Methods for studying the mechanism of action of CHPF2 in glioblastoma

Abstract

This invention discloses the application of CHPF2 as a prognostic diagnostic reagent for glioblastoma, relating to the field of CHPF2 application technology; specifically including the following steps: Step 1: Acquisition and processing of glioblastoma samples; Step 2: HE and immunohistochemical staining; Step 3: Bioinformatics analysis of CHPF2 and its mRNA expression, prognosis, and immune cell infiltration in glioblastoma; Step 4: In vitro experimental observation of the effect of CHPF2 on the proliferation and growth of U251 and A172 cells. The experimental results demonstrate that CHPF2 is mainly expressed in tumor tissues, and CHPF2 expression increases with increasing glioblastoma grade, reaching its highest level in primary glioblastoma; the levels of CHPF2 mRNA and protein in U251 and A172 cells are higher than in normal cells; CHPF2 is mainly expressed in the nucleus and cytoplasm.

Description

Technical Field

[0001] This invention relates to the field of CHPF2 application technology, and in particular to research methods for the mechanism of action of CHPF2 in glioblastoma. Background Technology

[0002] Gliomas are malignant tumors originating from glial cells. Due to their high invasiveness and resistance to existing treatments, they are considered one of the brain tumors with the worst clinical prognosis. Statistics show that the incidence of gliomas is on the rise, especially glioblastoma (GBM), whose survival is typically between 14 and 17 months, with unsatisfactory treatment outcomes. This is mainly due to their biological characteristics and the complexity of their microenvironment, which limits the effectiveness of traditional treatments such as surgery, radiotherapy, and chemotherapy (e.g., temozolomide and bevacizumab). While these drugs can slow tumor growth, they often have side effects such as nausea, fatigue, and immunosuppression, further impacting the patient's quality of life.

[0003] Chondroitin sulfate (CS), a class of glycosaminoglycans (GAGs), is composed of repeating disaccharides of n-acetylgalactosamine and d-glucuronic acid (DS being l-idulaldehyde) and exhibits various sulfation patterns. Due to its specific structural features, particularly sulfation and molecular size, CS plays a crucial role in antioxidant, neuroprotective, antitumor, antiproliferative, and antiadhesive processes. Chondroitin sulfate proteoglycan (CSPG) is a complex formed by chondroitin sulfate (CS) covalently linked to a proteoglycan (PG) core protein. Proteoglycans (PGs) containing CS1 / 2DS chains are located in the extracellular matrix, and upregulation or downregulation of CSPG expression is associated with normal and pathological conditions. Furthermore, CSPG can regulate key cellular processes, including proliferation, cell death, migration, adhesion, and invasion, as well as extracellular mechanism assembly via its highly negatively charged CS1 / 2DS side chains. Structural alterations in the CS chains within CSPG lead to various activities of growth factors and their receptors, enabling them to specifically promote a variety of biological effects. The type of CS (i.e., sulfation pattern) appears to be a key factor in cancer progression.

[0004] CHPF2, one of the six glycosyltransferases involved in the biosynthesis of CS, has been the subject of limited research. This study analyzed the expression and potential role of CHPF2 in glioblastoma using a series of bioinformatics methods, and conducted preliminary validation experiments in vitro to investigate the expression changes of CHPF2 in glioblastoma and its impact on its proliferation and growth. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies and to propose a method for studying the mechanism of action of CHPF2 in glioblastoma.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The research method for understanding the mechanism of action of CHPF2 in glioblastoma includes the following steps:

[0008] Step 1: Acquisition and processing of glioblastoma samples; The acquired glioblastoma samples are processed to prepare paraffin sections for glioblastoma, for later use;

[0009] Step 2: HE and immunohistochemical staining; dewaxing and dehydration were performed on some glioblastoma paraffin sections to obtain glioblastoma section samples. A portion of the glioblastoma section samples were stained with an HE staining kit to observe the optical morphology of the cells in the sections; another portion of the glioblastoma section samples were subjected to immunohistochemical staining to observe the positive results.

[0010] Step 3: Bioinformatics methods were used to analyze the expression, prognosis, and immune cell infiltration of CHPF2 and its mRNA in glioblastoma; specifically, this included CHPF2 gene expression analysis, CHPF2 expression analysis in glioblastoma patient tissues, CHPF2 mRNA expression and prognostic survival analysis in glioblastoma patient tissues, and CHPF2 mRNA expression and immune cell infiltration analysis in glioblastoma patient tissues.

[0011] Step 4: In vitro experiments to observe the effects of CHPF2 on the proliferation and growth of U251 and A172 cells; specifically including cell culture and passage, siRNA sequence design, transfection and grouping, reverse transcription real-time quantitative PCR, immunoblotting, immunofluorescence, Transwell and scratch assay.

[0012] Preferably, the specific method for CHPF2 gene expression analysis is as follows: mRNA sequencing data of 33 cancers and corresponding normal tissues from the TCGA cohort are retrieved from the Tumor Immunological Estimation Resource Database. The expression of CHPF2 mRNA in various cancer tissues and corresponding normal tissues is analyzed. The relevant data are organized into an expression matrix, and the CHPF2 mRNA expression is visualized and analyzed using the ggplot2R package.

[0013] Furthermore, the specific method for analyzing the expression of CHPF2 in glioblastoma patient tissues is as follows: After searching through UALCAN, the data was downloaded and organized into a gene expression matrix, and the protein expression of CHPF2 in glioblastoma patient tissues was analyzed using the Wilcox statistical method in R language.

[0014] As a preferred embodiment of the present invention, the specific method for analyzing the expression of CHPF2 mRNA in glioblastoma patient tissues and the prognostic survival of patients is as follows: data on CHPF2 mRNA expression and overall survival of glioblastoma patients are obtained through the TCGA and CGGA databases; the correlation between CHPF2 mRNA expression and patient prognosis is analyzed using the survivalR package of the R language; and the log rank test is used to analyze the impact of differences in CHPF2 mRNA expression levels on patient prognostic survival.

[0015] Based on the aforementioned scheme, the specific method for analyzing the expression and immune cell infiltration of CHPF2 mRNA in glioblastoma patient tissues is as follows: data on the expression of CHPF2 mRNA in glioblastoma patient tissues obtained from the TCGA database are used to evaluate the relationship between CHPF2 mRNA expression levels and immune activators and immunosuppressants in glioblastoma using the TISIDB database.

[0016] Based on the aforementioned scheme: the cells used in cell culture and passage are human glioma cell lines A172 and U251, as well as human astrocytes SVG-P12; the siRNA sequences designed for CHFP2 in the siRNA sequence design, transfection, and grouping are UAGUCAGCGUUGUAGAAGC(dT)(dT) and GCUUCUACAACGCUGACUA(dT)(dT).

[0017] Furthermore: The reverse transcription real-time quantitative PCR was performed using the TRIzol reagent kit to extract total RNA from three cell types: U251, A172, and SVG-P12, and then subjected to reverse transcription quantitative PCR and SYBR Green real-time PCR.

[0018] Based on the aforementioned protocol: cells were transfected using 6-well plates in the Transwell, cultured for 24 hours, then digested. 8000 cells were seeded into 24-well plates containing Transwell chambers, cultured for 24 hours, then washed with PBS, fixed with paraformaldehyde, washed again with PBS, stained with crystal violet, and finally washed with PBS. The Transwell chambers were then photographed using an inverted fluorescence microscope, and the number of cells was counted under 10x magnification for statistical analysis.

[0019] The beneficial effects of this invention are as follows:

[0020] The study method for investigating the mechanism of action of CHPF2 in glioblastoma demonstrated through experimental results that CHPF2 is mainly expressed in tumor tissues, and the expression of CHPF2 increases with the increase of glioma grade, with the highest expression in primary glioblastoma. The levels of CHPF2 mRNA and protein in U251 cells and A172 cells were higher than those in normal cells. CHPF2 is mainly expressed in the nucleus and cytoplasm, and its expression is significantly increased in glioma cells. Attached Figure Description

[0021] Figure 1 This is a flowchart of the entire invention;

[0022] Figure 2 These are before-and-after comparison images of paraffin sections of glioblastoma stained with hematoxylin and eosin (HE) in accordance with the present invention.

[0023] Figure 3 This is a comparison image of glioblastoma tissue samples before and after immunohistochemical staining, based on the present invention.

[0024] Figure 4 This is a schematic diagram of the statistical results of ImageJ in this invention;

[0025] Figure 5 This is a graph showing the statistical results of the CHPF2 gene expression analysis in this invention;

[0026] Figure 6 This is a graph showing the statistical results of CHPF2 mRNA levels in GBM samples of this invention;

[0027] Figure 7 This is a schematic diagram illustrating the changes in CHPF2 protein levels in the GBM sample of this invention.

[0028] Figure 8 This invention provides a statistical analysis of the changes in CHPF2 expression with glioma grading. Figure 1 ;

[0029] Figure 9 This invention provides a statistical analysis of the changes in CHPF2 expression with glioma grading. Figure 2 ;

[0030] Figure 10 This is a statistical graph showing the expression of CHPF2 in wild-type IDH patients according to the present invention.

[0031] Figure 11 This is a statistical chart comparing the expression of CHPF2 in autosomes 1 and 19 with and without deletion in cells of this invention.

[0032] Figure 12 This is a statistical graph showing the effect of CHPF2 expression levels on the survival time of glioblastoma patients according to the present invention;

[0033] Figure 13 This is a statistical graph showing the results of univariate and multivariate Cox regression analyses in this invention;

[0034] Figure 14 This is a statistical graph showing the results of RT-qPCR verification of CHPF2 mRNA and its protein expression in this invention.

[0035] Figure 15 This is a statistical graph showing the results of Western Blot verification of CHPF2 mRNA and its protein expression in this invention.

[0036] Figure 16 The results and statistical graphs of the interference of siRNA on the expression of CHPF2 mRNA and protein in A172 cells and U251 cells in this invention;

[0037] Figure 17 This is a photograph and statistical result of A172 cells after Transwell experiment according to the present invention;

[0038] Figure 18 This is a photograph and statistical result of U251 cells after Transwell experiment according to the present invention;

[0039] Figure 19 This is a statistical chart showing the results of the A172 cell scratch assay of this invention;

[0040] Figure 20 This is a statistical chart showing the results of the U251 cell scratch assay of this invention. Detailed Implementation

[0041] The technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0042] Embodiments of the present invention are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0043] Methods for studying the mechanism of action of CHPF2 in glioblastoma, such as Figures 1 to 20 As shown, the specific steps include:

[0044] Step 1: Acquisition and processing of glioblastoma samples; The acquired glioblastoma samples are processed to prepare glioblastoma paraffin sections for later use.

[0045] The glioblastoma samples were human tissues, obtained from the First Affiliated Hospital of Chongqing Medical University (6 cases). The samples were fixed overnight in 20% formaldehyde solution, dehydrated in a gradient of 70%-80%-90%-100% alcohol, cleared in xylene, embedded in paraffin, sectioned, and mounted to prepare paraffin sections for later use.

[0046] Step 2: HE and immunohistochemical staining; dewaxing and dehydration were performed on some glioblastoma paraffin sections to obtain glioblastoma section samples. Some glioblastoma section samples were stained with HE staining kit to observe the optical morphology of the cells in the sections; other glioblastoma section samples were subjected to immunohistochemical staining to observe positive results.

[0047] Paraffin sections of glioblastoma were dewaxed at 60 degrees Celsius, hydrated with xylene, and dehydrated with a gradient of 100%–90%–80%–70% alcohol. One portion was stained with an HE staining kit, and the morphological characteristics of the cells in the sections were observed under an optical microscope. The other portion was stained with an IHC immunohistochemical staining kit, and the positive results were observed under an optical microscope.

[0048] The primary antibody was a polyclonal rabbit anti-human antibody (ratio 1:100) (Wuhan Sanying Company, China), and the secondary antibody was a goat anti-rabbit antibody (ratio 1:5000) (White Shark Biotechnology Company, China).

[0049] Use ImageJ to calculate the area of ​​positive regions.

[0050] Reference Figures 2 to 4 The results are as follows:

[0051] HE results indicate that the general morphology of the cells is consistent with the morphological characteristics of cells in normal brain tissue and glioblastoma tissue.

[0052] Immunohistochemical results showed that glioblastoma cells had positive expression in both the cytoplasm and nucleus, appearing as yellowish-brown, while no positive expression was observed in the surrounding normal brain tissue.

[0053] Step 3: Bioinformatics methods were used to analyze the expression, prognosis, and immune cell infiltration of CHPF2 and its mRNA in glioblastoma. Specifically, this included CHPF2 gene expression analysis, CHPF2 expression analysis in glioblastoma patient tissues, CHPF2 mRNA expression in glioblastoma patient tissues and prognostic survival analysis, and CHPF2 mRNA expression in glioblastoma patient tissues and immune cell infiltration analysis.

[0054] (1) CHPF2 gene expression analysis

[0055] mRNA sequencing data from 33 cancers and corresponding normal tissues in the TCGA cohort were retrieved from the Tumor Immunological Estimation Resource (TIMER2.0, http: / / timer.cistrome.org / ) database. The expression of CHPF2 mRNA in various cancer tissues and corresponding normal tissues, especially glioblastoma, was analyzed.

[0056] Total RNA sequencing data for glioblastoma were obtained from the Cancer Genome Atlas (TCGA, http: / / cancergenome.nih.gov / ) and the Chinese Glioma Genome Atlas (CGGA, http: / / www.cgga.org.cn / ); total RNA sequencing data for non-cancerous tissues were obtained from the Genotype-Tissue Expression Database (GTEx database, https: / / gtexportal.org / ).

[0057] Download all the data, organize it into an expression matrix, and then use the ggplot2R package to process it.

[0058] Visual analysis of CHPF2 mRNA expression.

[0059] (2) Expression analysis of CHPF2 in tissues of patients with glioblastoma

[0060] After searching the University of Alabama at Birmingham's Cancer Data Analysis Portal (UALCAN, http: / / ualcan.path.uab.edu / index.html), the data were downloaded and organized into a gene expression matrix. The protein expression of CHPF2 in glioblastoma patient tissues was then analyzed using the Wilcox statistical method in R.

[0061] (3) Analysis of CHPF2 mRNA expression in glioblastoma patient tissues and its impact on patient prognosis and survival.

[0062] Data on CHPF2 mRNA expression and overall survival of glioblastoma patients were obtained from the TCGA and CGGA databases. Glioblastoma patients were divided into high and low groups according to the median CHPF2 mRNA expression value. The survivalR package of R language was used to analyze the association between CHPF2 mRNA expression and patient prognosis. The log rank test was used to analyze the impact of the difference between high and low CHPF2 mRNA expression on patient prognosis and survival rate.

[0063] (4) Analysis of CHPF2 mRNA expression and immune cell infiltration in glioblastoma patient tissues

[0064] Based on the CHPF2 mRNA expression data in glioblastoma patient tissues obtained from the TCGA database, the relative proportion of tumor-infiltrating immune cells (TIIC) was first calculated using the CIBERSORT algorithm. Then, according to the median expression value of CHPF2 mRNA, the cells were divided into a CHPF2 high expression group and a CHPF2 low expression group. Finally, the relative abundance of TIIC in the two groups was analyzed.

[0065] The relationship between CHPF2 mRNA expression levels and immune activators and immunosuppressants in glioblastoma was assessed using the TISIDB database (http: / / cis.hku.hk / ).

[0066] Reference Figures 5 to 7 The experimental results are as follows:

[0067] Using gene expression data from the TIMER2.0 database, the results showed that CHPF2 mRNA was expressed in a wide range of tumor tissues.

[0068] Visualization of glioblastoma samples from the TCGA and CGGA databases using R language revealed that CHPF2 mRNA levels were significantly upregulated in GBM samples from both databases.

[0069] Analysis of CHPF2 protein expression levels using the Clinical Proteomics Analysis Council (CPTAC) database showed that, compared with corresponding normal tissues, CHPF2 protein expression was significantly upregulated in these tumor tissues {e.g., clear cell renal cell carcinoma (ccRCC), uterine corpus endometrioid carcinoma (UCEC), lung cancer (LUNG), pancreatic adenocarcinoma (PAAD), head and neck squamous cell carcinoma (HNSC)} and glioblastoma multiforme (GBM), while CHPF2 protein expression was significantly downregulated in colon cancer (CC).

[0070] Visualization of CHPF2 protein levels in glioblastomas from the CPTAC database using UCLCAN also showed that CHPF2 protein levels were upregulated in GBM samples.

[0071] Reference Figures 8 to 13 The experimental results are as follows:

[0072] Analysis using the CGGA database revealed that CHPF2 expression increased with increasing glioma grade, reaching its highest level in primary glioblastoma. In IDH wild-type patients, CHPF2 expression was significantly higher than in IDH mutant patients, and also higher in patients with intact or missing autosomal arms 1 and 19 compared to the deletion group.

[0073] Survival analysis results from the TCGA and CGGA databases showed that the survival time of glioblastoma patients with high CHPF2 expression was significantly lower than that of patients with low CHPF2 expression.

[0074] Univariate and multivariate Cox regression analyses revealed the relationship between clinical characteristics of glioblastoma and patient survival outcomes. The results showed that patients with high CHPF2 expression and those without deletions of the missing arms of chromosomes 1 and 19 had a poorer prognosis (p < 0.001).

[0075] Step 4: In vitro experiments to observe the effects of CHPF2 on the proliferation and growth of U251 and A172 cells; specifically including cell culture and passage, siRNA sequence design, transfection and grouping, reverse transcription real-time quantitative PCR, immunoblotting, immunofluorescence, Transwell and scratch assay.

[0076] (1) Cell culture and passage

[0077] Human glioma cell lines A172 and U251, and human astrocytes SVG-P12 were all purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). DMEM medium supplemented with 5% fetal bovine serum (FBS) was used for routine culture at 37°C and 5% CO2. Cells were passaged at a ratio of 1:2 when the confluence reached approximately 90%.

[0078] (2) siRNA sequence design, transfection and grouping

[0079] The siRNA sequences designed for CHFP2 were UAGUCAGCGUUGUAGAAGC(dT)(dT) and GCUUCUACAACGCUGACUA(dT)(dT), designed and synthesized by technicians at TransIntro EL Transfection Reagent Co., Ltd. (Beijing, China); the FT201 transfection kit (TransIntro EL Transfection Reagent, Beijing, China) was used.

[0080] During the interference experiment, cells were divided into three groups: control group, negative control group, and interference group. Cells were digested and seeded into 6-well plates. When the cells reached 70% growth, serum-depleted medium containing transfection reagent and small interference was added. Negative siRNA was added to the negative control group, and CHPF2-siRNA was added to the interference group. After culturing for 36 hours, total RNA and protein were extracted from the cells. The expression of CHPF2 and its mRNA was detected by RT-qPCR and WB to verify the interference efficiency.

[0081] (3) Reverse transcription real-time fluorescence quantitative PCR

[0082] Total RNA was extracted from U251, A172, and SVG-P12 cells according to the TRIzol reagent (Vazyme Biotech Co., Ltd., Nanjing, China) kit instructions, and then subjected to reverse transcription quantitative PCR and SYBR Green real-time PCR.

[0083] The design and synthesis of the internal reference primer sequence for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the target gene primer sequence were completed by Qingke Biotechnology Co., Ltd. (Beijing, China).

[0084] The results were analyzed using the 2-ΔΔct method for semi-quantitative analysis.

[0085] The primer sequences are as follows:

[0086] GAPDH-F("GGAGTCCACTGGCGTCTTCA"),

[0087] GAPDH-R("GTCATGAGTCCTTCCACGATACC").

[0088] CHPF2-F("AGCGGGCTTACAGTGAAATAGAA"),

[0089] CHPF2-R("AAAGCGAGAGTGTGGTGTGAAAG").

[0090] (4) Immunoblotting

[0091] Cells from each group were collected in T25 flasks and radioimmunoprecipitation buffer (RIPA, PMSF ratio 100:1) containing benzyl sulfonyl fluoride (PMSF) was added.

[0092] Cells were gently collected using a disposable cell scraper, and the lysis buffer was transferred to a 1.5 mL EP tube. Then, sodium dodecyl sulfate (SDS) protein loading buffer was mixed with the lysis buffer at a ratio of 1:4, and the mixture was denatured at 95 °C for 5 minutes.

[0093] Add 10 μL of protein loading solution to each well, perform SDS-PAGE electrophoresis at 80V for 30 mins and 120V for 60 mins.

[0094] After cutting the gel near the corresponding molecular weight shown by the marker, place it in an ice box and electrospin it onto the PVDF membrane at 250mA for 90mins. Seal the PVDF membrane with Beyotime rapid sealing solution at room temperature for 20 minutes.

[0095] The membrane was immersed once in Tris-buffered saline and Tween solution, and then the PVDF membrane was incubated on ice overnight. Primary antibody (CHPF2 dilution ratio, 1:2000; Abcam, UK; β-actin, 1:2000) was added and incubated at 4°C overnight.

[0096] The PVDF membrane was then incubated with secondary antibody (diluted 1:10000; Proteintech, Rosemont, IL, USA) at 37°C for 2 hours. The bands were detected using a chemiluminescent solution and color imaging was performed using Image Lab software.

[0097] The ratio of the gray value of the target band to the gray value of the internal reference protein band was used as the source of statistical data; this experiment was repeated three times.

[0098] (5) Immunofluorescence

[0099] First, seed the cells in a T25 culture flask. Once the cells have grown to a confluence, prepare a sterile round glass slide and place it in a six-well plate. Seed the digested cells into the six-well plate. After the cells have grown to a confluence, wash them three times with PBS, treat them with 4% paraformaldehyde for 20 minutes, wash them three times with PBS, treat them with Triton X-100 for 5 minutes, and wash them three times with PBS after treatment.

[0100] Add primary antibody (CHPF2 dilution ratio, 1:200; Abcam, UK) and incubate overnight at 4°C; then wash 3 times with immunosorbent for 10 mins each time, and then add anti-rabbit fluorescent secondary antibody (dilution ratio, 1:500) and incubate at room temperature for 1 h.

[0101] Wash three times with PBS, stain the nuclei with DAPI for 3 minutes, then wash three times with PBS. Mount the slides with neutral resin and photograph the results using an upright fluorescence microscope (Leica, Wetzlar, Germany).

[0102] The statistical data were obtained using unit fluorescence intensity values ​​(ratio of field of view to fluorescent positive area under 10x magnification); this experiment was repeated three times.

[0103] (6) Transwell

[0104] Cells were transfected using 6-well plates, cultured for 24 hours, and then digested. 8000 cells were seeded into 24-well plates containing transwell chambers. Matrix gel was applied three hours before seeding. After seeding, the cells were cultured for 24 hours, and then the 24-well plates were removed and washed three times with PBS.

[0105] Cells were fixed with 4% paraformaldehyde for 20 minutes. After fixation, the cells were washed three times with PBS and stained with crystal violet solution (Beyotime, Shanghai, China) for 3-5 minutes.

[0106] The transwell chambers were washed three times with PBS, and the results were captured using an inverted fluorescence microscope (Leica, Wetzlar, Germany). The number of cells was counted under a 10x microscope for statistical analysis.

[0107] (7) Scratch test.

[0108] Reference Figures 14 to 20 The experimental results are as follows:

[0109] RT-qPCR and Western Blot were used to verify the expression of CHPF2 mRNA and protein in U251, A172 and normal astrocytes SVGP12. The results showed that the levels of CHPF2 mRNA and protein in U251 and A172 cells were higher than those in normal cells. Immunofluorescence results further showed that CHPF2 was mainly expressed in the nucleus and cytoplasm, and its expression was significantly increased in glioma cells.

[0110] RT-qPCR and Western Blot results also showed that after siRNA interference with CHPF2 mRNA and protein expression in U251 and A172 cells, the levels of CHPF2 mRNA and protein in both cell lines decreased, which met the requirements for subsequent experiments.

[0111] The scratch assay results showed that after CHPF2 expression was interfered with, the scratch area of ​​U251 and A172 cells at 24h and 48h was larger than that of the negative control group, which suggests that the migration speed of the two cell types was significantly reduced, indicating that the inhibition of CHPF2 reduced the cell migration ability.

[0112] Transwell assay results showed that the migration and invasion abilities of U251 and A172 cells were significantly weakened after CHPF2 expression was reduced.

[0113] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A method for studying the mechanism of action of CHPF2 in glioblastoma, characterized in that, Specifically, the following steps are included: Step 1: Acquisition and processing of glioblastoma samples; The acquired glioblastoma samples are processed to prepare paraffin sections for glioblastoma, for later use; Step 2: HE and immunohistochemical staining; dewaxing and dehydration were performed on some glioblastoma paraffin sections to obtain glioblastoma section samples. A portion of the glioblastoma section samples were stained with an HE staining kit to observe the optical morphology of the cells in the sections; another portion of the glioblastoma section samples were subjected to immunohistochemical staining to observe the positive results. Step 3: Bioinformatics methods were used to analyze the expression, prognosis, and immune cell infiltration of CHPF2 and its mRNA in glioblastoma; specifically, this included CHPF2 gene expression analysis, CHPF2 expression analysis in glioblastoma patient tissues, CHPF2 mRNA expression and prognostic survival analysis in glioblastoma patient tissues, and CHPF2 mRNA expression and immune cell infiltration analysis in glioblastoma patient tissues. Step 4: In vitro experiments to observe the effects of CHPF2 on the proliferation and growth of U251 and A172 cells; specifically including cell culture and passage, siRNA sequence design, transfection and grouping, reverse transcription real-time quantitative PCR, immunoblotting, immunofluorescence, Transwell and scratch assay. The cells used in cell culture and passage are human glioma cell lines A172 and U251, as well as human astrocytes SVG-P12; the siRNA sequences designed for CHFP2 in the siRNA sequence design, transfection and grouping are UAGUCAGCGUUGUAGAAGC(dT)(dT) and GCUUCUACAACGCUGACUA(dT)(dT).

2. The method for studying the mechanism of action of CHPF2 in glioblastoma according to claim 1, characterized in that: The specific method for CHPF2 gene expression analysis is as follows: mRNA sequencing data of 33 cancers and corresponding normal tissues from the TCGA cohort were retrieved from the Tumor Immunological Estimation Resource Database. The expression of CHPF2 mRNA in various cancer tissues and corresponding normal tissues was analyzed. The relevant data were organized into an expression matrix, and the CHPF2 mRNA expression was visualized and analyzed using the ggplot2R package.

3. The method for studying the mechanism of action of CHPF2 in glioblastoma according to claim 1, characterized in that: The specific method for analyzing the expression of CHPF2 in glioblastoma patient tissues is as follows: After searching through UALCAN, the data was downloaded and organized into a gene expression matrix, and the protein expression of CHPF2 in glioblastoma patient tissues was analyzed using the Wilcox statistical method in R language.

4. The method for studying the mechanism of action of CHPF2 in glioblastoma according to claim 1, characterized in that: The specific method for analyzing the expression of CHPF2 mRNA in glioblastoma patient tissues and its relationship with patient prognosis is as follows: Data on CHPF2 mRNA expression and overall survival of glioblastoma patients were obtained from the TCGA and CGGA databases. The survivalR package in R language was used to analyze the association between CHPF2 mRNA expression and patient prognosis. The log rank test was used to analyze the impact of differences in CHPF2 mRNA expression levels on patient prognosis and survival.

5. The method for studying the mechanism of action of CHPF2 in glioblastoma according to claim 1, characterized in that: The specific method for analyzing the expression and immune cell infiltration of CHPF2 mRNA in glioblastoma patient tissues is as follows: data on the expression of CHPF2 mRNA in glioblastoma patient tissues obtained from the TCGA database were used to evaluate the relationship between CHPF2 mRNA expression levels and immune activators and immunosuppressants in glioblastoma using the TISIDB database.

6. The method for studying the mechanism of action of CHPF2 in glioblastoma according to claim 1, characterized in that: The reverse transcription real-time quantitative PCR was performed using the TRIzol reagent kit to extract total RNA from three cell lines: U251, A172, and SVG-P12. Reverse transcription quantitative PCR and SYBR Green real-time PCR were then performed on the RNA.

7. The method for studying the mechanism of action of CHPF2 in glioblastoma according to claim 1, characterized in that: Cells were transfected using 6-well plates in the Transwell assay. After 24 hours of culture, the cells were digested, and 8000 cells were seeded into 24-well plates containing Transwell chambers. After 24 hours of culture, the cells were washed with PBS and fixed with paraformaldehyde. The cells were then washed with PBS and stained with crystal violet. Finally, the Transwell chambers were washed with PBS, and the results were captured using an inverted fluorescence microscope. The number of cells was counted under 10x magnification for statistical analysis.

Images