Nucleic acid molecule for coding tumor shared antigen epitope peptide and application of nucleic acid molecule

Abstract

The invention discloses a nucleic acid molecule for coding a tumor shared antigen epitope peptide and application of the nucleic acid molecule. The nucleic acid molecule contains one or more open reading frames, and the antigen epitope nucleic acid sequences in the open reading frames comprise any one or a combination of at least two of the sequences shown in SEQ ID NO.1-SEQ ID NO.192. The nucleic acid molecule provided by the invention can encode human or mouse tumor shared antigen epitope peptide, and has significant antigen-specific T cell activation level and tumor preventive effect. The prophylactic mRNA tumor vaccine prepared from the nucleic acid molecule is more flexible in preparation design, simpler in large-scale production and lower in cost compared with a prophylactic polypeptide vaccine.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine and mRNA tumor vaccine, and relates to a nucleic acid molecule encoding a tumor shared antigen epitope peptide and an application thereof. Background Art

[0002] Tumors are insidious in their onset and difficult to treat in the late stages, so “prevention before it happens” is an important strategy to reduce the burden of cancer. In recent years, the development of HPV and HBV vaccines has successfully reduced the incidence of cervical cancer and liver cancer related to viral infections. However, most malignant tumors are not caused by infection. Unlike the development of virus-related preventive vaccines, which have clear viral capsid proteins as vaccine antigen components, the genomic characteristics of non-infectious malignant tumors are extremely diverse and unpredictable. The development of universal antigens with high universality is a key goal of preventive tumor vaccine research. Recently, researchers have screened out a group of tumor-shared antigen epitopes through the shared phenotypes of stem cells and tumor cells, and verified the good immune effects and tumor prevention effects of these epitope peptides.

[0003] Directly encoding antigens in vivo based on mRNA coding is currently a vaccine technology with great potential. Its simplicity of design and preparation, inherent immunogenicity, rapid mass production and negligible insertion mutagenesis have deeply attracted some researchers. The rapid approval of anti-infection mRNA vaccines and their widespread use in the population have further verified the safety and effectiveness of this vaccine formulation. However, the tumor shared antigen epitope peptides obtained by this technology have low specificity and large molecular weight, and cannot be targeted to prevent or treat specific tumors.

[0004] Therefore, there is an urgent need to provide a nucleic acid molecule encoding a shared antigen epitope peptide of human or mouse tumors and its application. Summary of the invention

[0005] In view of the deficiencies in the prior art and actual needs, the present invention provides a nucleic acid molecule encoding a tumor shared antigen epitope peptide and its application. The nucleic acid molecule of the present invention can encode a tumor shared antigen epitope peptide of human or mouse origin, and has a significant antigen-specific T cell activation level and tumor preventive effect.

[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a nucleic acid molecule encoding an antigen epitope peptide shared by human or mouse tumors, wherein the antigen epitope nucleic acid sequence in the open reading frame includes any one or a combination of at least two of the sequences shown in SEQ ID NO.1-SEQ ID NO.192.

[0008] The nucleic acid molecules of the present invention can encode human or mouse tumor shared antigen epitope peptides, and have significant antigen-specific T cell activation levels and tumor preventive effects. The preventive mRNA tumor vaccine prepared using the nucleic acid molecules of the present invention is more flexible in formulation design than the preventive polypeptide vaccine, and is simpler to mass produce and has lower costs.

[0009] The RNA sequences corresponding to the human polypeptide antigen epitopes are shown in Table 1. The RNA sequences corresponding to the mouse polypeptide antigen epitopes are shown in Table 2.

[0010] Table 1

[0011]

[0012]

[0013]

[0014]

[0015]

[0016] Table 2

[0017]

[0018]

[0019] In the present invention, the antigen epitope sequences in the ORF nucleic acid can be combined arbitrarily, in any proportion and in any order. Multiple antigen epitope sequences are connected by linker nucleic acid sequences, which can encode amino acid sequences such as AAY, GPGPG, A(EAAAK)nA, KK, T2A, P2A, E2A, F2A, RRKR, GFLG, (G4S)n, (GS)n, etc., and can include one or more combinations.

[0020] Preferably, the nucleic acid molecule further comprises a 5' cap, a 5' UTR, a 3' UTR and poly-A.

[0021] Preferably, the 5' cap comprises any one of m7G5'ppp5'Np, m7G5'ppp5'NmpNp or m7G5'ppp5'NmpNmpNp.

[0022] Preferably, the nucleic acid sequence of the 5'UTR includes any one of the sequences shown in SEQ ID NO.193-SEQ ID NO.201.

[0023] SEQ ID NO.193:

[0024] AGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC。

[0025] SEQ ID NO.194:

[0026] GGGCGAACUAGUACUCUUCUGGUCCCCACAGACUCGCCACC。

[0027] SEQ ID NO.195:

[0028] UCUCAACACAACAUAUACAAAACAAACGAAUCUCAAGCAAUCAAGCAUUCUACUUCUAUUG CAGCAAUUUAAAUCAUUUCUUUUAAAGCAAAAGCAAUUUUCUGAAAAUUUUCACCAUUUACGAA CGAUAGC。

[0029] SEQ ID NO.196:

[0030] AAGUUGAAAGUCGCCGCUGACAGUUGUGACCAGGAUCGGACAGGUGAAC。

[0031] SEQ ID NO.197:

[0032] ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACACC。

[0033] SEQ ID NO.198:

[0034] ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACC。

[0035] SEQ ID NO.199:

[0036] ACUCCCCGAACCACUCAGGGUCCUGUGGACAGCUCACCUAGCUGCA。

[0037] SEQ ID NO.200:

[0038] AUAAACGCUCAACUUUGGCC。

[0039] SEQ ID NO.201:

[0040] AAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC。

[0041] Preferably, the nucleic acid sequence of the 3’UTR includes any one of the sequences shown in SEQ ID NO.202 - SEQ ID NO.211.

[0042] SEQ ID NO.202:

[0043] GCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUU CCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGA。

[0044] SEQ ID NO.203:

[0045] GCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGCGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUUAUUUUCAUUGC。

[0046] SEQ ID NO.204:

[0047] CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC。

[0048] SEQ ID NO.205:

[0049] GCUCGCUUUCUUGCUGCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACU AAACUGGGGGAUAUAUAUGAAGGGCCUUGAGCAUCUGGAUCUGCCUAAAUAAAAACAUUUAUU UUCAUUGC。

[0050] SEQ ID NO.206:

[0051] GCAGCUCGACGCCCGUUCGCUUGGUUCUGCCUGAUAUACCAUCCAGUCGGGUGUGGGCCGUUACCACACCGGUGAAUAGUUACCUGAGCUUGGUCAAACCUGGAAACAUGUUGGUUCCACACCUUCAUAUCUCAGGCAGCAGAAAAACAUGAAGGAUAAGUGAAACGCCUGCACUGAUAAAUCAAAGAAGAGGGUAAAUGAAGGUCAUAUUUUUUCUGAAAAUGCAUAAUAAAUAUUUUUUUUUUUUAAUAUAUAUAUAC UACUGUAUAGAGAGAGAGGCGUCCAUGGCAUUAUUGCUGCUGAGUGACAGCUUAAGUUCAACCCAGGACAGGACUGCUGAUCCAGCUGUGCUGAUCCAUUUUUAUUGUAUUACCAGAAAUACACGUUAACAGUAAUUUUUUACAAUAUAAACAUGAGUGUUGUGUAUUUUCUAGAAGUUUACCGCCUUUUUUUGACAUUAGCUUUUUUCUCAUUUUUUUUGUAAUAAAUCUCUUGGCUC.

[0052] SEQ ID NO.207:

[0053] GCUCGCUUUCUUGCUGCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACU AAACUGGGGGAUAUAUAUGAAGGGCCUUGAGCAUCUGGAUCUGCCUAAAUAAAAACAUUUAUU UUCAUUGCAA。

[0054] SEQ ID NO.208:

[0055] GCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUU CCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCA。

[0056] SEQ ID NO.209:

[0057] CUGCCCGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCAC UCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAU。

[0058] SEQ ID NO.210:

[0059] ACCAGCCUCAAGAACACCCGAAUGGAGUCUCUAAGCUACAUAAUACCAACUUACACUUUAC AAAAUGUUGUCCCCCAAAAUGUAGCCAUUCGUAUCUGCUCCUAAUAAAAAGAAAGUUUCUUCAC A。

[0060] SEQ ID NO.211:

[0061] CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC。

[0062] Preferably, the nucleic acid sequence of the poly-A includes the sequence shown in SEQ ID NO.212 or SEQ ID NO.213.

[0063] SEQ ID NO.212:

[0064] AAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0065] SEQ ID NO.213:

[0066] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0067] In a second aspect, the present invention provides a nucleic acid construct, wherein the nucleic acid construct comprises the nucleic acid molecule described in the first aspect.

[0068] Preferably, the nucleic acid construct further contains one or more modified nucleosides.

[0069] Preferably, the modified nucleoside comprises any one or a combination of at least two of pseudoguanosine, N1-methyl-pseudoguanosine or 5-methylcytidine.

[0070] In a third aspect, the present invention provides an expression vector, wherein the expression vector contains the nucleic acid molecule described in the first aspect or the nucleic acid construct described in the second aspect.

[0071] In a fourth aspect, the present invention provides a recombinant cell, wherein the recombinant cell contains the nucleic acid molecule described in the first aspect, the nucleic acid construct described in the second aspect, or the expression vector described in the third aspect.

[0072] In a fifth aspect, the present invention provides a pharmaceutical composition, which contains the nucleic acid molecule described in the first aspect or the nucleic acid construct described in the second aspect or the expression vector described in the third aspect or the recombinant cell described in the fourth aspect.

[0073] In a sixth aspect, the present invention provides use of the nucleic acid molecule described in the first aspect, the nucleic acid construct described in the second aspect, the expression vector described in the third aspect, the recombinant cell described in the fourth aspect, or the pharmaceutical composition described in the fifth aspect in the preparation of a product for preventing or treating tumors.

[0074] Compared with the prior art, the present invention has the following beneficial effects:

[0075] The nucleic acid molecules of the present invention can encode human or mouse tumor shared antigen epitope peptides, and have significant antigen-specific T cell activation levels and tumor preventive effects. The preventive mRNA tumor vaccine prepared using the nucleic acid molecules of the present invention is more flexible in formulation design than the preventive polypeptide vaccine, and is simpler to mass produce and has lower costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] Figure 1 This is a flow cytometry test result diagram after treatment with LNP-mRNA vaccine containing Vax1, Vax2, Vax5, and Vax6;

[0077] Figure 2 This is a flow cytometry test result diagram after treatment with LNP-mRNA vaccine containing Vax3, Vax4, Vax7, and Vax8;

[0078] Figure 3 This is a graph showing the survival results of mice treated with LNP-mRNA vaccines containing Vax1, Vax2, Vax5, and Vax6;

[0079] Figure 4 This is a graph showing the survival results of mice treated with LNP-mRNA vaccines containing Vax3, Vax4, Vax7, and Vax8;

[0080] Figure 5 This is a flow cytometry test result diagram after treatment with LNP-mRNA vaccine containing Vax9 and Vax10;

[0081] Figure 6 This graph shows the survival results of mice treated with LNP-mRNA vaccine containing Vax9 and Vax10. DETAILED DESCRIPTION

[0082] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0083] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0084] The present invention uses the ORF region of six peptides in series as an example. The following description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art who is familiar with the present technical field can easily think of changes or substitutions within the technical scope disclosed in the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

[0085] Preparation Example 1

[0086] This preparation example provides nucleic acid molecules including Vax1, Vax2, Vax3, Vax4, Vax5, Vax6, Vax7, Vax8, Vax9 and Vax10.

[0087] Vax1 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence. Linker is GSG. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.214, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.202, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.212.

[0088] Vax2 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence. Linker is GSG. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.214, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.203, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.213.

[0089] Vax3 is composed of the ORFs shown in SEQ ID NO.192, SEQ ID NO.188, SEQ ID NO.184, SEQ ID NO.190, SEQ ID NO.186 and SEQ ID NO.182, which are connected in series in sequence. Linker is GSG. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.215, the nucleic acid sequence of 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of 3'UTR is shown in SEQ ID NO.202, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.212.

[0090] Vax4 is composed of the ORFs shown in SEQ ID NO.192, SEQ ID NO.188, SEQ ID NO.184, SEQ ID NO.190, SEQ ID NO.186 and SEQ ID NO.182, which are connected in series in sequence. Linker is GSG. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.215, the nucleic acid sequence of 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of 3'UTR is shown in SEQ ID NO.203, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.213.

[0091] Vax5 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence. The linker is LKDFLRNL. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.216, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQID NO.202, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.212.

[0092] Vax6 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence. The linker is LKDFLRNL. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.216, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQID NO.203, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.213.

[0093] Vax7 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence. Linker is AAY. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.217, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.202, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.212.

[0094] Vax8 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence. Linker is AAY. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.217, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.203, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.213.

[0095] Vax9 is composed of the ORFs shown in SEQ ID NO.182, SEQ ID NO.184, SEQ ID NO.186, SEQ ID NO.188, SEQ ID NO.190 and SEQ ID NO.192, which are connected in series in sequence, without a linker. The nucleic acid sequence of the connected ORF is shown in SEQ ID NO.218, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.202, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.213.

[0096] Vax10 is composed of the ORFs shown in SEQ ID NO.181, SEQ ID NO.183, SEQ ID NO.185, SEQ ID NO.187, SEQ ID NO.189 and SEQ ID NO.191, which are connected in series in sequence. Linker is GSG. The nucleic acid sequence of the concatenated ORF is shown in SEQ ID NO.219, the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.193, the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.202, the 5' cap is m7G5'ppp5'Np, and the PolyA sequence is SEQ ID NO.213.

[0097] SEQ ID NO.214 (Vax1, Vax2):

[0098] AUGGGCUCCUCUCUGCUCUGCUGCUGGCCGUGACUGCCCCUCAGGAGAGUAAGCCUGCUGCCAGUGAUGCAGCAUCUGGGUAGCGGUGAUAUCUAUGCCUACCGGCAGCUGGGUAGCGGUUACGUGAA GGACAUCUAUGCCUAUUUGGGUAGCGGUAAGGUGGUGGAGCGGCUGCUGAGCCUGGGUAGCGGUCUGUUGAAGGACUUCUUGCGGAACCUGGGUAGCGGUAGCUCCAUCCUGCUGCUGCAGCAGAUG.

[0099] SEQ ID NO.215 (Vax3, Vax4):

[0100] AUGGGCUCCUCUCUGCUCUGCUGCUGGCCGUGACUGCCCCUCAGGAGAGUAAGCUCCAUCCUGCUGCUGCAGCAGAUGGGUAGCGGUAAGGUGGUGGAGCGGCUGCUGAGCCUGGGUAGCGGUGAUAUCUAUGCCUACCGGCAGCUGGGUAGCGGUCUGUUGAAGGACUUCUUGCGGAACCUGGGUAGCGGUUACGUGAAGGACAUCUAUGCCUAUUUGGGUAGCGGUAGCCUGCUGCCAGUGAUGCAGCAUCUG。

[0101] SEQ ID NO.216(Vax5,Vax6):

[0102] AUGGGCUCCUCUCUGCUCUGCUGCUGGCCGUGACUGCCCCUCAGGAGAGUAAGCCUGCUGCCAGUGAUGCAGCAUCUGGCUACCAACUUCAGCCUGCUGAAGCAGGCUGGUGACGUCGAGGAGAACCCCGGUCCCGAUAUCUAUGCCUACCGGCAGCUGGCUACCAACUUCAGCCUGCUGAAGCAGGCUGGUGACGUCGAGGAGAACCCCGGUCCCUACGUGAAGGACAUCUAUGCCUAUUUGGCUACCAACUUCAGCCUGCUGAAGCAGGCUGGUGACGUCGAGGAGAACCCCGGUCCCAAGGUGGUGGAGCGGCUGCUGAGCCUGGCUACCAACUUCAGCCUGCUGAAGCAGGCUGGUGACGUCGAGGAGAACCCCGGUCCCCUGUUGAAGGACUUCUUGCGGAACCUGGCUACCAACUUCAGCCUGCUGAAGCAGGCUGGUGACGUCGAGGAGAACCCCGGUCCCAGCUCCAUCCUGCUGCUGCAGCAGAUG。

[0103] SEQ ID NO.217(Vax7,Vax8):

[0104] AUGGGCUCCUCUCUGCUCUGCUGCUGGCCGUGACUGCCCCUCAGGAGAGUAAGCCUGCUGCCAGUGAUGCAGCAUCUGGCUGCUUACGAUAUCUAUGCCUACCGGCAGCUGGCUGCUUACUACGUGAAGGACAUCUAUGCCUAUUUGGCUGCUUACAAGGUGGUGGAGCGGCUGCUGAGCCUGGCUGCUUACCUGUUGAAGGACUUCUUGCGGAACCUGGCUGCUUACAGCUCCAUCCUGCUGCUGCAGCAGAUG。

[0105] SEQ ID NO.218: (Vax9)

[0106] AUGGGCUCCUCUCUGCUCUGCUGCUGGCCGUGACUGCCCCUCAGGAGAGUAAGCCUGCUGCCAGUGAUGCAGCAUCUGGAUAUCUAUGCCUACCGGCAGCUGUACGUGAAGGACAUCUAUGCCUAUUUGAAGGUGGUGGAGCGGCUGCUGAGCCUGCUGUUGAAGGACUUCUUGCGGAACCUGAGCUCCAUCCUGCUGCUGCAGCAGAUG。

[0107] SEQ ID NO.219: (Vax10)

[0108] AUGGGCUCCUCUCUGCUCUGCUGCUGGCCGUGACUGCCCCUCAGGAGAGUAAGUCUGCUGCCCGUAAUGCAGCACCUGGGUAGCGGUGAUAUCUACGCCUACCGGCAACUCGGUAGCGGUUAUGUUAAGGAUAUCUACGCCUACCUCGGUAGCGGUAAAGUGGUCGAGAGACUGCUUUCCUUGGGUAGCGGUCUGUUGAAAGACUUUCUUAGAAAUUUGGGUAGCGGUAGUUCCAUUCUUCUGCUGCAGCAGAUG。

[0109] Example 1

[0110] Construction of liposome - mRNA vaccine (LNP - mRNA vaccine).

[0111] Take the synthesized mRNA with complete structure (including 5' cap and PolyA sequence), including Vax1, Vax2, Vax3, Vax4, Vax5, Vax6, Vax7, Vax8, Vax9 and Vax10, each dissolved in 1mL of enzyme-free water to prepare a 1mg / mL mRNA solution for use; SM102 (Dlin-MC-DMA), cholesterol, DSPC, DMG-PEG2000 four lipids are dissolved in ethanol, and a lipid mixture with a final concentration of 10mM is prepared at a molar ratio of SM102: cholesterol: DSPC: DMG-PEG2000 = 50:38:10:2. The aqueous phase containing mRNA is quickly injected into the lipid-containing ethanol phase, the volume of the aqueous phase is 3:1 to the volume of the ethanol phase, and the mixture is quickly and continuously blown and mixed. After standing at room temperature for 1h, the excess ethanol is removed from the system using a dialysis bag with a molecular weight cutoff of 10kDa to obtain an LNP-encapsulated mRNA vaccine. The laser particle size meter was used to characterize the hydrated particle size and surface potential of the vaccine. The hydrated particle size and surface potential results of different LNP-mRNA vaccines are shown in Table 3.

[0112] Table 3

[0113]

[0114]

[0115] The results show that 10 types of LNP-mRNA nanovaccines were successfully synthesized, with a hydrated particle size of about 120nm and a negative surface potential.

[0116] Example 2

[0117] Detection of antigen-specific effects of LNP-mRNA vaccines.

[0118] The present invention uses 6-8 week old female C57 mice for evaluation. On the first and seventh days, the LNP-mRNA obtained in Example 1 was inoculated subcutaneously into the right back of the mice. Each vaccine dose was inoculated with 200 g mRNA. On the fourteenth day, the mice were killed by the carbon dioxide method and the spleen was removed. The spleen was ground into a single cell suspension and 1×10 6 / well were seeded into 48-well plates, and the cells were cultured in an environment with 5% carbon dioxide at 37°C supplemented with RPMI1640 medium containing 10% FBS. 5g of antigen peptides, including SLLPVMQHL, DIYAYRQL, YVKDIYAYL, KVVERLLSL, LLKDFLRNL or SSILLLQQM, were added to each well and cultured for 5 hours, and then Golgi inhibitors were added to block IFN-cytokine secretion. After 5 hours, the cells were collected, fixed with cell fixative, and then stained with anti-CD8 and anti-CD3 fluorescent antibodies. After washing away excess antibodies, the cells were permeabilized with the permeabilization solution, and fluorescently labeled anti-IFN- antibodies were added for intracellular staining. After staining, excess antibodies were washed away, and IFN-highly expressed CD8 was analyzed by flow cytometer. + T cell level, the results are as follows Figure 1 , Figure 2 and Figure 5 As shown, the mouse codon adaptation index (CAI) of the ORF mRNA sequence of Vax10 is less than 0.8, and Vax9 has no linker design, indicating that the LNP-mRNA vaccine can stimulate the immune system to produce specific responses to all six antigens, and exhibits enhanced antigen-specific T cell levels through designs such as codon optimization of mRNA sequences or introduction of linker connection sequences.

[0119] Example 3

[0120] Tumor prevention effect of LNP-mRNA vaccine.

[0121] In this example, a colon cancer model was constructed using 6-8 week old female C57 mice for evaluation. The LNP-mRNA obtained in Example 1 was inoculated subcutaneously on the right back of the mice. Each vaccine dose was 200 μg mRNA. A total of three immunizations were performed, each with an interval of 7 days. Then 1×10 6 MC38 tumor cells were inoculated subcutaneously into mice, and the tumorigenesis and survival of mice were observed. Figure 3 , Figure 4 and Figure 6 As shown, LNP-mRNA vaccines can prevent tumor occurrence, and the tumor prevention effect of vaccines can be improved by codon optimization of mRNA sequences or introduction of linker sequences.

[0122] In summary, the nucleic acid molecules of the present invention can encode human or mouse tumor shared antigen epitope peptides, and have significant antigen-specific T cell activation levels and tumor preventive effects. The preventive mRNA tumor vaccine prepared using the nucleic acid molecules of the present invention is more flexible in formulation design than the preventive polypeptide vaccine, and is simpler to mass produce and has lower costs.

[0123] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A nucleic acid molecule encoding a shared antigen epitope peptide of human or mouse tumors, characterized in that: The nucleic acid molecule contains one or more open reading frames, and the antigen epitope nucleic acid sequence in the open reading frame includes any one or a combination of at least two of the sequences shown in SEQ ID NO.1-SEQ ID NO.

192.

2. The nucleic acid molecule according to claim 1, characterized in that The nucleic acid molecule further comprises a 5' cap, a 5' UTR, a 3' UTR and poly-A.

3. The nucleic acid molecule according to claim 2, characterized in that The 5' cap includes any one of m7G5'ppp5'Np, m7G5'ppp5'NmpNp or m7G5'ppp5'NmpNmpNp.

4. The nucleic acid molecule according to claim 2 or 3, characterized in that The nucleic acid sequence of the 5'UTR includes any one of the sequences shown in SEQ ID NO.193-SEQ ID NO.201; Preferably, the nucleic acid sequence of the 3'UTR includes any one of the sequences shown in SEQ ID NO.202-SEQ ID NO.

211.

5. The nucleic acid molecule according to any one of claims 2 to 4, characterized in that The poly-A nucleic acid sequence includes the sequence shown in SEQ ID NO.212 or SEQ ID NO.

213.

6. A nucleic acid construct, characterized in that The nucleic acid construct contains the nucleic acid molecule according to any one of claims 1 to 5; Preferably, the nucleic acid construct further contains one or more modified nucleosides; Preferably, the modified nucleoside comprises any one or a combination of at least two of pseudoguanosine, N1-methyl-pseudoguanosine or 5-methylcytidine.

7. An expression vector, characterized in that: The expression vector contains the nucleic acid molecule according to any one of claims 1 to 5 or the nucleic acid construct according to claim 6.

8. A recombinant cell, characterized in that The recombinant cell contains the nucleic acid molecule according to any one of claims 1 to 5, the nucleic acid construct according to claim 6, or the expression vector according to claim 7.

9. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the nucleic acid molecule according to any one of claims 1 to 5, the nucleic acid construct according to claim 6, the expression vector according to claim 7, or the recombinant cell according to claim 8.

10. Use of the nucleic acid molecule according to any one of claims 1 to 5, the nucleic acid construct according to claim 6, the expression vector according to claim 7, the recombinant cell according to claim 8, or the pharmaceutical composition according to claim 9 in the preparation of a product for preventing or treating tumors.

Images