SNP molecular marker related to eimeria maduramycin resistance and application thereof

Abstract

The application provides an SNP molecular marker related to Eimeria maduramycin resistance and application thereof. The application crosses a maduramycin resistant Eimeria tenella strain with a sensitive Eimeria tenella strain, and backcrosses the maduramycin resistant Eimeria tenella strain with the sensitive Eimeria tenella strain to construct a maduramycin resistant gene introgression line strain. ETH2_0402100 It is found that a polymorphism mutation exists in the 1255th nucleotide of the gene, wherein C corresponds to a maduramycin sensitive phenotype, and T corresponds to a maduramycin resistant phenotype. Based on PCR identification results of field samples, the SNP molecular marker can accurately detect maduramycin resistance, and the results are consistent with cage feeding experiments. The application provides primers for detection and a method for screening a resistant strain by combining PCR technology, the method is simple in operation, short in time consumption, low in cost, and can be widely applied to clinical detection of chicken coccidium maduramycin resistance and drug use guidance.

Description

Technical Field

[0001] This invention belongs to the field of coccidia resistance detection technology, specifically, it relates to an SNP molecular marker related to maduramycin resistance in Eimeria coccidia and its application. Background Technology

[0002] Coccidiosis in chickens is an obligate intestinal parasitic disease caused by Eimeria tenella. This disease is characterized by high morbidity, strong infectivity, and high mortality, causing significant economic losses to the poultry industry. Eimeria tenella (… Eimeria Eimeria belongs to the phylum Apicocytoclita and includes seven currently identified and recognized species: *Eimeria tenella*, *Eimeria toxicaria*, *Eimeria scabra*, *Eimeria prematurei*, *Eimeria gianti*, *Eimeria brevicornuate*, and *Eimeria lendensis*. Different species of Eimeria parasitize different parts of the intestine, primarily damaging intestinal epithelial cells, leading to impaired digestion and absorption, reduced feed conversion ratio, and decreased production performance. Severe infections can cause intestinal hemorrhagic lesions, resulting in large-scale mortality in chicken flocks and severely impacting the economic benefits of poultry farms.

[0003] Currently, the control of coccidiosis in chickens mainly relies on drug treatment. Available anticoccidial drugs fall into two main categories: polyether ionotropic agents (such as monensin, salinomycin, maduramycin, naramycin, and lasalicin) and chemically synthesized agents (such as sulfaquinoxaline, sulfachlorpyrifos, diclazuril, toltrazuril, methyl methoxyquinate, benzyloxyquinate, chlorpyrifos, and chrysanthemumine). Due to the limited variety of anticoccidial drugs, long-term use has led to widespread drug resistance, seriously challenging the control of coccidiosis. However, current research on coccidial drug resistance is mostly limited to epidemiological surveys or omics analyses of differences between susceptible and resistant strains. Research on the mechanisms of anticoccidial drug resistance is scarce, which restricts further advancements in scientific control.

[0004] Maduramycin, the first microgram-level potent polyether ionocarrier anticoccidial drug, is widely used for the prevention and treatment of coccidiosis in livestock and poultry due to its broad anticoccidial spectrum, strong efficacy, and low dosage. Maduramycin was registered with the U.S. Food and Drug Administration (FDA) in 1987 and entered the Chinese veterinary drug market in the mid-1990s. However, just a few years later, reports of maduramycin-resistant strains emerged both domestically and internationally. Studies showed that the prevalence of maduramycin-resistant strains in chicken flocks in Guangdong Province was as high as 95.2%, severely weakening the drug's effectiveness. Elucidating the mechanism of maduramycin resistance is crucial for developing rapid detection methods and guiding rational clinical drug use. However, current understanding of the resistance mechanism remains insufficient, which has become a significant obstacle to the rational use of drugs in clinical practice.

[0005] Currently, the detection method for maduramycin resistance mainly relies on cage experiments, which has drawbacks such as being time-consuming, costly, and complex to operate. Therefore, there is an urgent need to develop a rapid and simple detection method to guide clinical drug use, assist in the scientific prevention and control of coccidiosis, and improve the production efficiency of farms. Summary of the Invention

[0006] The purpose of this invention is to provide an SNP molecular marker related to maduramycin resistance in Eimeria coccidia and its application, so as to facilitate rapid and accurate detection of maduramycin resistance in chicken coccidia.

[0007] The present invention also provides a kit and detection method based on the above-mentioned SNP molecular markers, which can be used to efficiently and cost-effectively screen chicken coccidia maduramycin-resistant strains, thereby guiding the scientific use of clinical anticoccidial drugs.

[0008] To achieve the objective of this invention, in a first aspect, this invention provides an SNP molecular marker associated with maduramycin resistance in Eimeria coccidia, wherein the SNP molecular marker contains a nucleotide sequence with a polymorphism of C / T at position 1255 of the sequence shown in SEQ ID NO:1 (N is C or T).

[0009] The SNP molecular marker has a polymorphic site of C, corresponding to maduramycin-sensitive strains, and a polymorphic site of T, corresponding to maduramycin-resistant strains.

[0010] Secondly, the present invention provides primer pairs for amplifying the SNP molecular marker of claim 1, comprising:

[0011] (1) Primer pairs Et (SEQ ID NO:2-3) suitable for detecting Eimeria tenella, specifically including:

[0012] Et-F: ATGCCGACTTCCACGCTAGGC;

[0013] Et-R: TCAGTCTGCTGTTGGCCCATC; and / or,

[0014] (2) Primer pair En (SEQ ID NO:4-5) suitable for detecting Eimeria coccidia, specifically including:

[0015] En-F: ATGCAGACTTCCACGCTAGGGCC;

[0016] En-R: TCAGTCTGCTGTTGACCCATCA; and / or,

[0017] (3) Primer pair Ea (SEQ ID NO:6-7) suitable for detecting Eimeria tenella, specifically including:

[0018] Ea-F: ATGGACCCAATGCCTCTCCGG;

[0019] Ea-R: CTAATGATCGATTCTCTTAAC; and / or,

[0020] (4) Primer pairs Ep (SEQ ID NO:8-9) suitable for detecting Eimeria prematura, specifically including:

[0021] Ep-F: ATGCACAGACCCGACAAGACGG;

[0022] Ep-R: TCAGTCAGCTTGCTCAGCGGGA; and / or,

[0023] (5) Primer pair Emwey (SEQ ID NO:10-11) suitable for detecting Eimeria giantis, specifically including:

[0024] Emwey-F:ATGCCTATCACAGACCATGAAC;

[0025] Emwey-R: TCAGTTCGGCCTGTTCATCAGTA; and / or,

[0026] (6) Primer pairs Eb (SEQ ID NO:12-13) suitable for detecting Eimeria brucellae, specifically including:

[0027] Eb-F:ATGCCGCCGGTTAACATCGAAG;

[0028] Eb-R: TCAGTCTGCCTCTTGAGCGATA; and / or,

[0029] (7) Primer pairs Em (SEQ ID NO:14-15) suitable for detecting and treating Eimeria coccidia, specifically including:

[0030] Em-F: ATGCCGCCCCTAAATCTTGAC;

[0031] Em-R:TCAGTCCACTTGTGTGCCGGT.

[0032] Thirdly, the present invention provides detection reagents or kits containing the primer pairs.

[0033] Fourthly, the present invention provides a method for identifying maduramycin resistance in Eimeria coccidia (including non-disease diagnosis and treatment purposes), the method comprising: extracting RNA from Eimeria coccidia to be tested, reverse transcribing it into cDNA, then using the cDNA as a template, performing PCR amplification using the primer pair or a detection reagent or kit containing the primer pair, and determining the maduramycin resistance of Eimeria coccidia to be tested based on the PCR amplification results.

[0034] Preferably, the PCR amplification reaction program is as follows: 95 °C for 3 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 15 s, 30 cycles; 72 °C for 10 min.

[0035] Furthermore, the method for determining the maduramycin resistance of the tested Eimeria coccidia includes: analyzing the single nucleotide polymorphism of the SNP molecular marker in the PCR amplification product, and determining whether the tested Eimeria coccidia has a drug-resistant or drug-sensitive phenotype based on the polymorphic sites.

[0036] If the SNP molecular marker has a C base at the polymorphic site, then the tested Eimeria coccidia has a maduramycin-sensitive phenotype; if the SNP molecular marker has a T base at the polymorphic site, then the tested Eimeria coccidia has a maduramycin-resistant phenotype.

[0037] Fifthly, the present invention provides the application of the SNP molecular marker or the primer pair or the detection reagent or kit containing the primer pair in screening maduramycin-resistant strains of chicken coccidia (including non-disease diagnosis and treatment purposes).

[0038] In a sixth aspect, the present invention provides the application of the SNP molecular marker or the primer pair or the detection reagent or kit containing the primer pair in guiding the use of anticoccidial drugs for chicken coccidiosis.

[0039] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0040] (i) The method for detecting maduramycin resistance in Eimeria provided by this invention is applicable to seven species of Eimeria: tender, toxic, clump-forming, giant, early-maturing, Brucella, and mild.

[0041] (ii) The SNP molecular marker provided by this invention has demonstrated high accuracy in detecting maduramycin resistance, and its detection results are in complete agreement with the identification results of traditional cage-rearing experiments. Therefore, this marker can serve as a reliable basis for screening and detecting maduramycin-resistant insect strains.

[0042] (III) The method for detecting coccidia maduramycin resistance provided by this invention has the advantages of high accuracy, short time consumption, low cost and simple operation, and can be widely used in the scientific prevention and control of chicken coccidiosis and the improvement of farm production efficiency. Attached Figure Description

[0043] Figure 1 In a preferred embodiment of the present invention, infiltrating strains were analyzed using genome resequencing ΔSNP-index to locate candidate regions of drug resistance genes. The red arrows indicate candidate regions of drug resistance genes located on chromosome 4.

[0044] Figure 2 In a preferred embodiment of the present invention, PCR detection of candidate gene mutation sites is performed, wherein M is a DNA marker, AL5000; lane 1 is strain H. ETH2_0402700 Lane 2 is strain H. ETH2_0402400 Lane 3 is strain H. ETH2_0402100 Lane 4 is for strain H. ETH2_0402600 Lane 5 is an MRR strain. ETH2_0402700 Lane 6 is an MRR strain. ETH2_0402400 Lane 7 is an MRR strain. ETH2_0402100 Lane 8 is an MRR strain. ETH2_0402600 .

[0045] Figure 3 This is a gel electrophoresis image of the PCR amplification products in a preferred embodiment of the present invention, where M is a DNA marker, AL5000; lane 1 is the amplification product using the Ea primer pair for detecting Eimeria tenella as primers and Eimeria tenella cDNA as template; lane 2 is the amplification product using the Et primer pair for detecting Eimeria tenella as primers and Eimeria tenella cDNA as template.

[0046] Figure 4 In a preferred embodiment of the present invention, mutation sites are detected by PCR in field samples, where M is a DNA marker, AL5000; lanes 1-11 represent field samples collected from different farms. Detailed Implementation

[0047] The present invention aims to provide an SNP molecular marker associated with maduramycin resistance in Eimeria coccidia, so as to facilitate rapid and accurate detection of maduramycin resistance in chicken coccidia.

[0048] The present invention also provides a kit and detection method based on the above-mentioned SNP molecular markers, which can be used to efficiently and cost-effectively screen chicken coccidia maduramycin-resistant strains, thereby guiding the scientific use of clinical anticoccidial drugs.

[0049] The present invention adopts the following technical solution:

[0050] This invention provides a SNP molecular marker associated with maduramycin resistance in *Eimeria tenella*, comprising a DNA fragment containing the nucleotide sequence shown in SEQ ID NO:1. This DNA fragment exhibits polymorphism at position 1255, characterized by a change in either base C or T:

[0051] The SNP molecular marker has a polymorphic site of C, corresponding to maduramycin-sensitive strains, and a polymorphic site of T, corresponding to maduramycin-resistant strains.

[0052] The SNP molecular markers of this invention can be rapidly detected using molecular biology techniques such as polymerase chain reaction (PCR), providing a reliable molecular tool for screening chicken coccidia for maduramycin resistance.

[0053] The present invention also provides a specific primer pair for amplifying SNP molecular markers associated with maduramycin resistance in the coccidia elegans, comprising:

[0054] The primer pair Et, suitable for detecting Eimeria tenella, has the following primer sequences (5′-3′):

[0055] Et-F: ATGCCGACTTCCACGCTAGGC;

[0056] Et-R: TCAGTCTGCTGTTGGCCCATC; and / or,

[0057] Primer pair En is suitable for detecting Eimeria tenella, and the primer sequences are as follows (5′-3′):

[0058] En-F: ATGCAGACTTCCACGCTAGGGCC;

[0059] En-R: TCAGTCTGCTGTTGACCCATCA; and / or,

[0060] Primer pair Ea is suitable for detecting Eimeria tenella, and the primer sequences are as follows (5′-3′):

[0061] Ea-F: ATGGACCCAATGCCTCTCCGG;

[0062] Ea-R: CTAATGATCGATTCTCTTAAC; and / or,

[0063] Primer pair Ep is suitable for detecting Eimeria prematura. The primer sequences are as follows (5′-3′):

[0064] Ep-F: ATGCACAGACCCGACAAGACGG;

[0065] Ep-R: TCAGTCAGCTTGCTCAGCGGGA; and / or,

[0066] The primer pair Emwey is suitable for detecting Eimeria giantis, and the primer sequences are as follows (5′-3′):

[0067] Emwey-F:ATGCCTATCACAGACCATGAAC;

[0068] Emwey-R: TCAGTTCGGCCTGTTCATCAGTA; and / or,

[0069] Primer pair Eb is suitable for detecting Eimeria brucelli, and the primer sequences are as follows (5′-3′):

[0070] Eb-F:ATGCCGCCGGTTAACATCGAAG;

[0071] Eb-R: TCAGTCTGCCTCTTGAGCGATA; and / or,

[0072] The primer pair Em, suitable for detecting mildly induced Eimeria coccidia, has the following primer sequences (5′-3′):

[0073] Em-F: ATGCCGCCCCTAAATCTTGAC;

[0074] Em-R:TCAGTCCACTTGTGTGCCGGT.

[0075] The present invention also provides a kit for detecting maduramycin resistance in Eimeria coccidia, the kit containing the above-mentioned primer pair for rapid and accurate detection of whether chicken coccidia have maduramycin resistance.

[0076] Specifically, the kit allows for the selection of appropriate primer pairs based on the species of coccidia to be detected. The kit also includes deionized water and PCR tubes. Other components, such as DNA polymerase, marker, and loading buffer, are commonly used laboratory reagents.

[0077] The present invention also provides a method for using the kit for detecting maduramycin resistance in Eimeria coccidia, including the steps of extracting cDNA from the sample of the target strain using conventional methods, and using the extracted cDNA as a template to perform PCR amplification using the kit, and determining the maduramycin resistance of the strain based on the PCR amplification results.

[0078] Specifically, in the detection method, the PCR reaction program is 95 °C for 3 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 15 s, 30 cycles; 72 °C for 10 min.

[0079] The method for determining whether chicken coccidia are maduramycin resistant based on the sequence of the PCR amplification product is as follows: if the nucleotide sequence corresponding to position 1255 of the sequence shown in SEQ ID NO:1 is C, then the chicken coccidia to be tested is a maduramycin-sensitive strain; if the nucleotide sequence corresponding to position 1255 of the sequence shown in SEQ ID NO:1 is T, then the chicken coccidia to be tested is a maduramycin-resistant strain.

[0080] The method for detecting maduramycin resistance in Eimeria provided by this invention is applicable to seven species of Eimeria: tender, toxic, clump-forming, giant, early-maturing, Brucella, and mild.

[0081] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0082] The instruments, equipment, and reagents involved in the following embodiments include:

[0083] PCR instrument, centrifuge, metal bath, 37 °C constant temperature shaker, 28 °C constant temperature shaker, gel electrophoresis instrument, gel imaging instrument are standard instruments and equipment;

[0084] The RNA extraction kit was purchased from Beijing TransGen Technology Co., Ltd.

[0085] The reverse transcription kit was purchased from Novizan Biosciences Co., Ltd.

[0086] pEASY-Blunt Simple Cloning Vector and competent Trans1-T1 cells were purchased from Beijing TransGen Biotech Co., Ltd.

[0087] The DNA molecular standard marker was purchased from Beijing Adley Biotechnology Co., Ltd.

[0088] Q5 high-fidelity DNA polymerase was purchased from NEB.

[0089] Percoll was acquired from Cytiva.

[0090] The glass beads were purchased from Sigma.

[0091] CTAB digestion solution and TAE buffer were prepared according to standard formulations.

[0092] Example 1: Construction of Eimeria coccidia maduramycin resistance gene introgression line

[0093] This embodiment uses *Eimeria tenella* as the research object and constructs drug-resistant gene-introduced strains using genetic hybridization and backcrossing strategies. The specific methods are as follows:

[0094] 1. Determination of parent strain drug resistance: The experiment was divided into two groups, each consisting of 5 coccidia-free AA broilers. The first group was inoculated with a laboratory-preserved drug-resistant strain of Eimeria tenella (MRR strain), and the second group was inoculated with the Eimeria tenella Howton strain (H strain). Each chicken was infected with 50,000 oocysts, and maduramycin (5 ppm) was added to the feed, starting two days before inoculation. Fecal samples were collected on day 5, and fresh feces from each group were collected daily from day 6 to day 12 using the "five-point sampling method" and tested using the saturated saline flotation method. If oocysts were detected, the strain was considered drug-resistant; if no oocysts were detected, the strain was considered susceptible.

[0095] 2. Crossbreeding of drug-resistant and susceptible parents: Three 3-week-old AA broilers were inoculated with 500 fresh MRR strain oocysts and 5000 fresh H strain oocysts, respectively. Fecal oocysts were collected on days 6-9 and designated as F1 generation. Three 4-week-old AA broilers were then infected with 10,000 F1 generation oocysts per broiler, and 5 ppm maduramycin was added to their feed. Fecal oocysts were collected on days 6-9 and designated as F2 generation. F2 generation oocysts exhibited maduramycin resistance. The experiment was designed with three replicates.

[0096] 3. Backcrossing and self-crossing of hybrid offspring: Simultaneously inoculate three 3-week-old AA broilers with 500 F2 generation oocysts and 5000 fresh H strain oocysts. Collect fecal oocysts from days 6-9, designated as generation BC1F1. Infect three 4-week-old AA broilers with 10,000 BC1F1 generation oocysts per broiler, adding 5 ppm maduramycin to their feed. Collect fecal oocysts from days 6-9, designated as generation BC1F2. Repeat the above backcrossing and self-crossing process twice to obtain drug-resistant introgression strains (F1, F2, BC1F1, BC1F2, BC2F1, BC2F2).

[0097] Example 2: Identification of SNP molecular markers associated with drug resistance

[0098] 1. DNA Template Preparation: Following standardized laboratory procedures, purified oocysts of maduramycin-resistant infiltrating strains were collected. 1 mm glass beads were added to the oocyst suspension, and the mixture was thoroughly shaken and centrifuged to retain the precipitate. 500 mL of CTAB lysis buffer and 40 μL of proteinase K were added to the precipitate, and the precipitate was dispersed. The centrifuge tube was placed in a 55 °C metal bath for 2-3 h for digestion. After the suspension returned to room temperature, 20 μL of RNase was added, and the centrifuge tube was placed in a 37 °C metal bath for further digestion for 30 min. After returning to room temperature, an equal volume of DNA extraction buffer was added, and the centrifuge tube was vigorously shaken. The supernatant was collected after centrifugation. The liquid was transferred to a new centrifuge tube, and an equal volume of pre-chilled isopropanol was added. The mixture was repeatedly inverted and mixed thoroughly, and incubated at -20 °C for at least 30 min. The precipitate was centrifuged at 4 °C and washed twice with 75% ethanol. After thorough evaporation, enzyme-free water preheated to 50 °C was added to dissolve the DNA precipitate. The DNA samples were stored at -80 °C.

[0099] 2. Genome Resequencing: Samples were sequenced and library constructed by Beijing Novogene Technology Co., Ltd. Sequencing depth for each sample was 100x. After extracting the genome from all infiltrating strains, the DNA samples were tested. Once qualified, the DNA was randomly fragmented using a Covaris ultrasonic disruptor, followed by end repair, A-tailing, sequencing adapter addition, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0 to dilute the library. Then, the insert fragments were detected using an Agilent 2100. Once the insert fragment size met expectations, the effective concentration of the library was accurately quantified using Q-PCR to ensure library quality. After the libraries passed the detection, different libraries were pooled into flowcells according to the effective concentration and target data volume requirements. After cBOT clustering, sequencing was performed using the Illumina HiSeq PE150 high-throughput sequencing platform.

[0100] 3. Bioinformatics Analysis: After filtering the data, quality control was performed. High-quality clean reads were aligned to the reference genome to extract reliable SNP marker information. Parameters were set, and SNP call was used to generate VCF files. ΔSNP-index analysis was performed using the QTLseqr software package to locate candidate regions of drug resistance genes on the chromosome. Figure 1 Then, the mutated genes within the interval were annotated using SnpEff software.

[0101] 4. Candidate Gene PCR Detection: To ensure the reliability of high-throughput sequencing results and avoid false positives due to sequencing errors, high-fidelity DNA polymerase was used to amplify genes within the candidate regions. A 1.0% agarose gel was prepared, and the electrophoresis conditions were set to 120 V for 15 min. After electrophoresis, the results were observed using gel imaging. Figure 2 The target band was excised from the gel and purified using a DNA gel extraction kit. The target band was then ligated into a pEASy-BluntSimple cloning vector (purchased from Beijing TransGen Biotech Co., Ltd.). Subsequently, the vector was transformed into competent Trans1-T1 cells (purchased from Beijing TransGen Biotech Co., Ltd.). After plating on ampicillin-resistant plates and incubating overnight, single clones were picked for PCR identification. Positive clones were selected and sequenced by Beijing Qingke Biotechnology Co., Ltd. Single clones with correct sequencing results were selected based on sequence alignment.

[0102] 5. Validation of Candidate Gene Function via Gene Editing Overexpression: An overexpression strategy was employed to validate the anchored maduramycin resistance candidate gene. An overexpression vector was constructed in vitro. The 5'MIC2-DHFR-EYFP-3'Actin sequence fragment, the 5'Actin fragment, and the 3'Actin-vector backbone fragment were amplified from the laboratory overexpression vector. The candidate gene was then amplified from the candidate gene T vector for multi-fragment ligation. Positive single clones from bacterial culture were selected for PCR and sequenced by Beijing Qingke Biotechnology Co., Ltd. Sporozoites of maduramycin-sensitive *Eimeria tenella* strains were extracted using the Percoll method. The constructed linearized plasmid of the candidate gene was transfected into the sporozoites. The transfected sporozoites were inoculated into 1-week-old AA broilers via the cloaca, and positive oocysts of transfected mCherry were selected by flow cytometry. The flow cytometry sorting and passage process was repeated until the luminescence rate of the positive strains was greater than 90%. This yielded the candidate gene overexpressing strains. Specific primers were designed to identify the candidate gene overexpressing strains.

[0103] Validation of candidate gene function based on CRISPR / Cas9 gene substitution: A gene substitution framework was constructed in vitro, and the 5' and 3' homologous arms of candidate genes were amplified from the genome of drug-resistant insect strains. gRNAs targeting candidate genes were designed, and the U6 promoter, Scaffold sequence, mCherry fluorescent gene, and 3' Actin fragment were amplified from existing vectors in the laboratory. Multiple fragments were ligated to obtain a homologous recombination vector. Sporangia were extracted from the previously constructed *Eimeria tenella* Cas9 baseline strain using the Percoll method, and the homologous recombination vector was transfected into the sporangia. Transfection, positive strain screening, and enrichment methods were the same as above. Primers were designed to amplify the 5' and 3' homologous regions, and positive clones were identified by PCR.

[0104] Based on the above experimental results, coccidia... ETH2_0402100 Gene (Gene ID: 25249721) mutation is associated with maduramycin resistance. Located in coccidia. ETH2_0402100 A SNP mutation exists at nucleotide position 1255 of the gene. At this position, C corresponds to the maduramycin-sensitive phenotype, and T corresponds to the maduramycin-resistant phenotype (Table 1).

[0105] Table 1. Sequence alignment results of susceptible and resistant strains

[0106]

[0107] Example 3: Primer design for detecting SNP molecular markers associated with maduramycin resistance in Eimeria coccidia.

[0108] This embodiment designs amplification primers for the SNP sites discovered in Example 2.

[0109] Taking Eimeria tenella as an example, this invention discovered Eimeria tenella during primer design. ETH2_ 0402100 Genes contain multiple intron sequences. To efficiently and specifically amplify DNA fragments containing these SNP sites, the template used should be a reverse-transcribed cDNA sample. Therefore, primers will be designed targeting the cDNA sequence.

[0110] Will ETH2_0402100 After BLAST alignment of the gene sequence, it was found that the gene is relatively conserved among different species of Eimeria. Therefore, in this embodiment, seven pairs of primers for amplifying this gene targeting seven species of Eimeria were designed, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The specific primer sequences are shown in Table 2.

[0111] Table 2 Primers for PCR amplification of seven chicken coccidia genes

[0112]

[0113] Following the instructions of the RNA extraction kit and reverse transcription kit, RNA was extracted from seven species of Eimeria coccidia and reverse transcribed into cDNA. Using the cDNA as a template, PCR amplification was performed using the primers in Table 2. The specific PCR reaction system and procedure are as follows:

[0114] PCR reaction system: 1 μL each of upstream and downstream primers (10 μmol / L), 1 μL of cDNA template, 1 μL of dNTP solution, 10 μL of 5× reaction buffer, 0.5 μL of Q5 enzyme (20 U / mL), and deionized water to make up to 50 μL.

[0115] PCR reaction procedure: 98 ℃ pre-denaturation for 30 s; 98 ℃ denaturation for 15 s, 65 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 35 cycles; final extension at 72 ℃ for 10 min.

[0116] PCR amplification yielded target fragments of the lengths shown in Table 2. Electrophoresis results of some amplified fragments are shown below. Figure 3 As shown.

[0117] Example 4: Detection of maduramycin resistance in mixed chicken coccidia samples collected in the field based on SNP molecular markers.

[0118] Fecal samples were randomly collected from 11 chicken farms in different counties and districts of four cities in Zhejiang Province. Maduromycin resistance was detected using the maduromycin resistance SNP molecular markers described in Examples 2 and 3. The specific methods are as follows:

[0119] 1. DNA template preparation: The isolated field samples were orally inoculated into coccidioidomycosis-free chickens. On the 5th day after inoculation, the feces were cleaned and the oocysts were collected at 6-9 days. The sporulation and purification processes were carried out in accordance with the standardized laboratory procedures. The subsequent preparation of DNA samples is referred to Example 2.

[0120] 2. PCR amplification system and reaction conditions

[0121] Select ETH2_0402100 For gene fragments containing mutation sites of approximately 200-300 bp, specific primers were designed: FastNGS-F: 5'-GGTAGTTGGCAATTCCTTGAG-3', FastNGS-R: 5'-CTCCATCGATACCAGAGCAGTC-3'. The forward primer had a adapter primer read 1 added to the 5' end: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3', and the reverse primer had an adapter primer read 2 added to the 5' end: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'. The reaction system and procedure were the same as in Example 3.

[0122] 3. Sequencing of PCR products

[0123] The amplified PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for FastNGS amplicon sequencing.

[0124] 4. Bioinformatics Analysis

[0125] After the DNA samples passed the initial testing, a PCR-free library was first constructed, followed by quality control of the library. Once the library passed quality control, sequencing was performed using the Illumina platform. After the sequencing data quality was assessed, data assembly was performed, and short sequence SNPs / Indels were detected.

[0126] 5. Cage-rearing experiment to assess drug resistance

[0127] Two days prior to inoculation, 5 ppm of maduramycin was added to the feed. Four field samples were selected and orally inoculated into chickens. Feces were collected on day 5 post-inoculation using a five-point sampling method from day 6 to 12, and analyzed using the saturated saline flotation method. Microscopic examination was performed to determine the presence of oocysts and to ascertain whether the samples exhibited maduramycin resistance phenotype.

[0128] 6. Detection of maduramycin resistance SNP sites

[0129] After performing FastNGS amplicon sequencing on the PCR products of the field samples, short sequence SNPs were detected, and the results are shown in Table 3.

[0130] Table 3. Mutation frequency of target sites in field samples detected by amplicon sequencing

[0131]

[0132] We collected chicken manure samples from 11 farms in the field and extracted coccidia genomes for PCR amplification. The results showed that the target fragment could be amplified in 8 of these farms. Figure 4 FastNGS amplicon sequencing was performed on the PCR products from these 8 fields. The results showed that maduramycin resistance gene mutations at different frequencies were detected in 7 fields (Table 3), indicating that maduramycin resistance occurred in all 7 fields.

[0133] Simultaneously, maduramycin resistance was assessed in four field samples using cage-rearing experiments. The results showed that all mixed field strains exhibited maduramycin resistance. This result was completely consistent with the SNP-based molecular marker detection results, further validating the accuracy and reliability of the detection method of this invention. Therefore, the SNP-based molecular marker PCR detection method provided by this invention can accurately reflect whether a strain possesses a maduramycin-resistant phenotype. This method is not only applicable to the detection of maduramycin resistance in pure-cultured *Eimeria tenella*, but can also be effectively applied to the detection of clinical samples (mixed strains), demonstrating broad applicability and clinical value.

[0134] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A SNP molecular marker associated with maduramycin resistance in Eimeria tenella, characterized in that, The nucleotide sequence of the SNP molecular marker is a nucleotide sequence with a C / T polymorphism at position 1255 of the sequence shown in SEQ ID NO:1; The SNP molecular marker has a polymorphic site of C, corresponding to maduramycin-sensitive strains, and a polymorphic site of T, corresponding to maduramycin-resistant strains.

2. A method for identifying maduramycin resistance in Eimeria tenella, characterized in that, The method includes: extracting RNA from Eimeria tenella to be tested, reverse transcribing it into cDNA, then using the cDNA as a template, performing PCR amplification using primer pairs or a kit containing the primer pairs, and determining the maduramycin resistance of Eimeria tenella to be tested based on the PCR amplification results. The primer pair is a primer pair used to amplify the SNP molecular marker of claim 1, as follows: Et-F: ATGCCGACTTCCACGCTAGGC; Et-R:TCAGTCTGCTTGTTGGCCCATC; The method for determining the maduramycin resistance of Eimeria tenella to be tested includes: analyzing the single nucleotide polymorphism of the SNP molecular marker in the PCR amplification product, and determining whether the Eimeria tenella to be tested has a drug-resistant or sensitive phenotype based on the polymorphic site; The method described is not for disease diagnosis and treatment purposes.

3. The method according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 95 ℃ for 3 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 15 s, 30 cycles; 72 ℃ for 10 min.

4. The method according to claim 2, characterized in that, If the SNP molecular marker has a C base at the polymorphic site, then the tested Eimeria tenella is maduramycin-sensitive; if the SNP molecular marker has a T base at the polymorphic site, then the tested Eimeria tenella is maduramycin-resistant.

5. The application of the reagent for detecting the SNP molecular marker described in claim 1 in screening for maduramycin-resistant strains of Eimeria tenella; The application is for purposes other than disease diagnosis and treatment.

6. The application of primer pairs for amplifying the SNP molecular markers of claim 1 or kits containing said primer pairs in screening maduramycin-resistant strains of Eimeria tenella; The primer pairs are as follows: Et-F: ATGCCGACTTCCACGCTAGGC; Et-R:TCAGTCTGCTTGTTGGCCCATC; Methods for determining maduramycin resistance in Eimeria tenella include: The single nucleotide polymorphisms of the SNP molecular markers in the PCR amplification products were analyzed, and the polymorphic sites were used to determine whether the tested Eimeria tenella was drug-resistant or drug-sensitive. The application is for purposes other than disease diagnosis and treatment.

Images