell source for complex editing strategies and subsequent derivation of iNK cells or other lymphocytes, for example, enables the generation of iNK cells that express a CAR of interest (such as mesothelin, EGFR, HER2, and MICA / B) and / or have one or more edits from List A and / or Table 10 and one or more edits from List B and / or Table 11.

[0430] List A: Enhanced exogenous expression of CD16 variants, such as hnCD16a, a high affinity, uncleavable variant of CD16 - a low affinity Fcy receptor involved in antibody-dependent cellular cytotoxicity (ADCC). Typically, CD16 is cleaved by proteases during ADCC - hnCD16CAR does not undergo this cleavage, thereby maintaining the ADCC signal longer. Exogenous expression of IL-15 / IL 15RA Loss of function of TGFbR2, or exogenous expression of a dominant negative variant of TGFbR2 (dominant negative TGFβ receptor II is expressed from an NK-specific promoter to interfere with the role of TGFbRII in the differentiation of CD34 cells that can be derived from iPS cells and are typically used as a cell type for differentiating heme lineages like NK cells) Loss of function of ADORA2A

[0431] List B: Loss of function of B2M (e.g., elimination of MHC class I expression by targeting B2M expression) Exogenous expression of HLA-G Loss of function of CIITA (e.g., ablation of MHC class II expression by targeting CIITA) Loss of function of PD1 Loss of function of TIGIT Loss of function of CISH (cytokine-inducible SH2-containing protein)

[0432] Loss of function preferably comprises complete elimination of surface expression of the corresponding protein.

[0433] For example, iNK cells with exogenous expression of CAR and CD16 variants (e.g., hnCD16) or with exogenous expression of CAR and no exogenous expression of CD16 variants can be produced. Cells that do not express CAR but express CD16 variants can also be produced. Any cell expressing CD16 or its enhanced variant (e.g., hnCD16) will be suitable for combined therapy with monoclonal antibodies (e.g., used in cancer treatment) or Fc fusion proteins targeting pathological cells.

[0434] If more than two transgenes are being knocked in, a polycistronic expression construct or a 2A construct may be advantageous to avoid having to insert a separate construct for each transgene.

[0435] Such iNK cells can be used for various immunotherapy applications, including but not limited to the treatment of proliferative diseases, such as certain forms of cancer. When using the above-mentioned CAR, applications in breast cancer, colon cancer, gastric cancer, renal cell carcinoma and NSCLC are envisioned. The altered surface molecule library of such cells can also successfully treat solid tumors, which have proven to be difficult for current NK cell-based strategies.

[0436] Exemplary iNK cells obtained from reprogrammed / edited T cells (or their daughter cells) comprise one or more (e.g., one or more, two or more, three or more, four or more, five or more, or six or more) of the following characteristics: ...

Claims

1. A modified lymphocyte, wherein the modified lymphocyte: (a) does not express endogenous CD3, CD4 and / or CD8; and (b) expressing at least one endogenous gene encoding: (i) CD56 (NCAM), CD49 and / or CD45; (ii) NK cell receptor immunoglobulin gamma Fc region receptor III (FcγRIII, cluster of differentiation 16 (CD16)); (iii) natural killer group-2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptors; or any combination of two or more thereof; wherein the modified lymphocytes are further: (1) comprising at least one exogenous nucleic acid expression construct comprising a nucleic acid sequence encoding: (i) Chimeric antigen receptor (CAR); (ii) non-naturally occurring FcγRIII variants (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) Loss of function of at least one of the following: (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof.

2. The modified lymphocyte of claim 1, wherein the lymphocyte exhibits the following loss of function: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A.

3. The modified lymphocyte of claim 1 or 2, wherein the lymphocyte comprises a rearranged endogenous T cell receptor (TCR) locus.

4. The modified lymphocyte of claim 3, wherein the rearranged TCR comprises TCRαVJ and / or TCRβV(D)J segment rearrangement and complete V-domain exons.

5. The modified lymphocyte of claim 1, 2, 3 or 4, wherein the natural cytotoxicity receptor is NKp30, NKp44, NKp46, and / or CD158b.

6. The modified lymphocyte of any one of claims 1-5, wherein the IL-15R variant is a constitutively active IL-15R variant, and / or wherein the IL12-R variant is a constitutively active IL12-R variant.

7. The modified lymphocyte of claim 6, wherein the constitutively active IL-15R variant is a fusion of IL-15R and an IL-15R agonist (IL-15RA), and / or wherein the constitutively active IL-12R variant is a fusion of IL-12R and an IL-12R agonist (IL-12RA).

8. The modified lymphocyte of claim 7, wherein the IL-15R agonist is IL-15, or an IL-15R binding variant thereof; and / or wherein the IL-12R agonist is IL-12, or an IL-12R binding variant thereof.

9. The modified lymphocyte of any one of claims 1-8, wherein the loss of TGFβR2 is associated with exogenous expression of a dominant negative variant of TGFβ receptor II (DN-TGFβR2).

10. The modified lymphocyte of claim 1, wherein the CAR is capable of binding to mesothelin, EGFR, HER2, MICA / B, BCMA, CD19, CD22, CD20, CD33, CD123, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptide (i.e., E7), EBV viral peptide, CD70, WT1, CEA, EGFRvIII, IL13Rα2, and GD2, CA125, CD7, EpCAM, Muc16 or CD30.

11. The modified lymphocyte of any one of claims 1-10, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell.

12. The modified lymphocyte of claim 11, wherein the pluripotent stem cell is a hematopoietic stem cell (HSC).

13. The modified lymphocyte of claim 11, wherein the pluripotent stem cell is an induced pluripotent stem cell (iPSC).

14. The modified lymphocyte of claim 11, wherein the pluripotent stem cell is an embryonic stem cell (ESC).

15. The modified lymphocyte of any one of claims 1-11, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell, comprising at least one or more exogenous nucleic acid constructs encoding any one of (1)(i)-(1)(xi) or any combination thereof; and / or at least one genomic alteration that achieves a loss of function of any one of (2)(i)-(2)(xi) or any combination thereof in the lymphocyte.

16. The modified lymphocyte of claim 15, wherein the lymphocyte is derived from a pluripotent or multipotent stem cell, comprising at least one genomic alteration that achieves loss of function of any of (2)(i)-(2)(xi) or any combination thereof in the lymphocyte.

17. The modified lymphocyte of claim 15 or claim 16, wherein the at least one genomic alteration that achieves loss of function of one or more of (2)(i)-(2)(xi) in the lymphocyte comprises insertion of an exogenous nucleic acid construct.

18. The modified lymphocyte of claim 17, wherein the exogenous nucleic acid construct encodes any one of (1)(i)-(1)(ix) or any combination thereof.

19. The modified lymphocyte of any one of claims 1-18, wherein the lymphocyte exhibits loss of function of two or more of the genes / proteins listed under (2).

20. The modified lymphocyte of any one of claims 1-19, wherein the lymphocyte comprises an indel or insertion of an exogenous nucleotide construct in a genomic locus containing a gene or encoding a protein under (2).

21. The modified lymphocyte of any one of claims 1-20, wherein the lymphocyte comprises an indel or insertion of an exogenous nucleotide construct in two or more genomic loci containing a gene or encoding a protein under (2).

22. The modified lymphocyte of any one of claims 1-21, wherein the lymphocyte is obtained by editing a genomic locus with an RNA-guided nuclease.

23. The modified lymphocyte of claim 22, wherein the RNA-guided nuclease is a CRISPR / Cas nuclease.

24. The modified lymphocyte of claim 22, wherein the RNA-guided nuclease is selected from the group consisting of SpCas9, SaCas9, (KKH)SaCas9, AsCpf1 (AsCas12a), LbCpf1, (LbCas12a), CasX, CasY, Cas12h1, Cas12i1, Cas12c1, Cas12c2, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fok1, Sniper-Cas9, xCas9, AaCas12b, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9, BhCas12b, and BhCas12b V4.

25. The modified lymphocyte of any one of claims 1-24, wherein the lymphocyte is obtained by editing two or more genomic loci containing genes encoding any of the proteins under (2).

26. The modified lymphocyte of claim 25, wherein at least two of the two or more genomic loci containing genes encoding any of the proteins under (2) have been edited by different RNA-guided nucleases.

27. The modified lymphocyte of claim 25, wherein at least one of the two or more genomic loci containing a gene encoding any of the proteins under (2) has been edited by Cas9, and wherein at least one of the loci has been edited by Cpf1.

28. The modified lymphocyte of any one of claims 1-27, wherein the modified lymphocyte expresses endogenous CD56, CD49 and CD45.

29. The modified lymphocyte of any one of claims 1-28, wherein the lymphocyte is a natural killer (NK) cell.

30. A modified cell, wherein the modified cell (1) comprising at least one exogenous nucleic acid expression construct comprising a nucleic acid sequence encoding: (i) Chimeric antigen receptor (CAR); (ii) non-naturally occurring FcγRIII variants (CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) Loss of function of at least one of the following: (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof.

31. The modified cell of claim 30, wherein the modified cell exhibits the following loss of function: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A.

32. The modified cell of claim 30 or 31, wherein the modified cell is an immune cell.

33. The modified cell of claim 32, wherein the immune cell is a lymphocyte.

34. The modified cell of claim 33, wherein the lymphocyte is a NK cell.

35. The modified cell of claim 30, wherein the cell is a pluripotent stem cell, or a differentiated daughter cell derived therefrom.

36. The modified cell of claim 34 or claim 35, wherein the modified cell does not express endogenous T cell co-receptors.

37. The modified cell of claim 33, wherein the lymphocyte is a T cell.

38. The modified cell of claim 30, wherein the cell comprises a rearranged endogenous TCR locus, wherein the rearranged TCR comprises TCRαVJ and / or TCRβV(D)J segment rearrangements and complete V-domain exons.

39. The modified cell of any one of claims 30-38, wherein the modified cell expresses at least one endogenous gene encoding: (i) CD56 (NCAM), CD49 and / or CD45; (ii) FcγRIII (CD16); (iii) natural killer group-2 member D (NKG2D); (iv) CD69; (v) natural cytotoxicity receptors; or any combination of two or more thereof.

40. The modified cell of claim 39, wherein the natural cytotoxicity receptor is NKp30, NKp44, NKp46, and / or CD158b.

41. The modified cell of any one of claims 30-40, wherein the cell expresses at least one NK cell biomarker.

42. The modified cell of claim 41, wherein the NK cell biomarker is CD56, CD49 and / or CD45.

43. A cell population comprising the modified lymphocytes of any one of claims 1-28 or the modified cells of any one of claims 30-42.

44. A pharmaceutical composition comprising the cell population of claim 43.

45. An isolated lymphocyte population, wherein the cell population comprises at least 1 x 10 3 , at least 1x 10 4 , at least 1x 10 5 , at least 2x 10 5 , at least 3x 10 5 , at least 4x 10 5 , at least 5x 10 5 , at least 1x 10 6 , at least 2x 10 6 , at least 3x 10 6 , at least 4x 10 6 , at least 5x 10 6 , at least 1x 10 7 , at least 1x 10 7 , at least 2x 10 7 , at least 3x 10 7 , at least 4x 10 7 , at least 5x10 7 , at least 1x 10 8 , at least 2x 10 8 , at least 3x 10 8 , at least 4x 10 8 , at least 5x 10 8 , at least 1x 10 9 , at least 1x10 9 , at least 2x 10 9 , at least 3x 10 9 , at least 4x 10 9 , at least 5x 10 9 , at least 1x 10 10 , at least 2x 10 10 , at least 3x10 10 , at least 4x 10 10 , at least 5x 10 10 , at least 1x 10 11 , or at least 1x10 12 cells, and wherein at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.9%, at least 99.99%, at least 99.999%, or nearly 100% of the lymphocytes in the cell population: (a) comprising a rearranged T cell receptor (TCR) locus; (b) does not express endogenous CD3; (c) expresses endogenous CD56 (NCAM), CD49 and / or CD45; and (d) expressing at least one endogenous gene encoding: (i) FcγRIII (CD16); (ii) natural killer group-2 member D (NKG2D); (iii) CD69; (iv) natural cytotoxicity receptors; or any combination of two or more thereof; and wherein the modified lymphocytes are further: (1) comprising at least one exogenous nucleic acid expression construct comprising a nucleic acid sequence encoding: (i) Chimeric antigen receptor (CAR); (ii) non-naturally occurring immunoglobulin gamma Fc region receptor III variant (FcγRIII, CD16); (iii) interleukin 15 (IL-15); (iv) IL-15 receptor (IL-15R) or a variant thereof; (v) interleukin 12 (IL-12); (vi) IL-12 receptor (IL-12R) or a variant thereof; (vii) human leukocyte antigen G (HLA-G); (viii) human leukocyte antigen E (HLA-E); (ix) leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and / or (2) Loss of function of at least one of the following: (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof.

46. ​​The isolated lymphocyte population of claim 45, wherein the modified lymphocytes exhibit the following loss of function: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A.

47. An isolated lymphocyte population as described in claim 45 or 46, wherein the rearranged TCR locus comprises TCRαVJ and / or TCRβV(D)J segment rearrangements and complete V-domain exons.

48. An in vitro isolated lymphocyte population as described in claim 47, wherein the rearranged endogenous TCR locus consists of no more than two rearranged alleles.

49. The in vitro isolated lymphocyte population of claim 45, wherein the natural cytotoxicity receptor is NKp30, NKp44, NKp46, and / or CD158b.

50. An in vitro isolated lymphocyte population as described in any one of claims 45-49, wherein the cell population does not contain more than 1%, more than 0.1%, more than 0.001%, more than 0.0001%, more than 0.00001%, more than 0.000001%, more than 0.0000001%, more than 0.00000001%, more than 0.000000001%, more than 0.0000000001%, or more than 0.00000000001% of cells expressing reprogramming factors from exogenous nucleic acid constructs.

51. The in vitro isolated lymphocyte population of claim 50, wherein the cell population does not comprise cells expressing reprogramming factors from an exogenous nucleic acid construct.

52. The in vitro isolated lymphocyte population of claim 50 or claim 51, wherein the reprogramming factor is Oct-4 and / or Sox-2.

53. The in vitro isolated lymphocyte population of claim 45, wherein the cell population does not contain cells containing an episomal expression construct encoding a reprogramming factor.

54. An in vitro isolated lymphocyte population as described in any one of claims 45-53, wherein each cell in the cell population contains the same combination of (1) and (2).

55. The in vitro isolated lymphocyte population of any one of claims 45-54, wherein the cell population comprises less than 0.001%, less than 0.002%, less than 0.003%, less than 0.004%, less than 0.005%, less than 0.006%, less than 0.007%, less than 0.008%, less than 0.009%, less than 0.01%, less than 0.02%, less than 0.03%, less than 0.04%, less than 0.05%. , less than 0.06%, less than 0.07%, less than 0.08%, less than 0.09%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% of cells contain a chromosomal translocation.

56. A method of treating a subject, the method comprising administering to a subject in need thereof a lymphocyte as described in any one of claims 1-29, a modified cell as described in any one of claims 30-42, a cell population as described in claim 41, a pharmaceutical composition as described in claim 44, or an in vitro isolated lymphocyte population as described in any one of claims 45-55.

57. The method of claim 56, wherein the subject suffers from or has been diagnosed with a proliferative disease.

58. The method of claim 57, wherein the proliferative disease is cancer.

59. The method of claim 58, wherein the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC), or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian cancer / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical cancer and HPV+ head and neck cancer, oral cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcomas, and hematological cancers like ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

60. A method of producing a lymphocyte as described in any one of claims 1-29, a modified cell as described in any one of claims 30-42, a cell population as described in claim 43, or an in vitro isolated lymphocyte population as described in any one of claims 44-54, the method comprising: (a) obtaining induced pluripotent stem cells (iPSCs); (b) modifying the iPSC or its undifferentiated or differentiated daughter cells to comprise at least one exogenous nucleic acid expression construct expressing (1) and / or comprising loss of function of at least one gene of (2); (c) directing the differentiation of the iPSCs toward hematopoietic lineage cells, The hematopoietic lineage cells retain the edited genetic loci contained in the iPSCs.

61. The method of claim 60, wherein the differentiation direction comprises: (i) contacting the iPSCs with a composition comprising a BMP pathway activator and optionally bFGF to obtain mesodermal cells; and (ii) contacting the mesodermal cells with a composition comprising a BMP pathway activator, bFGF, and a WNT pathway activator to obtain mesodermal cells with definitive hemogenic endothelial (HE) potential, wherein the mesodermal cells with definitive hemogenic endothelial (HE) potential are capable of providing hematopoietic lineage cells; wherein the mesodermal cells and the mesodermal cells with definitive HE potential are obtained in steps (i) and (ii) without the step of embryoid body formation; These hematopoietic lineage cells include definitive hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSC), hematopoietic multipotent progenitor cells (MPP), pre-T cell progenitor cells, pre-NK cell progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NK cells, NKT cells or B cells.

62. The method of claim 61, wherein directing the differentiation of iPSCs to cells of the hematopoietic lineage further comprises: These mesodermal cells with definitive HE potential are contacted with a composition comprising bFGF and a ROCK inhibitor to obtain definitive HE cells.

63. The method of claim 60, claim 61, or claim 62, further comprising: These definitive HE cells are contacted with a composition comprising a BMP activator and optionally a ROCK inhibitor and one or more growth factors and cytokines selected from the group consisting of TPO, IL3, GMCSF, EPO, bFGF, VEGF, SCF, IL6, Flt3L and IL11 to obtain hematopoietic multipotent progenitor cells (MPPs).

64. The method of any of claims 60-63, further comprising contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, and IL7; and optionally one or more of a BMP activator, a ROCK inhibitor, TPO, VEGF, and bFGF, to obtain pre-T cell progenitors, T cell progenitors, and / or T cells.

65. The method of any of claims 60-63, further comprising contacting the definitive HE cells with a composition comprising one or more growth factors and cytokines selected from the group consisting of SCF, Flt3L, TPO, IL7, and IL15, and optionally one or more of a BMP activator, a ROCK inhibitor, VEGF, and bFGF, to obtain pre-NK cell progenitors, NK cell progenitors, and / or NK cells.

66. The method of any one of claims 60-65, further comprising: Prior to step c), the pluripotent stem cells are contacted with a composition comprising a MEK inhibitor, a GSK3 inhibitor and a ROCK inhibitor to seed and expand the cells.

67. The method of any one of claims 60-65, further comprising detecting rearranged T cell receptor (TCR) loci in the hematopoietic lineage cells.

68. The method of claim 67, further comprising selecting a hematopoietic lineage cell comprising a rearranged TCR locus based on the TCR encoded by the rearranged TCR locus that binds an antigen of interest.

69. The method of claim 68, wherein the antigen of interest is a tumor antigen.

70. A method comprising: reprogramming donor cells to a pluripotent state; editing a target locus in the genome of the donor cell; as well as The reprogrammed donor cells are differentiated into lymphocytes.

71. The method of claim 70, wherein the editing is performed before or during the step of reprogramming the donor cell to a pluripotent state.

72. The method of claim 70 or 71, wherein the donor cell is a fibroblast, a peripheral blood cell, a lymphocyte, or a T cell.

73. A method comprising: Differentiating a genetically modified pluripotent stem cell into a lymphocyte, wherein the genetically modified pluripotent stem cell comprises: (1) an exogenous nucleic acid expression construct, the exogenous nucleic acid expression construct comprising: (i) a nucleic acid sequence encoding a chimeric antigen receptor (CAR); (ii) a nucleic acid sequence encoding a non-naturally occurring FcγRIII variant (CD16); (iii) a nucleic acid sequence encoding interleukin 15 (IL-15); (iv) a nucleic acid sequence encoding interleukin 15 receptor (IL-15R) or a variant thereof; (v) a nucleic acid sequence encoding interleukin 12 (IL12); (vi) a nucleic acid sequence encoding interleukin-12 receptor (IL-12R) or a variant thereof; (vii) a nucleic acid sequence encoding human leukocyte antigen G (HLA-G); (viii) a nucleic acid sequence encoding human leukocyte antigen E (HLA-E); (ix) a nucleic acid sequence encoding the leukocyte surface antigen cluster of differentiation CD47 (CD47); or any combination of two or more thereof; and (2) Deletion or insertion of exogenous nucleic acid in one or more of the following genetic loci: (i) transforming growth factor β receptor 2 (TGFβR2); (ii) adenosine A2a receptor (ADORA2A); (iii) T cell immunoreceptor with Ig and ITIM domains (TIGIT); (iv) beta-2 microglobulin (B2M); (v) programmed cell death protein 1 (PD-1, CD279); (vi) cytokine-inducible SH2-containing protein (CISH); (vii) major histocompatibility complex class II transactivator (CIITA); (viii) natural killer cell receptor NKG2A (natural killer group 2A); (ix) two or more HLA class II histocompatibility antigen α chain genes, and / or two or more HLA class II histocompatibility antigen β chain genes; (x) cluster of differentiation 32B (CD32B, FCGR2B); (xi) T cell receptor alpha constant region (TRAC); or any combination of two or more thereof, The deletion or insertion results in a loss of function of a gene product encoded by the corresponding one or more genetic loci.

74. The method of claim 73, wherein the indel or insertion of the exogenous nucleic acid is in the following genetic locus: (i) TGFβR2, CISH, TIGIT, ADORA2A, or NKG2A; (ii) TGFβR2 and CISH, TGFβR2 and TIGIT, TGFβR2 and ADORA2A, TGFβR2 and NKG2A, CISH and TIGIT, CISH and ADORA2A, CISH and NKG2A, TIGIT and ADORA2A, TIGIT and NKG2A, or ADORA2A and NKG2A; or (iii) TGFβR2, CISH and TIGIT; TGFβR2, CISH and ADORA2A; TGFβR2, CISH and NKG2A; TGFβR2, TIGIT and ADORA2A; TGFβR2, TIGIT and NKG2A; TGFβR2, ADORA2A and NKG2A; CISH, TIGIT and ADORA2A; CISH, TIGIT and NKG2A; CISH, ADORA2A and NKG2A; or TIGIT, ADORA2A and NKG2A, The deletion or insertion results in a loss of function of a gene product encoded by the corresponding one or more genetic loci.

75. The method of claim 73 or claim 74, wherein the exogenous nucleic acid of (2) is the exogenous nucleic acid of (1).

76. The method of claim 73 or claim 75, wherein the pluripotent stem cell is an iPS cell.

77. The method of claim 73 or claim 75, wherein the differentiation comprises contacting the pluripotent stem cell with a differentiation medium or a series of differentiation mediums.

78. The modified lymphocyte of any of the preceding claims, wherein the two or more HLA class II histocompatibility antigen alpha chain genes are selected from HLA-DQA1, HLA-DRA, HLA-DPAl, HLA-DMA, HLA-DQA2, and HLA-DOA.

79. A modified lymphocyte as described in any of the preceding claims, wherein the two or more HLA class II histocompatibility antigen β chain genes are selected from HLA-DMB, HLA-DOB, HLA-DPB1, HLA-DQB1, HLA-DQB3, HLA-DQB2, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5.

80. A modified lymphocyte as described in any one of claims 1-29 and 78-79, a modified cell as described in any one of claims 30-42, a cell population as described in claim 43, a pharmaceutical composition as described in claim 44, an in vitro isolated lymphocyte population as described in any one of claims 45-55, or a method as described in any one of claims 56-77, wherein the exogenous nucleic acid expression construct comprises a coding nucleic acid sequence listed under (1) under the control of a heterologous promoter.

81. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, in vitro isolated lymphocyte population, or method of claim 80, wherein the heterologous promoter is a NK cell-specific promoter.

82. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, in vitro isolated lymphocyte population, or method of claim 80, wherein the NK cell-specific promoter is a promoter of a gene known to be specifically expressed in NK cells, or a variant thereof.

83. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, in vitro isolated lymphocyte population, or method of claim 80, wherein the NK cell-specific promoter is a CD56 (NCAM), CD49 or CD45 promoter, or a variant thereof.

84. The modified lymphocyte, modified cell, cell population, pharmaceutical composition, in vitro isolated lymphocyte population, or method of claim 80, wherein the NK cell-specific promoter is an FcγRIII promoter, an NKG2D promoter, a CD69 promoter, or a natural cytotoxicity receptor promoter, or a variant thereof.

85. A method comprising: The modified lymphocyte, modified cell, or cell population of any one of the preceding claims is administered to a subject in need thereof.

86. The method of claim 85, wherein the subject suffers from or has been diagnosed with a proliferative disease.

87. The method of claim 86, wherein the proliferative disease is cancer.

88. The method of claim 87, wherein the cancer is breast cancer, colorectal cancer, gastric cancer, renal cell carcinoma (RCC), or non-small cell lung cancer (NSCLC), solid tumors, bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian cancer / uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-related and / or HPV-positive cancers such as cervical cancer and HPV+ head and neck cancer, oral cancer, pharyngeal cancer, thyroid cancer, gallbladder cancer, soft tissue sarcomas, and hematological cancers like ALL, CLL, NHL, DLBCL, AML, CML, multiple myeloma (MM).

Images