A primer for detecting Leishmania infantum infection in infants and its application

Abstract

The present invention provides a primer for detecting Leishmania infantum infection in infants and its application, belonging to the field of biotechnology. The present invention can diagnose VL-HLH sensitively and accurately, and the obtained amplification product can be used for sequencing. According to the sequencing results, comparison in the NCBI database, phylogenetic tree analysis and identification can be carried out, so as to quickly diagnose and identify the species of Leishmania, which has great guiding significance for the treatment and prognosis of this disease. The present invention uses qPCR to amplify and quantify kDNA, and can further obtain the load of Leishmania in the sample, which has great reference value for clinical treatment and prognosis, and is more conducive to the popularization and application of using PCR to diagnose VL-HLH.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a primer for detecting Leishmania infantum infection in infants and its application. Background Art

[0002] Leishmania parasites in human tissues, belonging to intracellular flagellates, are classified in the order Kinetoplastida, Suborder Trypanosomatina, Family Trypanosomatidae, Genus Leishmania. The life cycle of Leishmania has two stages, namely promastigote and amastigote. The former parasitizes in the digestive tract of arthropods (sandflies), and the latter parasitizes in the mononuclear-phagocyte system of humans and vertebrates, and is transmitted through sandflies. There are more than 54 species of Leishmania globally, and more than 20 of them can infect humans. The diseases caused by Leishmania are called leishmaniasis. Different species of Leishmania infections lead to different diseases. Among them, visceral leishmaniasis is related to the infection of Leishmania donovani and Leishmania infantum.

[0003] According to a large number of research reports, visceral leishmaniasis (VL) is prone to secondary hemophagocytic lymphohistiocytosis (Visceral leishmaniasis associated hemophagocyticlymphohistiocytosis HLH, VL-HLH), especially in VL endemic areas. VL-HLH is an immune system disease in which the immune system is abnormally activated and out of control, leading to a series of excessive inflammatory responses and ultimately multi-organ system damage. It is mainly manifested as abnormal activation and proliferation of lymphocytes, monocytes, and macrophage systems, secreting a large number of inflammatory cytokines to cause cytokine storm. The clinical symptoms mainly include pancytopenia, persistent fever, hepatosplenomegaly, poor mental state, malnutrition, abdominal distension, etc. If not diagnosed and treated in time, 41.7% of VL children will develop into VL-HLH. If VL-HLH is not diagnosed and treated in time and accurately, its mortality rate can reach 100%. At present, the diagnosis of VL-HLH is often misdiagnosed and missed. 30% of VL-HLH patients are misdiagnosed at the first diagnosis, especially in non-endemic areas of leishmaniasis, and the misdiagnosis rate is higher.

[0004] Currently, microscopic examination of bone marrow smears is a commonly used method for diagnosing VL-HLH, that is, examining the bone marrow smears of patients under a microscope to directly identify the amastigote pathogens of Leishmania and make a diagnosis. However, this method requires high professional knowledge and experience of the examiners. If Leishmania cannot be observed in a single sampling, multiple bone marrow punctures are needed, causing great pain to the patients. Therefore, rapid and accurate diagnosis of whether infants and young children are infected with Leishmania is crucial for the treatment of VL or VL-HLH. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a primer for detecting Leishmania infection in infants and young children, which can sensitively and accurately diagnose VL-HLH.

[0006] In order to achieve the above invention purpose, the present invention provides the following technical solutions:

[0007] A primer for detecting Leishmania infection in infants and young children, comprising primer set 1 and / or primer set 2;

[0008] In the primer set 1, the upstream primer has the nucleotide sequence shown in SEQ ID NO.1, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.2;

[0009] In the primer set 2, the upstream primer has the nucleotide sequence shown in SEQ ID NO.3, the downstream primer has the nucleotide sequence shown in SEQ ID NO.4, and the probe has the nucleotide sequence shown in SEQ ID NO.5.

[0010] Preferably, the primer set 1 is used for specifically amplifying the kDNA of Leishmania and for sequencing; the primer set 2 is used for quantitatively detecting the kDNA load of Leishmania in the sample.

[0011] Another purpose of the present invention is to provide a reagent for detecting Leishmania infection in infants and young children, and the reagent contains the above primer.

[0012] Another purpose of the present invention is to provide the application of the primer or the reagent in the preparation of products for detecting Leishmania infection in infants and young children.

[0013] Preferably, PCR amplification is performed on the test substance using the primer or the reagent.

[0014] Preferably, the amplification system for quantitatively detecting the kDNA content of Leishmania in the sample using the primer set 2 is: 2×Probe qPCR Mix 10µL, 0.4µL of each of the upstream and downstream primers of the primer set 2, 0.8µL of the probe of the primer set 2, 0.4µL of 50×ROX Reference Dye, 2µL of DNA template, and 6µL of sterilized water.

[0015] Preferably, the amplification system for specifically amplifying Leishmania kDNA using primer set 1 is: 25 μL of 2×PCR MasterMix, 19 μL of water, 1 μL each of the upstream and downstream primers of primer set 1, and 4 μL of DNA template.

[0016] Preferably, the amplification conditions for specifically amplifying Leishmania kDNA using primer set 1 are: 94°C for 2 min, 94°C for 30 s, 56°C for 30 s, 72°C for 15 s, 35 cycles, and incubation at 72°C for 1 min.

[0017] Preferably, after the PCR amplification, the amplification product is subjected to agarose gel electrophoresis. If a specific identification band of 139 bp appears in the electrophoresis pattern, the test substance is infected with Leishmania.

[0018] Preferably, the specific identification band is recovered, the amplification product is purified, the amplification product and the PCDND3.1(+) plasmid are digested with enzymes respectively and then ligated, and the ligation product is transformed into Escherichia coli DH5α cells and then sequenced.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention provides a primer for detecting Leishmania infection in infants and its application. The present invention performs kinetoplast minicircle DNA (kDNA) PCR on the total DNA in bone marrow samples, which can diagnose VL-HLH sensitively and accurately. The obtained amplification product can be used for sequencing. According to the sequencing results, comparison in the NCBI database and phylogenetic tree analysis and identification can be carried out, which can quickly diagnose and identify the species of Leishmania, and has great guiding significance for the treatment and prognosis of this disease. The present invention uses qPCR to amplify and quantify kDNA, which can further detect the load of Leishmania in the sample, has great reference value for clinical treatment and prognosis, and is more conducive to the popularization and application of using PCR to diagnose VL-HLH. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 For bone marrow cell smear examinations of 3 cases of children. Among them, a shows amastigotes of Leishmania in the bone marrow of patient 1; b shows phagocytes in the bone marrow of patient 1; c shows amastigotes of Leishmania in the bone marrow of patient 2; d shows phagocytes in the bone marrow of patient 2; e shows amastigotes of Leishmania in the bone marrow of patient 3; f shows phagocytes in the bone marrow of patient 3; the red arrow indicates amastigotes of Leishmania, and the black arrow indicates phagocytes (×1000, Wright-Giemsa staining);

[0022] Figure 2Electrophoresis results of kDNA and ITS-1 PCR products for 3 children. Among them, a is kDNA PCR of DNA extracts from bone marrow smears of 3 children; b is kDNA PCR after cloning plasmids of kDNA amplification products from 3 children were transformed into Escherichia coli; c is ITS-1 PCR of DNA extracts from bone marrow smears of 3 children; Lane M: DNA2000 Marker, Lane 1: Patient 1, Lane 2: Patient 2, Lane 3: Patient 3, Lane C: Negative control;

[0023] Figure 3 Alignment of kDNA sequences among 3 children. The sequences were aligned using Snapgene (version 5.3);

[0024] Figure 4 Phylogenetic tree of kDNA sequences of 14 Leishmania strains. Among them, the purple dots represent Patients 1, 2, and 3;

[0025] Figure 5 Amplification curves of kDNA standard and kDNA of 3 children by real-time fluorescence quantitative PCR;

[0026] Figure 6 Linear regression equation of kDNA standard and kDNA loads of 3 children;

[0027] Figure 7 Linear regression equation of kDNA standard;

[0028] Figure 8 Amplification curves of kDNA standard and diluted kDNA of Patient 2 by real-time fluorescence quantitative PCR. Specific implementation method

[0029] The present invention provides a primer for detecting Leishmania infantum infection in infants, including Primer Set 1 and / or Primer Set 2; in the Primer Set 1, the upstream primer has the nucleotide sequence shown in SEQ ID NO.1, and the downstream primer has the nucleotide sequence shown in SEQ ID NO.2; in the Primer Set 2, the upstream primer has the nucleotide sequence shown in SEQ ID NO.3, the downstream primer has the nucleotide sequence shown in SEQ ID NO.4, and the probe has the nucleotide sequence shown in SEQ ID NO.5.

[0030] In the present invention, PCR amplification primers are designed with the kDNA minicircle gene sequence of Leishmania infantum as the template. The Primer Set 1 is used for specifically amplifying the kDNA of Leishmania infantum and for sequencing; the Primer Set 2 is used for quantitatively detecting the kDNA load of Leishmania infantum in the sample.

[0031] The present invention also provides a reagent for detecting Leishmania infantum infection in infants, and the reagent contains the above primers.

[0032] The present invention also provides the use of the primer or the reagent in the preparation of a product for detecting Leishmania infantum infection in infants.

[0033] In the present invention, the primer or the reagent is used for PCR amplification of the analyte.

[0034] In the present invention, the amplification system for quantitatively detecting the kDNA content of Leishmania in a sample using Primer Set 2 is as follows: 10 μL of 2×Probe qPCR Mix, 0.4 μL each of the upstream and downstream primers of Primer Set 2, 0.8 μL of the probe of Primer Set 2, 0.4 μL of 50×ROX Reference Dye, 2 μL of DNA template, and 6 μL of sterilized water. In the specific embodiments of the present invention, in the amplification system, the concentrations of the upstream and downstream primers of Primer Set 2 are 10 μM, and the concentration of the probe is 4 μM. The primer concentrations provided by the present invention can accurately detect low-load Leishmania.

[0035] In the present invention, quantitative detection using Primer Set 2 can accurately detect low-load Leishmania pathogens, and can diagnose VL-HLH Leishmania infection and identify the species of the parasite at the initial stage of infection, with high sensitivity.

[0036] In the present invention, the amplification system for specifically amplifying the kDNA of Leishmania using Primer Set 1 is as follows: 25 μL of 2×PCRMaster Mix, 19 μL of water, 1 μL each of the upstream and downstream primers of Primer Set 1, and 4 μL of DNA template. In the specific embodiments of the present invention, in the amplification system, the concentrations of the upstream and downstream primers of Primer Set 1 are 10 μM.

[0037] In the present invention, the amplification conditions for specifically amplifying the kDNA of Leishmania using Primer Set 1 are: 94°C for 2 min, 94°C for 30 s, 56°C for 30 s, 72°C for 15 s, 35 cycles, and incubation at 72°C for 1 min.

[0038] In the present invention, after the PCR amplification, the amplification product is subjected to agarose gel electrophoresis. If a specific identification band of 139 bp appears in the electrophoresis pattern, the analyte is infected with Leishmania. As an implementable method, in the present invention, the PCR amplification product is electrophoresed on a 1% agarose gel, and the size of the target band is observed on a gel imaging instrument.

[0039] In the present invention, the specific identification band is recovered, the amplification product is purified, the amplification product and the PCDND3.1(+) plasmid are digested with enzymes respectively and then ligated, and the ligation product is transformed into Escherichia coli DH5α cells and then sequenced.

[0040] After being infected with different species of Leishmania, the severity of the disease and the treatment regimens will vary. Therefore, rapid diagnosis and differentiation of Leishmania species have great guiding significance for the treatment and prognosis of this disease. The products amplified using Primer Set 1 provided by the present invention can be used for sequencing and can accurately identify the species of parasites.

[0041] In clinical practice, when clinical symptoms highly suspect VL-HLH and Leishmania cannot be detected in the initial bone marrow sampling, the primers provided in the present invention can be used for detection to assist clinical diagnosis and treatment.

[0042] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0043] Example 1

[0044] A primer for detecting Leishmania infection in infants and young children and its detection effect.

[0045] 1. Materials.

[0046] Three children were admitted to the Children's Hospital of Kunming, Yunnan Province, China at different times, and their clinical symptoms, laboratory examinations and other data were collected for retrospective analysis. Bone marrow samples were from the Children's Hospital of Kunming, Yunnan Province and were used for DNA extraction, PCR and qPCR detection. This experiment was approved by the Ethics Committee of the Children's Hospital of Kunming, Yunnan Province.

[0047] 2. Laboratory examinations.

[0048] After admission, three children underwent routine laboratory examinations, including blood routine, biochemical indexes, pathogens, bone marrow puncture and other examinations. Among them, bone marrow cell smears were stained with Wright-Giemsa and examined and diagnosed by experienced pathology and diagnosis experts according to relevant procedures.

[0049] All three children were female. Among them, Case 1 and Case 3 were both 2 years old, Case 2 was 9 months old. Case 1 was from Guizhou, China, and Case 2 and Case 3 were both from Yunnan, China. All three children were admitted to the hospital for treatment due to repeated fever. Before admission, they all had persistent high fever (38.9 - 40 °C), poor mental state, abdominal distension, enlarged liver and spleen, etc., and all had a history of mosquito bites and travel to Leishmania-endemic areas. Biochemical examinations showed that all three children had typical VL-HLH blood routine and biochemical characteristics, manifested as pancytopenia or two-line reduction, significantly elevated high-sensitivity C-reactive protein, procalcitonin, ferritin, alanine aminotransferase, and significantly reduced fibrinogen.

[0050] The traditional etiological examination based on bone marrow cell smear microscopy confirmed VL-HLH. No Leishmania amastigotes were found in the bone marrow of the 3 children during the first bone marrow aspiration. Leishmania amastigotes were found in all 3 children after the second bone marrow aspiration. Among them, patient 2 had 2 Leishmania amastigotes detected after continuously observing 6 bone marrow cell smears. As Figure 1 shown, there were more Leishmania in the bone marrow of patient 1 and patient 3, as seen in Figure 1 a in Figure 1 and Figure 1 e in Figure 1 However, Leishmania were relatively rare in the bone marrow of patient 2, as seen in Figure 1 d in Figure 1 f in

[0051] Table 1 Pathogen examinations of three children

[0052]

[0053] In the experiment of the present invention, all 3 children were diagnosed with VL-HLH 3 - 5 days after bone marrow smear microscopy. After treatment with specialized drugs and treatment regimens, patient 1 and patient 3 recovered and were discharged soon. However, due to the low Leishmania load in patient 2, misdiagnosis occurred in other hospitals in the early stage, resulting in untimely diagnosis and the occurrence of severe drug eruption on the 10th day of treatment and multiple organ failure on the 13th day of treatment, and finally patient 2 died. Therefore, for this rare disease of VL-HLH, which is prone to misdiagnosis, missed diagnosis and has a high mortality rate, rapid and accurate diagnosis and timely symptomatic treatment are the keys to avoiding death.

[0054] 3. Gene extraction, amplification and sequencing.

[0055] 3.1 Leishmania DNA extraction: The bone marrow samples on the bone marrow smears of 3 children were rinsed off with 0.01 mol / L PBS respectively, and the eluates were collected and centrifuged at 12,000 r / min for 5 min. The supernatant was discarded, 500 μL of deionized water was added, and centrifuged at 12,000 r / min for 2 min. The supernatant was discarded, and the above operation was repeated 2 times to wash the samples. 500 μL of lysis buffer (100 mM Tris–HCl, pH 8.0; 100 mM EDTA; 100 mM NaCl), 1% SDS and 4 μL of 10 mg / mL proteinase K (Sigma) were added to each sample, and incubated overnight at 37 °C. Then an equal volume of phenol-chloroform was added for extraction. After centrifugation, the aqueous phase was taken and 2 volumes of absolute ethanol were added to precipitate DNA. The DNA precipitate was washed with 70% ethanol, air-dried, and 50 μL of deionized water was added to fully dissolve the DNA, which was stored at -20 °C for later use.

[0056] 3.2 ITS-1 amplification:

[0057] PCR primers were designed with the ITS-1 gene as the amplification region. The upstream primer sequence was (F: 5 / to3 / ): CTGGATCATTTTCCGATG (SEQ ID NO.6), and the downstream primer sequence was (R: 5 / to3 / ): TGATACCACTTATCGCACTT (SEQ ID NO.7). The reaction system was: 1 μL of upstream and downstream primers respectively, 25 μL of 2×PCR Master Mix (purchased from TAKARA, Beijing, China), 4 μL of DNA template (40 ng / μL), 19 μL of sterile deionized water, with a total volume of 50 μL. The reaction conditions were: 94 °C for 2 min, 94 °C for 30 sec, 52 °C for 30 sec, 72 °C for 1 min, 35 cycles, and incubation at 72 °C for 1 min. The amplified products were electrophoresed on 1% agarose gel, and the size of the target band was observed on a gel imager.

[0058] As Figure 2 in c, no specific band was produced for the PCR of IST-1.

[0059] 3.3 kDNA amplification:

[0060] Using the Leishmania kDNA minicircle gene sequence as a template, PCR amplification primers were designed. The upstream primer sequence (F: 5' to 3') was: GGCAAGCTTCTTTTCTGGTCCCGCGGGTAGG (SEQ ID NO.1), and the downstream primer sequence (R: 5' to 3') was: GGCGGATCCCCACCTGGCCTATTTTACACCA (SEQ ID NO.2). The reaction system was as follows: 1 µL of each of the upstream and downstream primers, 25 µL of 2×PCR Master Mix (purchased from TAKARA, Beijing, China), 4 µL of DNA template (40 ng / µL), and 19 µL of sterile deionized water, with a total volume of 50 µL. The reaction conditions were: 94°C for 2 min, 94°C for 30 sec, 56°C for 30 sec, 72°C for 15 sec, for 35 cycles, and then incubation at 72°C for 1 min. The amplified product was electrophoresed on a 1% agarose gel, and the size of the target band was observed using a gel imager. The target band was recovered and purified according to the instructions of the kit (the gel recovery kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0061] By performing kDNA-targeted PCR amplification on the DNA extracts from the bone marrow smears of 3 children, specific bands were amplified in all 3 children for the kDNA PCR, and the band size was 139 bp. The results are shown in Figure 2 a in

[0062] 3.4 Gene cloning and sequencing:

[0063] Both the PCR amplification product after gel recovery and purification and the PCDND3.1(+) plasmid were double-digested with BamHI and HindIII (purchased from TAKARA, Beijing, China). The digested products were again subjected to gel recovery and purification, and then the digested PCR fragment and the plasmid were ligated using T4 ligase. The specific operation was carried out according to the instructions of the T4 ligase kit (TAKARA, Beijing, China). The ligation product was transformed into Escherichia coli DH5α cells, and the cells were spread on an LB medium (Luria-Bertani) plate containing ampicillin and cultured overnight. The next day, colonies were selected, cultured in LB culture medium, and then identified by PCR using the above primers. The PCR-positive clones were sent to Sangon Biotech Co., Ltd. (Shanghai, China) for sequencing.

[0064] The results showed that after double-digesting the kDNA amplification product with BamHI and HindIII and cloning it into the PCDNA3.1(+) vector, and transforming Escherichia coli, specific bands of the same size could still be amplified in the colonies. The results are shown in Figure 2 b in

[0065] Homotypic analysis was performed on the kDNA PCR amplification sequences from three cases. The results showed that the homology between case 1 and case 2, case 1 and case 3, and case 2 and case 3 was 97.84%, 87.14%, and 87.77% respectively. Among them, the homology between case 1 and case 2 was the highest (97.84%). The results are shown in Figure 3 .

[0066] 3.5 Sequence identity analysis and phylogenetic tree construction.

[0067] Three sequences were submitted to GenBank respectively to obtain accession numbers, and each sequence was input into NCBI for alignment. A total of 11 sequences with higher homology (higher than 93%) to each sequence were downloaded, and the homology between these sequences and the three sequences was compared using Snapgene software (version 5.3). All sequences were imported into MEGA 11 software, and the neighbor-joining analysis method was used to construct a phylogenetic tree. At the same time, the Bootstraping (Bootstraping = 1000) method was used to evaluate the phylogenetic tree.

[0068] The PCR amplification sequences of kDNA from 3 children were submitted to the Genbank database to obtain accession numbers, which were OR134573, OR134574, and OR134575 respectively. After alignment in the NCBI database, the results showed that all 3 children belonged to the genus Leishmania. At the same time, 11 sequences with homology higher than 93% were obtained, including two species: Leishmania donovani and Leishmania infantum; these sequence samples were from India, Nepal, Tunisia, China, and Italy. The detailed information is shown in Table 2. The homology comparison between these sequences by Snapgene showed that the homology between the sequences of patient 1 and patient 2 and other sequences was consistent, and the homology between the sequence of patient 3 and other sequences was quite different from that of patient 1 and patient 2. The detailed information is shown in Table 3. Using freshwater fish trypanosomes (S82515) as the outgroup and (MHOM / IN / 80 / DD8, AF167712) as the WHO reference strain of Leishmania donovani, a phylogenetic tree was constructed for the 3 case sequences and these highly homologous sequences using MEGA11 software. The results showed that all sequences were clustered under the genus Leishmania, which was consistent with the results of bone marrow smear microscopy. Among them, patient 1 and patient 2 belonged to Leishmania donovani, but they were clustered into a separate group, while patient 3 belonged to Leishmania infantum and was relatively close to Leishmania infantum (HQ585885) in China. The results are shown in Figure 4 .

[0069] Table 2 Details of Leishmania for phylogenetic tree construction

[0070]

[0071] Table 3 Homology Alignment among Each Sequence

[0072]

[0073] 3.6 qPCR Detection:

[0074] Forward primer (F: 5' / to 3'): CGGGTAGGGGCGTTCTGC (SEQ ID NO.3), reverse primer (R: 5' / to 3'): CCTGGCCTATTTTACACCAACC (SEQ ID NO.4), probe (TaqMan-P, 5' / to 3'): CCGAAAAATGGGTGCAGAAATCCCGTTCA (SEQ ID NO.5). Using the DNA extract of each case as a template for real-time fluorescence quantitative PCR, the reaction system is as follows: Probe qPCR Mix(2×) 10µL (purchased from TAKARA, Beijing, China), forward primer (10µM) 0.4µL, reverse primer (10µM) 0.4µL, Probe 0.8µL, ROX Reference Dye(50×) 0.4µL (purchased from TAKARA, Beijing, China), DNA template 2µL, sterilized water 6µL, with a total volume of 20µL. The reaction system is: 95°C for 5s, 60°C for 34s (fluorescence signal collection), for a total of 40 cycles. Among them, using the cloned plasmid of case 1 as a standard product (starting copy number is 1×10 8 ), and performing 10-fold serial dilution of the standard product, which are respectively denoted as: A: 1×10 8 copies / μL, B: 1×10 7 copies / μL, C: 1×10 6 copies / μL, D: 1×10 5 copies / μL, E: 1×10 4 copies / μL, F: 1×10 3 copies / μL, G: 1×10 2 copies / μL, H: 10 copies / μL. Each dilution standard product is repeated in 2 wells, each case sample is repeated in 3 wells, and in addition, using the normal bone marrow DNA extract as a negative control (denoted as CK).

[0075] Such as Figure 5As shown, the green is the amplification curve of Patient 3's sample, the red is the amplification curve of Patient 1's sample, and the black is the amplification curve of Patient 2's sample. It can be seen that all three children have obvious amplification curves after qPCR amplification, while there is no amplification curve in the negative control. The average cq values of Patients 1, 2, and 3 are 28.09±0.27, 33.23±0.16, and 23.34±0.23 respectively. After quantification with the standard product, the average copy numbers of Leishmania kDNA in the samples of the three children are 3830 copies / µL, 150 copies / µL, and 77168 copies / µL respectively. Among them, the copy number in Patient 3 is the highest. The results are shown in Figure 6 .

[0076] To further explore the sensitivity of qPCR, the sample of Patient 2 was further diluted to theoretical copy numbers of 30 copies / µL, 6 copies / µL, and 1.2 copies / µL respectively. Seven dilution degrees of the standard product were selected: A: 1×10 8 copies / μL, B: 1×10 7 copies / μL, C: 1×10 6 copies / μL, D: 1×10 5 copies / μL, E: 1×10 4 copies / μL, F: 1×10 3 copies / μL, G: 1×10 2 copies / μL. The qPCR program was the same as in step 3.6.

[0077] As Figure 7 shown, the amplification results indicate that all seven concentrations of the standard product have good amplification curves and good linearity (R 2 =0.9994).

[0078] As Figure 8 shown, when the sample of Patient 2 was diluted to a copy number of 30 copies / µL (blue curve) and 6 copies / µL (black curve), there were obvious amplification curves. However, when diluted to a copy number of 1.2 copies / µL (green curve), 2 out of 3 replicate wells amplified successfully and 1 well amplified failed, indicating that the sensitivity of the qPCR provided by the present invention is at least 6 copies / µL.

[0079] The method for detecting Leishmania in VL-HLH by using primer set 1 and primer set 2 provided by the present invention is an efficient, sensitive and highly accurate diagnostic method. In clinical practice, when the clinical symptoms highly suspect VL-HLH and Leishmania is not detected in the initial bone marrow sampling, the primer set provided by the present invention should be considered for detection as early as possible to assist clinical diagnosis and treatment.

[0080] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A primer for detecting Leishmania infection in infants and young children, characterized in that: Includes primer set 2; In the primer set 2, the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3, the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4, and the probe has a nucleotide sequence as shown in SEQ ID NO.5; The amplification system for quantitatively detecting the kDNA content of Leishmania in samples using primer set 2 was as follows: 2×Probe qPCR Mix 10µL, 0.4µL of upstream and downstream primers of primer set 2, 0.8µL of probe of primer set 2, 0.4µL of 50×ROX Reference Dye, 2µL of DNA template, and 6µL of water; the amplification program was: 95°C 5s, 60°C 34s, for a total of 40 cycles.

2. A reagent for detecting Leishmania infection in infants and young children, characterized in that: The reagent comprises the primer according to claim 1.

3. Use of the primer according to claim 1 or the reagent according to claim 2 in the preparation of a product for detecting Leishmania infection in infants and young children.

4. The use according to claim 3, characterized in that: The primers according to claim 1 or the reagents according to claim 2 are used to perform PCR amplification on the object to be detected.

5. The use according to claim 4, characterized in that: The amplification system for quantitatively detecting the kDNA content of Leishmania in the sample using primer set 2 is: 2×Probe qPCR Mix 10µL, 0.4µL each of the upstream and downstream primers of primer set 2 described in claim 1, 0.8µL of the probe of primer set 2 described in claim 1, 0.4µL of 50×ROX Reference Dye, 2µL of DNA template, and 6µL of water.

Images