Oligonucleotides targeting angiotensinogen and uses thereof

By designing oligonucleotide sequences to inhibit AGT gene expression, the problems of poor adherence and numerous side effects of existing hypertension treatments have been solved, achieving a highly effective and long-lasting hypertension treatment effect.

CN119998450BActive Publication Date: 2026-07-21ANLONG BIOPHARMACEUTICAL CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANLONG BIOPHARMACEUTICAL CO LTD
Filing Date
2024-07-13
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Existing hypertension medications suffer from poor adherence and numerous side effects, and drug escape from the RAAS system is common. There is a need for a targeted AGT inhibitor that is effective, safe, and has a long-lasting effect.

Method used

An oligonucleotide was designed, comprising a sense strand and an antisense strand, with sequences having high identity with specific sequences or modified sequences, to suppress AGT gene expression and reduce AGT protein levels through an RNA interference mechanism.

Benefits of technology

It significantly inhibits AGT gene expression in human liver cancer cells and transgenic mouse models, with long-lasting efficacy, and is suitable for the treatment of primary and secondary hypertension and related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119998450B_ABST
    Figure CN119998450B_ABST
Patent Text Reader

Abstract

The present application relates to an oligonucleotide targeting angiotensinogen and use thereof, which significantly inhibits the expression level of AGT gene and has long-lasting drug efficacy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to an oligonucleotide, and more particularly to a targeted oligonucleotide for the treatment of hypertension or related diseases. Background Technology

[0002] In 1998, two American scientists, Andrew Fire and Craig Mello, discovered a biological mechanism: small interfering RNA (siRNA) can mediate the degradation of specific mRNAs (Fire, Andrew, et al. Nature 391.6669(1998):806-811). This mechanism is activated when RNA molecules appear in the cell in double-stranded form, resulting in RNA interference. This discovery heralded the beginning of a new research field, and the two scientists were awarded the 2006 Nobel Prize in Physiology or Medicine for this discovery. When double-stranded RNA binds to the protein complex Dicer, Dicer cleaves the dsRNA into fragments. Then, another protein complex, RISC, binds to these fragments. One strand of the siRNA double strand is removed, but the other strand remains bound to the RISC complex. Guided by single-stranded RNA, RISC recognizes and degrades the mRNA of the target gene, inhibiting the expression of the specific protein and thus specifically leading to gene silencing.

[0003] RNA interference has opened up a new field for the application of gene technology. Double-stranded RNA (dsRNA) molecules have been artificially designed to silence specific genes in humans, animals, or plants. These artificially designed and synthesized small double-stranded interfering RNA molecules (siRNA) for gene silencing are introduced into cells and activate RNA interference mechanisms to degrade the corresponding mRNA. Currently, this method is an important research tool in biology and biomedicine. Furthermore, numerous siRNA drugs have been developed to treat viral infections, cardiovascular diseases, cancer, endocrine disorders, and many other diseases. Most siRNA therapies, either in the research and development stage or already approved for marketing, have shown promising therapeutic effects. Since the first siRNA drug was launched in 2018, at least six siRNAs have been approved for marketing in the EU or the US. Therefore, using RNA interference technology to inhibit the expression of specific target genes has become an effective approach to disease treatment.

[0004] The asialoglycoprotein receptor (ASGPR) in the liver is a receptor specifically expressed by hepatocytes and is a highly efficient endocytic receptor. Because various glycoproteins, after enzymatic or acidic hydrolysis of sialic acid under physiological conditions, expose galactose residues at their secondary terminals, the sugar that ASGPR specifically binds to is galactose, hence it is also called a galactose-specific receptor. Monosaccharides and polysaccharides such as galactose, galactosamine, and N-acetylgalactosamine (GalNAc) all have high affinity for ASGPR. The main physiological function of ASGPR is to mediate the clearance of asialoglycoproteins, lipoproteins, and other substances from the blood, and it is closely related to the occurrence and development of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of this characteristic of ASGPR plays an important role in the diagnosis and treatment of hepatogenic diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Hepatogenic drugs containing galactose or galactosamine and their derivatives in their structure can specifically bind to ASGPR, thus exhibiting active liver targeting without requiring other delivery systems.

[0005] Blood pressure is the pressure exerted by blood against the walls of blood vessels in the circulatory system. It is primarily caused by the beating of the heart in animals. During each heartbeat, blood pressure varies between maximum (systolic) blood pressure (SBP) and minimum (diastolic) blood pressure (DBP). Mean arterial pressure (MAP) is the average arterial pressure during the heartbeat cycle. Blood pressure can be measured using a sphygmomanometer (blood pressure monitor). Normal resting blood pressure ranges from 100-140 mmHg during systole and 60-90 mmHg during diastole, and is usually expressed as systolic pressure (maximum reading) / diastolic pressure (minimum reading) mmHg.

[0006] The Chinese Clinical Practice Guidelines for Hypertension (2022 Edition) recommend lowering the diagnostic threshold for hypertension in Chinese adults from SBP ≥ 140 mmHg and / or DBP ≥ 90 mmHg to SBP ≥ 130 mmHg and / or DBP ≥ 80 mmHg (1B).

[0007] It is recommended that adult hypertension patients in my country be classified according to their blood pressure levels as follows:

[0008] Level 1 (SBP 130–139 mmHg and / or DBP 80–89 mmHg)

[0009] For individuals with SBP of 130–139 mmHg and / or DBP of 80–89 mmHg, the absolute risk of cardiovascular disease is significantly increased only when accompanied by clinical comorbidities, target organ damage, or ≥3 cardiovascular risk factors.

[0010] Level 2 (SBP ≥ 140 mmHg and / or DBP ≥ 90 mmHg) (1B)

[0011] Research evidence shows that individuals with SBP ≥ 140 mmHg and / or DBP ≥ 90 mmHg have a cumulative 10-year risk of developing cardiovascular disease of 15%, and ≥ 80% of them have two or more cardiovascular risk factors. The vast majority of patients with SBP ≥ 140 mmHg and / or DBP ≥ 90 mmHg belong to the high-risk group for cardiovascular disease.

[0012] Based on its cause, hypertension can be divided into primary hypertension and secondary hypertension. Primary hypertension is caused by multiple factors, or by unknown reasons. Causes include genetics, geographical location, sodium and water retention, sympathetic excitation, and RAS activation, among others. Therefore, primary hypertension can only be controlled, not cured. Secondary hypertension refers to elevated blood pressure caused by a specific disease. Hypertension is one of the clinical symptoms of the primary disease, accounting for 95% of cases. Common examples of secondary hypertension include renal hypertension, renal artery stenosis, primary aldosteronism, pheochromocytoma, and Takayasu arteritis.

[0013] The renin-angiotensin-aldosterone system (RAAS) is a system in the human body that regulates cardiovascular function. Led by the sympathetic nervous system, it secretes angiotensin, which has a vasoconstrictive effect. Excessive stimulation or activity of the RAS pathway is one of the causes of hypertension. Angiotensinogen (AGT), a member of the serpin family and also known as SERPINA8, is encoded by the AGT gene and is the only precursor of all angiotensin peptides in the RAS. Human AGT has 485 amino acids, including a 33-amino acid signal peptide. It is mainly produced in the liver and released into the systemic circulation, where renin converts it to angiotensin I. Subsequently, angiotensin-converting enzyme (ACE) converts angiotensin I to angiotensin II. Angiotensin I can stimulate the adrenal medulla to secrete adrenaline, but its direct vasoconstrictive effect is not obvious. Angiotensin II can cause the constriction of small arteries throughout the body, thereby raising blood pressure. In addition, it can promote the secretion of aldosterone by the adrenal cortex. Aldosterone acts on the renal tubules, playing a role in sodium retention, water retention, and potassium excretion, thereby increasing blood volume and raising blood pressure.

[0014] For hypertensive patients without clinical comorbidities, the 2022 Chinese Clinical Practice Guidelines for Hypertension recommend ACEIs, ARBs, CCBs, and diuretics as first-line initial antihypertensive drugs (1B). For hypertensive patients with blood pressure ≥140 / 90 mmHg, initial combination antihypertensive drug therapy is recommended (1B). For hypertensive patients requiring combination antihypertensive drug therapy, single-pill combination (SPC, 2C) is recommended as the first choice. When selecting an SPC, a combination of renin-angiotensin system inhibitor (RASI) + CCB or RASI + diuretic is recommended as the first choice (2C). On March 11, 2023, at the 2022 Chinese Hypertension Annual Meeting and the 24th International Symposium on Hypertension and Related Diseases, the expert group of the "Chinese Guidelines for the Prevention and Treatment of Hypertension" Committee discussed and reviewed the key updates to the "2023 Chinese Guidelines for the Prevention and Treatment of Hypertension," which is currently under revision. The focus was primarily on new drug recommendations, hypertension epidemiological data, and a more detailed breakdown of risk factors. As one of the key points of this review, angiotensin receptor-neprilysin inhibitors (ARNIs) were included in the guidelines for the first time as a commonly used antihypertensive drug. Their mechanism of action is as follows: Figure 1 As shown.

[0015] Currently, the six classes of drugs commonly used in clinical practice all require long-term, uninterrupted daily use. Poor adherence among some patients is largely due to side effects. ACE inhibitors and ARBs can cause dry cough and edema, which can lead to renal insufficiency in severe cases. Calcium channel blockers (CCBs) and beta-blockers can cause side effects such as rapid heartbeat, facial flushing, headache, and leg swelling. Beta-blockers can also cause fatigue and affect blood glucose and lipid metabolism. Diuretics can cause weakness and cramps, and in severe cases, gout. Furthermore, current oral antihypertensive drugs often exhibit drug escape from the RAAS system due to the existence of alternative pathways. Therefore, there is a need in this field for drugs with novel mechanisms of action, fewer side effects, and more effective treatment options.

[0016] One type of off-target effect of siRNA is the miRNA-like effect—argonaute proteins, a core effector in RNA interference, treat artificially introduced siRNAs to induce RNA interference as miRNAs (microRNAs) (Lam et al. (2015) Molecular Therapy Nucleic Acids (2015) 4, e252). miRNAs primarily recognize target genes through base pairing between their seed region (positions 2-9 from the 5' end) and the target mRNA used for gene repression. Off-target effects caused by siRNA stem from the base complementarity between the seed region of the iRNA, which carries a RISC-loaded antisense strand, and one or more mRNAs. MiRNA-like off-target effects in siRNA have been reported in several studies, affecting the expression of multiple genes depending on the sequence of the seed region, and are severe enough to cause up to 30% positive hits in siRNA-based phenotypic screening. Furthermore, in the case of miRNAs, when the interaction between the seed region and the target weakens, they have also been reported to silence target genes through compensatory pairing (3'-compensatory pairing) in their 3' terminal regions, suggesting that miRNA-like off-target effects may be regulated by this mechanism. It is known that chemically modified siRNA designs, by adding chemically modified bases at different positions on the antisense strand of the siRNA, can eliminate or reduce miRNA-like off-target effects without impairing the gene silencing efficacy of siRNA gene therapy. This can be achieved by replacing bases at different positions on the antisense strand of the siRNA with glycerol nucleic acid (GNA) modified bases, such as Tgn, Cgn, Agn, and Ggn, or by linking the 2' phosphate ester to the 5' phosphate ester of the next nucleic acid (Schlegel et al. (2021), CN 110582283 A). Summary of the Invention

[0017] In order to address the problems existing in the prior art, the purpose of this disclosure is to provide an inhibitor targeting AGT that is effective, safe, and has a long-lasting effect.

[0018] In one aspect, this disclosure provides oligonucleotides or pharmaceutically acceptable salts thereof for reducing AGT expression, the oligonucleotides comprising a sense strand and an antisense strand, the sense strand having at least 80% sequence identity with a sequence or fragment thereof shown in any of SEQ ID NO:2-219, 789-804, 868-871, or a modified sequence thereof, preferably having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity; the antisense strand having at least 80% sequence identity with a sequence or fragment thereof shown in any of SEQ ID NO:221-424, 805-821, 872-875, or a modified sequence thereof, preferably having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0019] In another aspect, this disclosure provides a composition comprising the aforementioned oligonucleotide or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier.

[0020] In another respect, this disclosure provides the use of the aforementioned oligonucleotides or pharmaceutically acceptable salts or compositions thereof in the preparation of medicaments for the treatment and / or prevention of AGT-related diseases.

[0021] Experiments have demonstrated that the candidate compounds disclosed herein have a significant inhibitory effect on AGT gene expression levels in the human hepatocellular carcinoma cell line Hep3B. Some of these candidate compounds showed inhibition rates exceeding 90% on AGT gene expression in Hep3B cells, while others inhibited AGT gene expression in cynomolgus monkey hepatocytes by 70%, 80%, or even over 90%, exhibiting excellent inhibitory effects. In hAGT-containing transgenic mice, after approximately two months of administration (Day 29), the AGT protein reduction of some of these compounds remained at around 60%; some compounds reduced AGT protein levels by over 80% in mice for four consecutive weeks (Day 28), demonstrating sustained efficacy. These compounds can be used to treat essential and secondary hypertension and related diseases.

[0022] Inhibition of AGT gene expression can be represented by a reduction in the amount of mRNA expressed in a cell line (such cells may be present, for example, in a sample derived from a subject), in which the AGT gene has been transcribed and which has been treated (e.g., by contacting one or more cells with the iRNA of this disclosure, or by administering the iRNA of this disclosure to a subject in which cells are present or were previously present), such that AGT gene expression is inhibited compared to a substantially identical cell line but untreated (control cells not treated with iRNA or not treated with iRNA targeting the target gene). In a preferred embodiment, inhibition is assessed in species-matched cell lines using 0.5 nM, 0.05 nM siRNA concentrations as described in Example 1, expressed as 2^-ΔΔCT of the mRNA expression level in the treated cells relative to the mRNA level in the control cells, using the following formula, wherein a housekeeping gene (e.g., hTBP or GAPDH) is used as an internal control for normalization:

[0023] △CT=CT AGT -CT 管家基因

[0024] △△CT=△CT 处理细胞 -△CT 对照细胞

[0025] mRNA level = 2^-△△CT

[0026] In other embodiments, suppression of AGT gene expression can be assessed based on a decrease in parameters associated with AGT gene expression function, such as the level of AGT protein in the blood or serum of a subject. AGT gene silencing can be determined in any AGT-expressing cell, whether endogenous or heterologous from the expression construct, and by any assay known in the art.

[0027] Inhibition of AGT protein expression can be demonstrated by a decrease in the level of AGT protein expressed in cells or cell populations or in a subject sample (e.g., protein levels in a blood sample from the subject). As described above, to assess mRNA inhibition, inhibition of protein expression levels in treated cells or cell populations can similarly be expressed as a percentage of protein levels in control cells or cell populations, or as a change in protein levels in a subject sample (e.g., blood or serum from which it is derived). Inhibition is assessed using the methods provided in Examples 3, 4, 5, 6, or 7, using the following formula, expressed as a percentage of AGT expression in the treated sample (e.g., blood or serum from which it is derived) relative to AGT expression in the control or relative to AGT expression before administration.

[0028] mRNA inhibition percentage = (protein expression level)处理细胞 - Protein expression level 对照细胞 Protein expression level 对照细胞 *100%

[0029] Control cells, cell populations, or subject samples that can be used to assess the inhibition of AGT gene expression include cells, cell populations, or subject samples that have not yet been exposed to the RNAi agent of this disclosure. For example, control cells, cell lines, or subject samples may be derived from individual subjects (e.g., human or animal subjects) before treating subjects or appropriately matched cohorts with the RNAi agent.

[0030] In some embodiments of the methods disclosed herein, iRNA is administered to a subject to deliver iRNA to a specific site within the subject. Inhibition of AGT expression can be assessed by measuring the level or changes in AGT mRNA or AGT protein in fluid or tissue samples from a specific site in the subject (e.g., liver or blood). Attached Figure Description

[0031] Figure 1 The action sites of inhibitors of the renin-angiotensin-aldosterone system are shown, where solid lines represent the primary pathway, dashed lines represent the alternative pathway, and dashed lines represent the blocking pathway. ACE: angiotensin-converting enzyme; ARB: angiotensin receptor blocker; AT-R: angiotensin receptor; DRI: direct renin inhibitor; LVH: left ventricular hypertrophy.

[0032] Figure 2 The solid-phase synthesis steps of siRNA are shown.

[0033] Figure 3 The in vivo efficacy of AGT siRNA in hAGT transgenic mice is shown.

[0034] Figure 4 The in vivo efficacy II of AGT siRNA in hAGT transgenic mice is shown.

[0035] Figure 5 and Figure 6 The in vivo efficacy of AGT siRNA in hAGT transgenic mice is shown in part III.

[0036] Figure 7 and Figure 8 The in vivo efficacy of AGT siRNA in hAGT transgenic mice is shown in IV.

[0037] Figure 9 , Figure 10 and Figure 11 The in vivo efficacy of AGT siRNA in non-primate (NHP) animals was demonstrated. Detailed Implementation

[0038] In this disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. To better understand this disclosure, definitions and explanations of relevant terms are provided below.

[0039] As used herein, the term “about” or “approximately” when applied to one or more target values ​​means a value similar to a reference value. In some embodiments, unless otherwise stated or otherwise apparent from the context, the term “approximately” or “about” means a range of values ​​falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in any direction (unless such a number would exceed 100% of the possible value).

[0040] As used herein, the term "angiotensinogen" may be used interchangeably with the term "AGT" to refer to the well-known gene and polypeptide, also known in the art as a Serpin peptidase inhibitor, branch A, member 8; α-1 antiprotease; antitrypsin; SERPINA8; angiotensin I; Serpin A8; angiotensin II; α-1 antiprotease angiotensinogen; antitrypsin; proangiotensinogen 2; ANHU; serine protease inhibitor; and cysteine ​​protease inhibitor.

[0041] As used herein, the term "complementary" refers to a structural relationship between nucleotides (e.g., two nucleotides on opposing nucleic acids or on opposing regions of a single nucleic acid strand) that allows the nucleotides to form base pairs with each other. For example, a purine nucleotide complementary to a pyrimidine nucleotide of an opposing nucleic acid can be base-paired together by forming hydrogen bonds with each other. In some embodiments, complementary nucleotides may be base-paired in a Watson-Crick manner or in any other manner that allows the formation of a stable duplex. In some embodiments, the two nucleic acids may have nucleotide sequences that are complementary to each other to form complementary regions, as described herein.

[0042] As used herein, the term "chain" refers to a single, continuous sequence of nucleotides linked together by internucleotide bonds (e.g., phosphodiester bonds, thiophosphate bonds). In some embodiments, the chain has two free ends, such as a 5'-end and a 3'-end.

[0043] As used herein, the term "deoxyribonucleotide" refers to a nucleotide that has a hydrogen atom at the 2' position of its pentose sugar compared to a ribonucleotide. A modified deoxyribonucleotide is a deoxyribonucleotide that has one or more modifications or substitutions (including modifications or substitutions in the sugar, phosphate group, or base) other than at the 2' position.

[0044] As used herein, the term "double-stranded RNA" or "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands with "sense" and "antisense" orientations relative to the target RNA (i.e., the AGT gene). In some embodiments of this disclosure, the double-stranded RNA (dsRNA) triggers the degradation of the target RNA (e.g., mRNA) through a post-transcriptional gene silencing mechanism referred to herein as RNA interference or RNAi. Generally, the majority of nucleotides in each strand of the dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands may also contain one or more non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides. Additionally, as used herein, "iRNA" may contain chemically modified ribonucleotides; iRNA may contain substantial modifications at multiple nucleotide sites.

[0045] As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide bond, or a modified nucleobase, or any combination thereof. Therefore, the term "modified nucleotide" encompasses substitutions, additions, or removals of, for example, functional groups or atoms, of internucleotide bonds, sugar moieties, or nucleobases. Modifications applicable to pharmaceuticals disclosed herein include all types of modifications disclosed herein or known in the art.

[0046] As used herein, the term "oligonucleotide" refers to a short nucleic acid, such as a short nucleic acid less than 100 nucleotides in length. Oligonucleotides may comprise ribonucleotides, deoxyribonucleotides, and / or modified nucleotides, including, for example, modified ribonucleotides. Oligonucleotides may be single-stranded or double-stranded. Oligonucleotides may or may not have a double-stranded region. As a set of non-limiting examples, oligonucleotides may be, but are not limited to, small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), Dicer substrate interfering RNA (dsiRNA), antisense oligonucleotides, short siRNA, or single-stranded siRNA. In some embodiments, the double-stranded oligonucleotide is an RNAi oligonucleotide. As used herein, "conjugation" refers to the covalently linked connection of two or more chemical moieties, each having a specific function; correspondingly, "conjugate" refers to a compound formed by the covalent linking of the respective chemical moieties. Further, "siRNA conjugate" refers to a compound formed by the covalent linking of one or more chemical moieties having a specific function to siRNA. Hereinafter, the siRNA conjugates of this disclosure are sometimes simply referred to as "conjugates". The term "siRNA conjugate" should be understood in context as a general term for siRNA conjugates, including the first type of siRNA conjugate, the second type of siRNA conjugate, or siRNA sense strand conjugates or siRNA antisense strand conjugates.

[0047] As used herein, the term "double-stranded oligonucleotide" refers to an oligonucleotide that is substantially in a double-stranded form. In some embodiments, complementary base pairings are formed between antiparallel sequences of nucleotides in covalently separated nucleic acid chains, forming one or more double-stranded regions of the double-stranded oligonucleotide. In some embodiments, complementary base pairings are formed between antiparallel sequences of nucleotides in covalently linked nucleic acid chains. In some embodiments, complementary base pairings of one or more double-stranded regions of the double-stranded oligonucleotide are formed from a single nucleic acid chain folded (e.g., via a hairpin) to provide complementary antiparallel sequences of nucleotides that are base-paired together. In some embodiments, the double-stranded oligonucleotide comprises two covalently separated nucleic acid chains that are fully double-stranded with each other. However, in some embodiments, the double-stranded oligonucleotide comprises two covalently separated nucleic acid chains that are partially double-stranded, for example, having overhangs at one or both ends. In some embodiments, the double-stranded oligonucleotide comprises antiparallel sequences of nucleotides that are partially complementary, and therefore may have one or more mismatches, which may include internal mismatches or terminal mismatches.

[0048] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide protruding from the double-stranded structure of a double-stranded iRNA. For example, a nucleotide overhang exists when the 3' end of one strand of a dsRNA extends beyond the 5' end of the other strand, or vice versa. A dsRNA may include an overhang of at least one nucleotide; alternatively, an overhang may include at least two, three, four, five, or more nucleotides. A nucleotide overhang may include or consist of nucleotide / nucleoside analogs comprising deoxynucleotides / nucleosides. The overhang may be on the sense strand, antisense strand, or any combination thereof. Furthermore, the overhanging nucleotide may be present at the 5' end, 3' end, or both ends of the antisense or sense strand of the dsRNA.

[0049] As used in this article, the term "naked sequence" refers to an unmodified nucleotide sequence.

[0050] As used herein, the term "subject" refers to an animal that expresses the target gene endogenously or heterologously, such as a mammal, including primates (e.g., humans, non-human primates such as monkeys and chimpanzees), non-primates (e.g., cattle, pigs, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, or mice), or birds. In one embodiment, the subject is a human.

[0051] As used herein, the term "treating" or "treatment" refers to a beneficial or desired outcome, such as a reduction in at least one sign or symptom of AGT-related disorder in a subject. Treatment also includes reducing one or more signs or symptoms associated with undesired AGT expression; mitigating the degree of undesired AGT activation or stabilization; and improving or alleviating undesired AGT activation or stabilization. Treatment also includes reducing one or more signs or symptoms associated with undesired AGT expression. "Treatment" can also mean prolonged survival compared to expected survival without treatment.

[0052] As used in this article, the terms “prevention” or “preventing” when referring to a disease or condition will benefit from a reduction in AGT gene expression or agt protein production.

[0053] As used herein, the term "therapeutic effective amount" is intended to encompass the amount of RNAi agent that, when administered to a subject with AGT-related conditions, is sufficient to affect the treatment of the disease (e.g., by reducing, improving, or maintaining existing disease or symptoms of one or more diseases). "Therapeutic effective amount" may vary depending on the RNAi agent, how it is administered, the disease and its severity, as well as medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if any), and other individual characteristics of the subject being treated.

[0054] As used herein, the term "preventive effective dose" is intended to encompass the amount of RNAi agent sufficient to prevent or improve the condition or one or more symptoms of the condition when administered to a subject with AGT-related disease. Improving the disease includes slowing its progression or reducing the severity of later-stage disease. "Preventive effective dose" may vary depending on the RNAi agent, how it is administered, the degree of disease risk, and factors such as medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0055] As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium talc, calcium stearate, zinc stearate, or stearic acid), or solvent encapsulation material (involving the carrying or delivery of a subject compound from one organ or part of the body to another organ or part of the body). Each carrier must be "acceptable" in the sense that it is compatible with the other components of the formulation and harmless to the treated subject. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers intended for administration by injection.

[0056] In one aspect, this disclosure provides an oligonucleotide or a pharmaceutically acceptable salt thereof for reducing the expression of AGT, the oligonucleotide comprising a sense strand and an antisense strand, the sense strand having at least 80% sequence identity with a sequence or fragment thereof shown in any of SEQ ID NO:2-219, 789-804, 868-871, or a modified sequence thereof, preferably having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity; the antisense strand having at least 80% sequence identity with a sequence or fragment thereof shown in any of SEQ ID NO:221-424, 805-821, 872-875, or a modified sequence thereof, preferably having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity.

[0057] In some implementations, each chain is independently 19 to 25 nucleotides in length.

[0058] In some implementations, the aforementioned antisense strand is 19 to 23 nucleotides in length.

[0059] In some implementations, the aforementioned positive chain is 19 to 23 nucleotides in length.

[0060] In some embodiments, the aforementioned oligonucleotide comprises a 5' and / or 3'-overhang sequence of one or more nucleotides in length, wherein the aforementioned 5' and / or 3'-overhang sequence is present on the antisense strand and / or the sense strand. In one embodiment, the antisense strand of the aforementioned oligonucleotide has one to ten nucleotides at the 3' or 5' end of the overhang, for example, one, two, three, four, five, six, seven, eight, nine, or ten nucleotides. In one embodiment, the sense strand of the dsRNA has one to ten nucleotides at the 3' or 5' end of the overhang, for example, one, two, three, four, five, six, seven, eight, nine, or ten nucleotides. In another embodiment, one or more nucleotides in the overhang are replaced by nucleoside thiophosphate.

[0061] In some implementations, the aforementioned antisense chain has a protruding end.

[0062] In some implementations, the aforementioned chain of justice has a protruding end.

[0063] In some implementations, the aforementioned oligonucleotide comprises a 3'-overhead sequence of two nucleotides in length.

[0064] In some implementations, the aforementioned 3'-protruding end sequence exists on the aforementioned justice chain; preferably, the aforementioned protruding end sequence is selected from: GG, GA, GC, UC, UG, UU, UA, CA, CC, CG, CU, AA, AG, AU, AC.

[0065] In some implementations, the aforementioned 3'-protrusion sequence exists on the aforementioned antisense chain; preferably, the aforementioned protrusion sequence is selected from: UU, UC, UA, UG, GA, GG, GU, GC, TT, AG, AU, AA, AC, CA, CC, U; more preferably, the aforementioned protrusion sequence is UU.

[0066] In some implementations, the aforementioned oligonucleotide comprises an antisense strand and a sense strand, each ranging in length from 19 to 23 nucleotides.

[0067] In some implementations, the aforementioned justice chain and the aforementioned antisense chain form a bichain region.

[0068] In some implementations, the aforementioned justice chain and the aforementioned antisense chain are respectively a double-chain structure with 19 / 21 pairing, 21 / 21 pairing, 21 / 23 pairing, or 23 / 23 pairing.

[0069] In some embodiments, the aforementioned oligonucleotide includes a 3'-protrusion sequence of two nucleotides in length, wherein the aforementioned 3'-protrusion sequence is present on the aforementioned antisense strand, and wherein the aforementioned sense strand is 19 nucleotides in length and the aforementioned antisense strand is 21 nucleotides in length, such that the aforementioned sense strand and antisense strand form a double helix of 19 nucleotides in length.

[0070] In some embodiments, the aforementioned oligonucleotide includes a 3'-protrusion sequence of two nucleotides in length, wherein the aforementioned 3'-protrusion sequence is present on the aforementioned antisense strand and sense strand, and wherein the aforementioned sense strand is 21 nucleotides in length and the aforementioned antisense strand is 21 nucleotides in length, such that the aforementioned sense strand and antisense strand form a double helix of 19 nucleotides in length.

[0071] In some embodiments, the aforementioned oligonucleotide includes a 3'-protrusion sequence of two nucleotides in length, wherein the aforementioned 3'-protrusion sequence is present on the aforementioned antisense strand, and wherein the aforementioned sense strand is 21 nucleotides in length and the aforementioned antisense strand is 23 nucleotides in length, such that the aforementioned sense strand and antisense strand form a double helix of 21 nucleotides in length.

[0072] In some embodiments, the aforementioned oligonucleotide includes a 3'-protrusion sequence of two nucleotides in length, wherein the aforementioned 3'-protrusion sequence is present on the aforementioned antisense strand and sense strand, and wherein the aforementioned sense strand is 23 nucleotides in length and the aforementioned antisense strand is 23 nucleotides in length, such that the aforementioned sense strand and antisense strand form a double helix of 21 nucleotides in length.

[0073] In some implementations, the modified sequence of the aforementioned justice chain includes any of the sequences selected from SEQ ID NO:426-598, 822-838, and 876-886;

[0074] In some embodiments, the modified sequence of the aforementioned antisense strand includes any of the aforementioned sequences selected from SEQ ID NO:600-676, 678-788, 839-867, and 887-911.

[0075] In some embodiments, the aforementioned oligonucleotide or its pharmaceutically acceptable salt is preferably prepared or synthesized in the form of a carboxylate, sodium salt, triethylamine salt or other pharmaceutically acceptable salt.

[0076] In some embodiments, the aforementioned oligonucleotide or its pharmaceutically acceptable salt is more preferably its sodium salt or triethylamine salt.

[0077] In some implementations, the aforementioned positive chain comprises an unmodified oligonucleotide selected from any of 74, 101, 107, 108, 111-113, 129, 133, 135, 137, 148, 166, 178, 184, 789, 794, 798, 799, 800, 801, 802, 803, 804, 870, or a modified oligonucleotide selected from any of SEQ ID NO: 471, 477, 478, 481-483, 518, 536, 548, 554, 592-598, 822, 827, 831, 832, 833, 834, 835, 836, 837, 838.

[0078] In some embodiments, the aforementioned antisense strand comprises an unmodified oligonucleotide selected from any of SEQ ID NO:259, 281, 286, 311, 317, 318, 319, 334, 338, 340, 342, 353, 371, 383, 389, 805, 808, 811, 812, 813, 814, 815, 816, 817, 818, 874, or SEQ ID NO:259, 281, 286, 311, 317, 318, 819, 874, or SEQ ID NO:259, 281, 286, 311, 317, 318, 319, 334, 338, 340, 342, 353, 371, 383, 389, 805, 808, 811, 812, 813, 814, 815, 816, 817, 818 ... Modified oligonucleotides described in NO: 643, 644, 645, 647, 648, 681, 678, 679, 680, 764, 610, 773, 774, 775, 776, 777, 778, 779, 780, 782, 783, 785, 839, 854, 857, 858, 859, 860, 861, 862, 863, and 864.

[0079] In some preferred embodiments, the aforementioned oligonucleotide has a sense strand and an antisense strand, wherein the aforementioned oligonucleotide is selected from any of the following combinations of sense strands and antisense strands:

[0080] (1) The positive chain contains the sequence shown in SEQ ID NO:101, and the negative chain contains the sequence shown in SEQ ID NO:311;

[0081] (2) The positive chain contains the sequence shown in SEQ ID NO:107, and the negative chain contains the sequence shown in SEQ ID NO:281;

[0082] (3) The positive chain contains the sequence shown in SEQ ID NO:108, and the negative chain contains the sequence shown in SEQ ID NO:286;

[0083] (4) The positive chain contains the sequence shown in SEQ ID NO:111, and the negative chain contains the sequence shown in SEQ ID NO:317;

[0084] (5) The positive chain contains the sequence shown in SEQ ID NO:112, and the negative chain contains the sequence shown in SEQ ID NO:318;

[0085] (6) The positive chain contains the sequence shown in SEQ ID NO:113, and the negative chain contains the sequence shown in SEQ ID NO:319;

[0086] (7) The positive chain contains the sequence shown in SEQ ID NO:129, and the negative chain contains the sequence shown in SEQ ID NO:334;

[0087] (8) The positive chain contains the sequence shown in SEQ ID NO:133, and the negative chain contains the sequence shown in SEQ ID NO:338;

[0088] (9) The positive chain contains the sequence shown in SEQ ID NO:135, and the negative chain contains the sequence shown in SEQ ID NO:340;

[0089] (10) The positive chain contains the sequence shown in SEQ ID NO:137, and the negative chain contains the sequence shown in SEQ ID NO:342;

[0090] (11) The positive chain contains the sequence shown in SEQ ID NO:148, and the negative chain contains the sequence shown in SEQ ID NO:353;

[0091] (12) The positive chain contains the sequence shown in SEQ ID NO:166, and the negative chain contains the sequence shown in SEQ ID NO:371;

[0092] (13) The positive chain contains the sequence shown in SEQ ID NO:178, and the negative chain contains the sequence shown in SEQ ID NO:383;

[0093] (14) The positive chain contains the sequence shown in SEQ ID NO:184, and the negative chain contains the sequence shown in SEQ ID NO:389;

[0094] (15) The positive chain contains the sequence shown in SEQ ID NO:113, and the negative chain contains the sequence shown in SEQ ID NO:808;

[0095] (16) The positive chain contains the sequence shown in SEQ ID NO:113, and the negative chain contains the sequence shown in SEQ ID NO:811;

[0096] (17) The positive chain contains the sequence shown in SEQ ID NO:113, and the negative chain contains the sequence shown in SEQ ID NO:818;

[0097] (18) The sense chain contains the sequence shown in SEQ ID NO:789, and the antisense chain contains the sequence shown in SEQ ID NO:805;

[0098] (19) The sense chain contains the sequence shown in SEQ ID NO:794, and the antisense chain contains the sequence shown in SEQ ID NO:805;

[0099] (20) The sense chain contains the sequence shown in SEQ ID NO:798, and the antisense chain contains the sequence shown in SEQ ID NO:805;

[0100] (21) The positive chain contains the sequence shown in SEQ ID NO:799, and the negative chain contains the sequence shown in SEQ ID NO:812;

[0101] (22) The sense chain contains the sequence shown in SEQ ID NO:800, and the antisense chain contains the sequence shown in SEQ ID NO:813;

[0102] (23) The positive chain contains the sequence shown in SEQ ID NO:801, and the negative chain contains the sequence shown in SEQ ID NO:814;

[0103] (24) The sense chain contains the sequence shown in SEQ ID NO:802, and the antisense chain contains the sequence shown in SEQ ID NO:815;

[0104] (25) The sense chain contains the sequence shown in SEQ ID NO:803, and the antisense chain contains the sequence shown in SEQ ID NO:816;

[0105] (26) The sense chain contains the sequence shown in SEQ ID NO:804, and the antisense chain contains the sequence shown in SEQ ID NO:817;

[0106] (27) The positive chain contains the sequence shown in SEQ ID NO:868, and the negative chain contains the sequence shown in SEQ ID NO:872;

[0107] (28) The positive chain contains the sequence shown in SEQ ID NO:869, and the negative chain contains the sequence shown in SEQ ID NO:873;

[0108] (29) The sense chain contains the sequence shown in SEQ ID NO:870, and the antisense chain contains the sequence shown in SEQ ID NO:874;

[0109] (30) The sense chain contains the sequence shown in SEQ ID NO:871, and the antisense chain contains the sequence shown in SEQ ID NO:875; and

[0110] (31) The sense chain contains the sequence shown in SEQ ID NO:74, and the antisense chain contains the sequence shown in SEQ ID NO:259;

[0111] Each of these chains is independently 19 to 25 nucleotides in length.

[0112] In some embodiments, the aforementioned oligonucleotide comprises at least one modified nucleotide.

[0113] In some embodiments, at least one of the aforementioned modified nucleotides is selected from the group consisting of: deoxynucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, 2'-5'-linked ribonucleotides (3'-RNA), unlocked nucleotides, conformation-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2' nucleotides modified with -hydroxyl, nucleotides modified with 2'-methoxyethyl, nucleotides modified with 2'-O-alkyl, morpholinonucleotides, aminophosphates, nucleotides including non-natural bases, nucleotides modified with tetrahydropyran, nucleotides modified with 1,5-dehydrohexyl alcohol, nucleotides modified with cyclohexenyl, nucleotides including thiophosphate, nucleotides including methylphosphonate, nucleotides including 5'-phosphate, nucleotides including 5'-phosphate mimics, vinyl-phosphonate nucleotides, heat-labile nucleotides, glycol-modified nucleotides, nucleotides including 2'-phosphate and nucleotides modified with 2-O-(N-methylacetamide); and combinations thereof.

[0114] In some embodiments, at least one of the aforementioned modified nucleotides is selected from the group consisting of: LNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-alkyl, 2′-O-allyl, 2′-C-allyl, 2′-fluorine, 2′-deoxy, 2′-hydroxy and ethylene glycol; and combinations thereof.

[0115] In some embodiments, at least one of the aforementioned modified nucleotides is selected from the group consisting of: deoxynucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, ethylene glycol modified nucleotides (GNA), nucleotides comprising 2'-phosphate esters, and nucleotides comprising thiophosphate ester groups; and combinations thereof.

[0116] In some embodiments, the aforementioned oligonucleotide comprises at least one 2'-modified nucleotide. For example, these nucleotides may be selected from one or more of the following: 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-fluorine-modified nucleotides, 2'-acylamino-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, 2'-deoxynucleotides, nucleotides including 2'-phosphate esters, and nucleotides modified with 2'-O-(N-methylacetamide). Examples include C1-C3 alkoxy groups (e.g., methoxy); substituted alkoxy groups (e.g., C1-C3 alkoxy-substituted C1-C3 alkoxy groups, such as methoxyethoxy); alkyl groups (e.g., C1-C3 alkyl groups, such as methyl); substituted alkyl groups (e.g., C1-C3 alkoxy-substituted C1-C3 alkyl groups, such as methoxymethyl, methoxyethyl); amino groups (-NH2); substituted amino groups (e.g., C1-C3 alkyl mono- or di-substituted amino groups, such as methylamino, ethylamino), but not limited thereto.

[0117] In some embodiments, the aforementioned 2'-modified nucleotide is selected from one or more of 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides.

[0118] In some embodiments, the aforementioned 2'-modification is selected from the following modifications: 2'-methoxy, 2'-acetamido, 2'-aminoethyl, 2'-fluorine, 2'-O-methoxyethyl, and 2'-fluoro-β-d-arabinonucleotide.

[0119] In some embodiments, the aforementioned modification is selected from the following: 5'-phosphate analog modification, 2'-methoxy (CH3O-, m), 2'-fluorine (f), 2'-acetamido (CH3CO-NH-), and thiophosphate (s).

[0120] In some implementations, the aforementioned 2'-modification is a 2'-methoxy modification.

[0121] In some implementations, the aforementioned 2'-modification is 2'-acetamido.

[0122] In some implementations, all nucleotides of the aforementioned oligonucleotide are modified.

[0123] In some implementations, the aforementioned oligonucleotides may contain glycol nucleic acid (GNA) modifications.

[0124] In some implementations, the aforementioned diol nucleic acid (GNA) modification is selected from adenosine-diol nucleic acid, cytidine-diol nucleic acid, thymidine-diol nucleic acid, and guanosine-diol nucleic acid.

[0125] In some embodiments, the aforementioned diol nucleic acid (GNA) modification is selected from the thymidine-diol nucleic acid S-isomer (Tgn) of formula (I), the cytidine-diol nucleic acid S-isomer (Cgn) of formula (II), the adenosine-diol nucleic acid S-isomer (Agn) of formula (III), and the guanosine-diol nucleic acid S-isomer (Ggn) of formula (IV);

[0126]

[0127] In some implementations, the aforementioned oligonucleotide may contain a 2'-5'-phosphodiester bond.

[0128] In some embodiments, the aforementioned oligonucleotide comprises uridine-2'-phosphate (U-2'5') as shown in formula (V), guanosine-2'-phosphate (G-2'5') as shown in formula (VI); cytidine-2'-phosphate (C-2'5') as shown in formula (VII); adenosine-2'-phosphate (A-2'5') as shown in formula (VIII) and thymidine-2'-phosphate (T-2'5') as shown in formula (IX).

[0129]

[0130] In some implementations, the aforementioned oligonucleotides also include nucleotides modified with 5'-phosphate analogues.

[0131] In some embodiments, the aforementioned phosphate ester analogues are oxymethylphosphonates, vinylphosphonates, or malonylphosphonates.

[0132] In some implementations, the 4'-carbon of the sugar in the 5'-nucleotide of the aforementioned antisense strand comprises a phosphate ester analog.

[0133] In some embodiments, the aforementioned 5'-phosphate analog-modified nucleotide is APU as shown in formula (X). In some embodiments, the aforementioned 5'-phosphate analog-modified nucleotide is VPUm as shown in formula (XI);

[0134]

[0135] In some embodiments, the aforementioned oligonucleotide contains at least one modified internucleotide bond.

[0136] In some embodiments, the aforementioned at least one modified nucleotide inter-bond is a phosphate-thioester bond. Phospho-thioester nucleotide inter-bond modification can occur at any position on any nucleotide of the sense strand, antisense strand, or both strands. For example, the nucleotide inter-bond modification can occur on each nucleotide of the sense strand or antisense strand; each nucleotide inter-bond modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand can contain two nucleotide inter-bond modifications in an alternating pattern. The alternating pattern of nucleotide inter-bond modifications on the sense strand can be the same as or different from that on the antisense strand, and the alternating pattern of nucleotide inter-bond modifications on the sense strand can be offset relative to the alternating pattern of nucleotide inter-bonds on the antisense strand. In one embodiment, the double-stranded RNAi agent comprises 6 to 8 phosphate-thioester nucleotide inter-bonds. In some embodiments, the antisense strand comprises two phosphate-thioester nucleotide inter-bonds at the 5' end and two phosphate-thioester nucleotide inter-bonds at the 3' end, and the sense strand comprises at least two phosphate-thioester nucleotide inter-bonds at either the 5' or 3' end.

[0137] In some preferred embodiments, the aforementioned oligonucleotide comprises any of the following combinations of sense and antisense strands:

[0138] (1) The positive chain contains the sequence shown in SEQ ID NO:477, and the negative chain contains the sequence shown in SEQ ID NO:643;

[0139] (2) The positive chain contains the sequence shown in SEQ ID NO:471, and the negative chain contains the sequence shown in SEQ ID NO:644;

[0140] (3) The positive chain contains the sequence shown in SEQ ID NO:478, and the negative chain contains the sequence shown in SEQ ID NO:645;

[0141] (4) The positive chain contains the sequence shown in SEQ ID NO:482, and the negative chain contains the sequence shown in SEQ ID NO:647;

[0142] (5) The positive chain contains the sequence shown in SEQ ID NO:483, and the negative chain contains the sequence shown in SEQ ID NO:648;

[0143] (6) The positive chain contains the sequence shown in SEQ ID NO:481, and the negative chain contains the sequence shown in SEQ ID NO:681;

[0144] (7) The positive chain contains the sequence shown in SEQ ID NO:471, and the negative chain contains the sequence shown in SEQ ID NO:678;

[0145] (8) The positive chain contains the sequence shown in SEQ ID NO:478, and the negative chain contains the sequence shown in SEQ ID NO:679;

[0146] (9) The sense chain contains the sequence shown in SEQ ID NO:483, and the antisense chain contains the sequence shown in SEQ ID NO:680;

[0147] (10) The positive chain contains the sequence shown in SEQ ID NO:594, and the negative chain contains the sequence shown in SEQ ID NO:764;

[0148] (11) The positive chain contains the sequence shown in SEQ ID NO:593, and the negative chain contains the sequence shown in SEQ ID NO:610;

[0149] (12) The positive chain contains the sequence shown in SEQ ID NO:592, and the negative chain contains the sequence shown in SEQ ID NO:773;

[0150] (13) The positive chain contains the sequence shown in SEQ ID NO:592, and the negative chain contains the sequence shown in SEQ ID NO:774;

[0151] (14) The positive chain contains the sequence shown in SEQ ID NO:592, and the negative chain contains the sequence shown in SEQ ID NO:775;

[0152] (15) The positive chain contains the sequence shown in SEQ ID NO:595, and the negative chain contains the sequence shown in SEQ ID NO:776;

[0153] (16) The positive chain contains the sequence shown in SEQ ID NO:596, and the negative chain contains the sequence shown in SEQ ID NO:777;

[0154] (17) The positive chain contains the sequence shown in SEQ ID NO:597, and the negative chain contains the sequence shown in SEQ ID NO:778;

[0155] (18) The positive chain contains the sequence shown in SEQ ID NO:598, and the negative chain contains the sequence shown in SEQ ID NO:779;

[0156] (19) The positive chain contains the sequence shown in SEQ ID NO:518, and the negative chain contains the sequence shown in SEQ ID NO:780;

[0157] (20) The sense chain contains the sequence shown in SEQ ID NO:536, and the antisense chain contains the sequence shown in SEQ ID NO:782;

[0158] (21) The positive chain contains the sequence shown in SEQ ID NO:548, and the negative chain contains the sequence shown in SEQ ID NO:783;

[0159] (22) The sense chain contains the sequence shown in SEQ ID NO:554, and the antisense chain contains the sequence shown in SEQ ID NO:785;

[0160] (23) The sense chain contains the sequence shown in SEQ ID NO:592, and the antisense chain contains the sequence shown in SEQ ID NO:854;

[0161] (24) The positive chain contains the sequence shown in SEQ ID NO:592, and the negative chain contains the sequence shown in SEQ ID NO:857;

[0162] (25) The sense chain contains the sequence shown in SEQ ID NO:592, and the antisense chain contains the sequence shown in SEQ ID NO:864;

[0163] (26) The sense chain contains the sequence shown in SEQ ID NO:822, and the antisense chain contains the sequence shown in SEQ ID NO:839;

[0164] (27) The positive chain contains the sequence shown in SEQ ID NO:827, and the negative chain contains the sequence shown in SEQ ID NO:839;

[0165] (28) The positive chain contains the sequence shown in SEQ ID NO:831, and the negative chain contains the sequence shown in SEQ ID NO:839;

[0166] (29) The sense chain contains the sequence shown in SEQ ID NO:598, and the antisense chain contains the sequence shown in SEQ ID NO:840;

[0167] (30) The positive chain contains the sequence shown in SEQ ID NO:832, and the negative chain contains the sequence shown in SEQ ID NO:841;

[0168] (31) The positive chain contains the sequence shown in SEQ ID NO:832, and the negative chain contains the sequence shown in SEQ ID NO:842;

[0169] (32) The positive chain contains the sequence shown in SEQ ID NO:832, and the negative chain contains the sequence shown in SEQ ID NO:848;

[0170] (33) The positive chain contains the sequence shown in SEQ ID NO:832, and the negative chain contains the sequence shown in SEQ ID NO:849;

[0171] (34) The sense chain contains the sequence shown in SEQ ID NO:832, and the antisense chain contains the sequence shown in SEQ ID NO:850;

[0172] (35) The sense chain contains the sequence shown in SEQ ID NO:833, and the antisense chain contains the sequence shown in SEQ ID NO:858;

[0173] (36) The sense chain contains the sequence shown in SEQ ID NO:834, and the antisense chain contains the sequence shown in SEQ ID NO:859;

[0174] (37) The positive chain contains the sequence shown in SEQ ID NO:835, and the negative chain contains the sequence shown in SEQ ID NO:860;

[0175] (38) The positive chain contains the sequence shown in SEQ ID NO:836, and the negative chain contains the sequence shown in SEQ ID NO:861;

[0176] (39) The sense chain contains the sequence shown in SEQ ID NO:837, and the antisense chain contains the sequence shown in SEQ ID NO:862;

[0177] (40) The sense chain contains the sequence shown in SEQ ID NO:838, and the antisense chain contains the sequence shown in SEQ ID NO:863;

[0178] (41) The justice chain contains the sequence shown in SEQ ID NO:882, and the antisense chain contains the sequence shown in SEQ ID NO:894;

[0179] (42) The sense chain contains the sequence shown in SEQ ID NO:882, and the antisense chain contains the sequence shown in SEQ ID NO:902;

[0180] (43) The justice chain contains the sequence shown in SEQ ID NO:884, and the antisense chain contains the sequence shown in SEQ ID NO:896;

[0181] (44) The sense chain contains the sequence shown in SEQ ID NO:884, and the antisense chain contains the sequence shown in SEQ ID NO:903;

[0182] (45) The sense chain contains the sequence shown in SEQ ID NO:592, and the antisense chain contains the sequence shown in SEQ ID NO:905;

[0183] (46) The sense chain contains the sequence shown in SEQ ID NO:592, and the antisense chain contains the sequence shown in SEQ ID NO:907;

[0184] (47) The sense chain contains the sequence shown in SEQ ID NO:882, and the antisense chain contains the sequence shown in SEQ ID NO:910; and

[0185] (48) The sense chain contains the sequence shown in SEQ ID NO:882, and the antisense chain contains the sequence shown in SEQ ID NO:911;

[0186] Each of these chains is independently 19 to 25 nucleotides in length.

[0187] In some preferred embodiments, the aforementioned oligonucleotide comprises any of the following combinations of sense and antisense strands:

[0188] (1) The positive chain shown in SEQ ID NO:594 and the negative chain shown in SEQ ID NO:764;

[0189] (2) The positive chain shown in SEQ ID NO:593 and the negative chain shown in SEQ ID NO:610;

[0190] (3) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:773;

[0191] (4) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:774;

[0192] (5) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:775;

[0193] (6) The positive chain shown in SEQ ID NO:595 and the negative chain shown in SEQ ID NO:776;

[0194] (7) The positive chain shown in SEQ ID NO:596 and the negative chain shown in SEQ ID NO:777;

[0195] (8) The positive chain shown in SEQ ID NO:597 and the negative chain shown in SEQ ID NO:778;

[0196] (9) The positive chain shown in SEQ ID NO:598 and the negative chain shown in SEQ ID NO:779;

[0197] (10) The positive chain shown in SEQ ID NO:518 and the negative chain shown in SEQ ID NO:780;

[0198] (11) The positive chain shown in SEQ ID NO:536 and the negative chain shown in SEQ ID NO:782;

[0199] (12) The positive chain shown in SEQ ID NO:548 and the negative chain shown in SEQ ID NO:783;

[0200] (13) The positive chain shown in SEQ ID NO:554 and the negative chain shown in SEQ ID NO:785;

[0201] (14) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:854;

[0202] (15) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:857;

[0203] (16) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:864;

[0204] (17) The positive chain shown in SEQ ID NO:822 and the negative chain shown in SEQ ID NO:839;

[0205] (18) The justice chain shown in SEQ ID NO:827 and the antisense chain shown in SEQ ID NO:839;

[0206] (19) The positive chain shown in SEQ ID NO:831 and the negative chain shown in SEQ ID NO:839;

[0207] (20) The positive chain shown in SEQ ID NO:598 and the negative chain shown in SEQ ID NO:840;

[0208] (21) The positive chain shown in SEQ ID NO:832 and the negative chain shown in SEQ ID NO:841;

[0209] (22) The justice chain shown in SEQ ID NO:832 and the antisense chain shown in SEQ ID NO:842;

[0210] (23) The justice chain shown in SEQ ID NO:832 and the antisense chain shown in SEQ ID NO:848;

[0211] (24) The justice chain shown in SEQ ID NO:832 and the antisense chain shown in SEQ ID NO:849;

[0212] (25) The positive chain shown in SEQ ID NO:832 and the negative chain shown in SEQ ID NO:850;

[0213] (26) The positive chain shown in SEQ ID NO:833 and the negative chain shown in SEQ ID NO:858;

[0214] (27) The positive chain shown in SEQ ID NO:834 and the negative chain shown in SEQ ID NO:859;

[0215] (28) The positive chain shown in SEQ ID NO:835 and the negative chain shown in SEQ ID NO:860;

[0216] (29) The positive chain shown in SEQ ID NO:836 and the negative chain shown in SEQ ID NO:861;

[0217] (30) The positive chain shown in SEQ ID NO:837 and the negative chain shown in SEQ ID NO:862;

[0218] (31) The positive chain shown in SEQ ID NO:838 and the negative chain shown in SEQ ID NO:863;

[0219] (32) The justice chain shown in SEQ ID NO:882 and the antisense chain shown in SEQ ID NO:894;

[0220] (33) The positive chain shown in SEQ ID NO:882 and the negative chain shown in SEQ ID NO:902;

[0221] (34) The justice chain shown in SEQ ID NO:884 and the antisense chain shown in SEQ ID NO:896;

[0222] (35) The positive chain shown in SEQ ID NO:884 and the negative chain shown in SEQ ID NO:903;

[0223] (36) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:905;

[0224] (37) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:907;

[0225] (38) The justice chain shown in SEQ ID NO:882, and the antisense chain shown in SEQ ID NO:910; and

[0226] (39) The justice chain shown in SEQ ID NO:882 and the antisense chain shown in SEQ ID NO:911.

[0227] In some preferred embodiments, the aforementioned oligonucleotide comprises any of the following combinations of sense and antisense strands:

[0228] (1) The positive chain shown in SEQ ID NO:594 and the negative chain shown in SEQ ID NO:764;

[0229] (2) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:773;

[0230] (3) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:774;

[0231] (4) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:775;

[0232] (5) The positive chain shown in SEQ ID NO:595 and the negative chain shown in SEQ ID NO:776;

[0233] (6) The positive chain shown in SEQ ID NO:598 and the negative chain shown in SEQ ID NO:779;

[0234] (7) The positive chain shown in SEQ ID NO:518 and the negative chain shown in SEQ ID NO:780

[0235] (8) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:854;

[0236] (9) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:857;

[0237] (10) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:864;

[0238] (11) The positive chain shown in SEQ ID NO:822 and the negative chain shown in SEQ ID NO:839;

[0239] (12) The positive chain shown in SEQ ID NO:827 and the negative chain shown in SEQ ID NO:839;

[0240] (13) The positive chain shown in SEQ ID NO:831 and the negative chain shown in SEQ ID NO:839;

[0241] (14) The positive chain shown in SEQ ID NO:598 and the negative chain shown in SEQ ID NO:840;

[0242] (15) The positive chain shown in SEQ ID NO:832 and the negative chain shown in SEQ ID NO:841;

[0243] (16) The positive chain shown in SEQ ID NO:832 and the negative chain shown in SEQ ID NO:842;

[0244] (17) The justice chain shown in SEQ ID NO:832 and the antisense chain shown in SEQ ID NO:848;

[0245] (18) The justice chain shown in SEQ ID NO:832 and the antisense chain shown in SEQ ID NO:849;

[0246] (19) The positive chain shown in SEQ ID NO:832 and the negative chain shown in SEQ ID NO:850;

[0247] (20) The positive chain shown in SEQ ID NO:833 and the negative chain shown in SEQ ID NO:858;

[0248] (21) The positive chain shown in SEQ ID NO:834 and the negative chain shown in SEQ ID NO:859;

[0249] (22) The positive chain shown in SEQ ID NO:835 and the negative chain shown in SEQ ID NO:860;

[0250] (23) The justice chain shown in SEQ ID NO:836 and the antisense chain shown in SEQ ID NO:861;

[0251] (24) The justice chain shown in SEQ ID NO:837 and the antisense chain shown in SEQ ID NO:862;

[0252] (25) The positive chain shown in SEQ ID NO:838 and the negative chain shown in SEQ ID NO:863;

[0253] (26) The justice chain shown in SEQ ID NO:882 and the antisense chain shown in SEQ ID NO:894;

[0254] (27) The positive chain shown in SEQ ID NO:882 and the negative chain shown in SEQ ID NO:902;

[0255] (28) The justice chain shown in SEQ ID NO:884 and the antisense chain shown in SEQ ID NO:896;

[0256] (29) The positive chain shown in SEQ ID NO:884 and the negative chain shown in SEQ ID NO:903;

[0257] (30) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:905;

[0258] (31) The positive chain shown in SEQ ID NO:592 and the negative chain shown in SEQ ID NO:907;

[0259] (32) The justice chain shown in SEQ ID NO:882, and the antisense chain shown in SEQ ID NO:910; and

[0260] (33) The justice chain shown in SEQ ID NO:882 and the antisense chain shown in SEQ ID NO:911.

[0261] In some embodiments, at least one nucleotide of the aforementioned oligonucleotide or its salt is conjugated to one or more targeting ligands to form an siRNA conjugate. The aforementioned siRNA conjugate contains the aforementioned siRNA and a conjugating group attached to the siRNA. The term "oligonucleotide salt" refers to an oligonucleotide compound in salt form. Oligonucleotide salts include salts of oligonucleotide conjugated compounds and salts of unconjugated oligonucleotide compounds. Oligonucleotide salts are advantageously present in solid powder form.

[0262] Generally, the aforementioned conjugation group comprises at least one pharmaceutically acceptable targeting ligand and an optional linker, and the aforementioned siRNA, the aforementioned linker, and the aforementioned targeting ligand are sequentially linked. The targeting group can be a ligand commonly used in the field of siRNA drug delivery, such as the various ligands described in WO2009082607A2, the entire disclosure of which is incorporated herein by reference. In some embodiments, there are 2-4 aforementioned targeting ligands. The aforementioned siRNA molecule can be non-covalently or covalently conjugated to the aforementioned conjugation group, for example, it can be covalently conjugated to the aforementioned conjugation group. The conjugation site of the siRNA to the conjugation group can be at the 3' or 5' end of the sense or antisense strand of the siRNA, or it can be within the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugation group is at the 3' or 5' end of the sense strand of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugation group is at the 3' or 5' end of the antisense strand of the siRNA. In some preferred embodiments, the conjugation site of the aforementioned siRNA and the conjugating group is located at the 3' end of the siRNA's positive strand.

[0263] In some embodiments, the targeting ligand comprises a desialyl glycoprotein receptor ligand. In some embodiments, the desialyl glycoprotein receptor ligand comprises or is composed of one or more galactose derivatives. As used herein, the term "galactose derivative" includes galactose and lactose derivatives with an affinity for the desialyl glycoprotein receptor equal to or greater than that for galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-butyryl-galactosamine, and N-isobutyryl-galactosamine. Galactose derivatives and clusters of galactose derivatives that can be used to target the liver in vivo with oligonucleotides and other molecules are known in the art. Galactose derivatives have been used to target molecules to hepatocytes in vivo by binding to the desialyl glycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. Binding of ASGPr ligands to ASGPr(s) facilitates cell-specific targeting of hepatocytes and the entry of endocytic molecules into hepatocytes. ASGPr ligands can be monomers (e.g., having a single galactose derivative) or polymers (e.g., having multiple galactose derivatives). Galactose derivatives or clusters of galactose derivatives can be linked to the 3' or 5' end of the siRNA using methods known in the art.

[0264] In some embodiments, the pharmaceutically acceptable targeting ligand in the aforementioned siRNA conjugate can be galactose or N-acetylgalactosamine (GalNAc), wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. It should be understood that the monovalent, divalent, trivalent, and tetravalent meanings refer to the molar ratio of siRNA molecules to galactose or N-acetylgalactosamine molecules in the siRNA conjugate being 1:1, 1:2, 1:3, or 1:4, respectively, after the siRNA molecule forms a conjugate with a conjugate group containing galactose or N-acetylgalactosamine as a targeting ligand. In some embodiments, the pharmaceutically acceptable targeting ligand is N-acetylgalactosamine. In some embodiments, when the siRNA of the present invention is conjugated with a conjugate group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA of the present invention is conjugated with a conjugating group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0265] In some implementations, the targeting ligand is selected from carbohydrates, amino sugars, cholesterol, peptides, or lipids.

[0266] In some implementations, the targeting ligand comprises the N-acetylgalactosamine (GalNAc) moiety.

[0267] In some implementations, the aforementioned GalNac portion is a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

[0268] In some embodiments, the targeting ligand is A1 or L96. A1 is the GalNAc targeting ligand of formula (XII); L96 is N-[tris(GalNAc-alkyl)amidodecanoyl]-4-hydroxyprolylHyp-(GalNAc-alkyl)3(XIII) of formula (V).

[0269]

[0270] In another aspect, this disclosure provides a composition comprising the aforementioned oligonucleotide or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier.

[0271] In some embodiments, the dosage form of the aforementioned composition is an oral, intravenous, subcutaneous, or intramuscular injection.

[0272] In some preferred embodiments of this disclosure, the dosage form of the aforementioned composition is a subcutaneous injection.

[0273] In some implementations, the aforementioned combination also includes other medications for treating and / or preventing AGT-related diseases.

[0274] In another aspect, this disclosure provides the use of the aforementioned oligonucleotide or a pharmaceutically acceptable salt or composition thereof in the preparation of a medicament for treating and / or preventing AGT-related diseases.

[0275] Various formulations have been developed to facilitate the use of oligonucleotides. For example, oligonucleotides can be delivered to a subject or cellular environment using formulations that minimize degradation, facilitate delivery and / or uptake, or provide another beneficial property to the oligonucleotide in the formulation. In some embodiments, compositions comprising oligonucleotides (e.g., single-stranded or double-stranded oligonucleotides) to reduce AGT expression are provided herein. Such compositions can be suitably formulated such that when administered to a subject (in the direct environment of target cells or systemically), a sufficient fraction of the oligonucleotide enters the cells to reduce AGT expression. Any of a variety of suitable oligonucleotide formulations can be used to deliver oligonucleotides for reducing AGT, as disclosed herein. In some embodiments, the oligonucleotide or its conjugate is formulated in a buffer solution, such as an aqueous solution of phosphate-buffered saline, liposomes, micelle structures, and shells. The buffer solution may be selected from solutions of acetate, citrate, glutenin, carbonate, or phosphate, or any combination thereof. In some embodiments, the naked (i.e., without a delivery agent) oligonucleotide or its conjugate is formulated in water or an aqueous solution (e.g., pH-adjusted water). In some embodiments, the naked oligonucleotide or its conjugate is formulated in an alkaline buffer solution (e.g., PBS).

[0276] Formulations of oligonucleotides containing cationic lipids can be used to promote the transfection of oligonucleotides into cells. For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine) can be used.

[0277] Therefore, in some embodiments, the formulation comprises lipid nanoparticles. In some embodiments, the excipient comprises liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to the cells, tissues, organs, or body of a subject in need.

[0278] In some embodiments, the formulations disclosed herein include excipients. In some embodiments, the excipients impart to the composition enhanced stability, enhanced absorption, enhanced solubility, and / or therapeutic enhancement of the active ingredient. In some embodiments, the excipients are buffers (e.g., sodium citrate, sodium phosphate, tris base, or sodium hydroxide) or mediators (e.g., buffer solutions, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotides are lyophilized to extend their shelf life and then formulated into solutions prior to use (e.g., administration to a subject). Therefore, the excipients in compositions comprising any of the oligonucleotides described herein may be lyophilization protectants (e.g., mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone) or collapse temperature modifiers (e.g., dextran, ficoll, or gelatin).

[0279] In some embodiments, the pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Typically, the route of administration is intravenous or subcutaneous.

[0280] Pharmaceutical compositions suitable for injectable applications include sterile aqueous solutions (in the case of water solubility) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous or subcutaneous administration, suitable carriers include physiological saline, antibacterial water, Cremophor EL.™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). The aforementioned carriers can be solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. In many cases, isotonic agents, such as sugars, and polyols such as mannitol, sorbitol, and sodium chloride, are preferably included in the composition. Sterile injectable solutions can be prepared by incorporating the desired amount of oligonucleotides with one or a combination of the desired ingredients listed above into a selected solvent, followed by filtration sterilization.

[0281] In some embodiments, the composition may contain at least about 0.1% or more of a therapeutic agent (e.g., an oligonucleotide for reducing AGT expression), although the percentage of one or more active ingredients may be between about 1% and about 80% or more of the total composition by weight or volume. Those skilled in the art of preparing such pharmaceutical formulations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations, and therefore various dosages and treatment regimens may be desirable.

[0282] Even though many implementations involve liver-targeted delivery of any oligonucleotides disclosed herein, targeting other tissues is also considered.

[0283] In some embodiments, the administration of the oligonucleotide as described herein results in a reduction in the level of AGT expression in cells. In some embodiments, the reduction in AGT expression level may be a reduction to 1% or less, 5% or less, 10% or less, 15% or less, 20% or less, 25% or less, 30% or less, 35% or less, 40% or less, 45% or less, 50% or less, 55% or less, 60% or less, 70% or less, 80% or less, or 90% or less compared to an appropriate control level of AGT. An appropriate control level may be the level of AGT expression in cells or cell populations that have not been contacted with the oligonucleotide as described herein. In some embodiments, the effect of delivering the oligonucleotide to cells according to the methods disclosed herein is evaluated after a limited time period. For example, the level of AGT in the blood may be analyzed at least 8 hours, 12 hours, 18 hours, 24 hours after the aforementioned oligonucleotide is introduced into the cells; or at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks.

[0284] In some embodiments, the oligonucleotide is delivered in the form of a transgene engineered to express the oligonucleotide disclosed herein (e.g., in the form of shRNA) in cells. In some embodiments, the oligonucleotide is delivered using a transgene engineered to express any of the oligonucleotides disclosed herein. The transgene can be delivered using a viral vector (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or a non-viral vector (e.g., plasmid or synthetic mRNA). In some embodiments, the transgene can be injected directly into a subject.

[0285] On the other hand, this disclosure provides a method for preventing at least one symptom in subjects suffering from an dysregulation that would benefit from reduced AGT expression, such as AGT-related diseases, for example, hypertension, such as borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-primary hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive urgency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum preeclampsia), diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension. Hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other hyperglycemic states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosteronism and other hypermineralocorticoid states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina pectoris, stroke, diabetes (e.g., diabetic nephropathy), nephropathy (e.g., chronic nephropathy or diabetic nephropathy, optionally in a gestational setting), renal failure (e.g., chronic renal failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In certain implementations, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction. The method includes administering a therapeutically effective amount of the iRNA agent (e.g., dsRNA) or vector of the present invention to a subject, thereby preventing at least one symptom in a subject suffering from a dysregulation that would benefit from reduced AGT expression.

[0286] In some aspects, this disclosure provides methods for preventing diseases, conditions, symptoms, or illnesses as described herein in a subject by administering a therapeutic agent (e.g., an oligonucleotide or a vector or transgene encoding it) to the subject. In some embodiments, the subject to be treated is a subject who would benefit from a reduction in, for example, the amount of AGT protein.

[0287] The methods described herein generally involve administering an effective amount (i.e., an amount capable of producing the desired therapeutic outcome) of an oligonucleotide to a subject. A therapeutically acceptable amount may be an amount capable of treating a disease or condition. The appropriate dose for any subject will depend on several factors, including the subject's body size, body surface area, age, the specific composition to be administered, one or more active ingredients in the composition, the time and route of administration, overall health, and any other medications administered concurrently.

[0288] In some embodiments, any of the compositions disclosed herein are administered to a subject via the enteral (e.g., orally, via a gastric feeding tube, via a duodenal feeding tube, via a gastrostomy, or via the rectum), parenteral (e.g., subcutaneous injection, intravenous injection or infusion, intra-arterial injection or infusion, intramuscular injection), local (e.g., epidermal, inhalation, via eye drops, or via mucous membranes), or by direct injection into a target organ (e.g., the subject's liver). Typically, the oligonucleotides disclosed herein are administered intravenously or subcutaneously.

[0289] In some embodiments, the oligonucleotide is administered to the subject at a dose ranging from about 0.001 mg / kg to about 200 mg / kg (e.g., about 0.1 mg / kg to about 100 mg / kg). In some embodiments, the oligonucleotide is administered to the subject at a dose ranging from about 0.1 mg / kg to about 50 mg / kg, preferably from about 0.1 mg / kg to about 20 mg / kg, 0.3 mg / kg to about 18 mg / kg, 0.5 mg / kg to about 15 mg / kg, or 0.5 mg / kg to about 12 mg / kg, more preferably from about 1 mg / kg to about 10 mg / kg.

[0290] In some embodiments, the oligonucleotide is administered to the subject at a fixed dose of about 50 mg to about 800 mg. In some embodiments, the oligonucleotide is administered to the subject at a fixed dose of about 50 mg to about 200 mg, about 200 mg to about 400 mg, or about 400 mg to about 800 mg. In some embodiments, the oligonucleotide is administered to the subject at a fixed dose of about 100 mg, about 200 mg, about 300 mg, about 400 mg, 500 mg, about 600 mg, about 700 mg, or about 800 mg.

[0291] As a set of non-limiting examples, the oligonucleotides of this disclosure will be administered typically once a year, twice a year, quarterly (once every three months), every two months (once every two months), monthly, or weekly. In some embodiments, a fixed dose is administered to the subject at a monthly interval. In some embodiments, a fixed dose is administered to the subject at a six-month interval.

[0292] In some embodiments, the subject is administered a fixed dose of about 150 mg approximately every six months. In some embodiments, the subject is administered a fixed dose of about 300 mg approximately every six months. In some embodiments, the subject is administered a fixed dose of about 300 mg approximately every six months. In some embodiments, the subject is administered a fixed dose of about 600 mg approximately every six months. In some embodiments, the subject is administered a fixed dose of about 800 mg approximately every six months. In some embodiments, the subject is administered a fixed dose of about 800 mg approximately every six months.

[0293] In some implementations, the subject to be treated is a human (e.g., a human patient) or a non-human primate or other mammal subject. Other exemplary subjects include domestic animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters.

[0294] In another aspect, this disclosure provides a method for inhibiting angiotensinogen (AGT) gene expression in a subject, the method comprising administering to the subject a fixed dose of about 50 mg to about 800 mg of an oligonucleotide or a salt thereof.

[0295] In another aspect, this disclosure provides a method for preventing or treating a subject suffering from angiotensinogen (AGT)-related conditions, the method comprising administering to the subject a fixed dose of about 50 mg to about 800 mg of an oligonucleotide or a salt thereof.

[0296] In another aspect, this disclosure provides a method for lowering blood pressure levels in a subject, the method comprising administering to the subject a fixed dose of about 50 mg to about 800 mg of an oligonucleotide or a salt thereof.

[0297] In some embodiments, the method further includes administering to the subject other therapeutic agents for treating hypertension. In some embodiments, the other therapeutic agents are selected from: diuretics, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor antagonists, beta-blockers, vasodilators, calcium channel blockers, aldosterone antagonists, α2-agonists, renin inhibitors, α-blockers, peripherally acting adrenergic agents, selective D1 receptor partial agonists, non-selective α-adrenergic antagonists, synthetic steroidal anti-mineralocorticoid agents; any combination of the above; and hypertension therapeutic agents formulated into pharmaceutical combinations. In some embodiments, the other therapeutic agents include angiotensin II receptor antagonists. In other embodiments, the angiotensin II receptor antagonist is selected from: losartan, valsartan, olmesartan, eprosartan, and azilsartan.

[0298] For the purpose of clarity and concise description, the features are described herein as part of some identical or separate embodiments; however, it will be understood that the scope of this disclosure may include some embodiments having a combination of all or some of the features described.

[0299] The present disclosure will now be described in more detail with reference to specific embodiments. However, the embodiments are for illustrative purposes only and are not intended to limit the scope of the present disclosure.

[0300] Example

[0301] Unless otherwise specified in this article, such reagents can be obtained from any molecular biology reagent supplier, and their quality / purity standards are applicable to molecular biology.

[0302] Abbreviations for nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in oligonucleotides, are interconnected by 5'-3' phosphodiester bonds unless otherwise stated. And it should be understood that when a nucleotide contains a 2'-fluorine modification, the fluorine replaces the hydroxyl group at that position in the parent nucleotide (i.e., it is a 2'-deoxy-2'-fluoronucleotide).

[0303] Table A. Abbreviations for nucleotide monomers used in nucleic acid sequence representation

[0304]

[0305]

[0306] Preparation of targeted ligands

[0307] (i) L96 was prepared according to the method described in patent CN104717982B.

[0308] (ii) The preparation steps of A1 are as follows:

[0309] (1) Synthesis of intermediate E1

[0310]

[0311]

[0312] F1 (199.46 mg, 0.41 mmol) was dissolved in DMF and activated with HBTU (155.39 mg, 0.41 mmol), followed by the addition of DIEA (67.81 L, 0.41 mmol). After stirring for 30 min, intermediate G1 (100.0 mg, 0.14 mmol) was added to the reaction system. After stirring overnight, the reaction was confirmed to be complete by TLC. After concentration under reduced pressure, the mixture was separated by column chromatography (PE:EA = 10:1) to obtain intermediate I-F1 (174.98 mg, yield 58%). Intermediate I-F1 was reacted with palladium on carbon under hydrogen catalysis to remove the benzyl group, yielding intermediate II-F1 (156.34 mg, 95%). In DMF, the HBTU-activated intermediate II-F1 was coupled with (3R,5S)-5-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-3-pyrrolidone to obtain intermediate E1. 1 HNMR (400MHz, DMSO-D6): δ7.91-7.86(m,8H),7.51-7.45(m,6H),7.40-7.32(m,10H),7.02-6.95(m,3H),6.03-5.89( m,4H),5.31(d,3H),5.07-4.99(m,4H),4.43-4.37(m,3H),4.23-4.19(m,4H),4.17-4.13(m,6H),4.05-4.00(m,6H),3 .88-3.81(m,6H),3.77(s,6H),3.69-3.66(m,9H),3.50-3.47(m,12H),3.40-3.37(m,6H),3.20-3.16(m,16H),2.60- 2.57(m,2H),2.46(s,9H),2.30(s,9H),2.10(m,6H),2.07(s,9H),1.98(s,9H),1.56-1.45(m,8H),1.32-1.27(m,4H). HRMS[M+H] + m / z 2467(calcdfor C 115 H 168 N 14 O 45 ,2466).

[0313] (2) Synthesis of solid support A1 with protecting groups

[0314]

[0315] Intermediate E1 was treated with succinic anhydride in the presence of DMAP and Et3N to obtain a quantitative yield of hemisuccinate intermediate E1-1. Hemisuccinate intermediate E1-1 was then amino-coupled with an amino group of a 60% divinylbenzene (DVB) crosslinked (aminomethyl) polystyrene resin with an amine content of 250 mol / g to obtain a solid support A1 with a loading of 100 mol / g and protected groups.

[0316] Preparation of oligonucleotides

[0317] (1) Preparation of siRNA

[0318] The siRNA sequence was synthesized separately on a solid support via the sense strand (SS) and antisense strand (AS), and was obtained after deprotection, cleavage, purification, annealing, purification and lyophilization.

[0319] Solid-phase synthesis ( Figure 2 The sense and antisense strands were synthesized separately on a solid-phase support using an automated oligonucleotide synthesizer, employing phosphoramide technology. The synthesizer, such as the AKTA Oligopilot (Cytiva) or Dr. Oligo 192XLc (Kunshan Berlik Precision Instruments Co., Ltd.), was used. Solid-phase synthesis began at the 3' end of the sequence, with monomers sequentially coupled into the sequence. Each coupling of a phosphoramide monomer involved four chemical steps: 1) unblocking or deprotection (de-hydroxyl protecting group); 2) coupling; 3) oxidation; and 4) end-capping. All phosphoramidite monomers, reagents, and purification consumables used were commercially available. For example, various phosphoramidite monomers (such as 5'-O-(4,4'-Dimethoxytrityl)-2'-O-methyl-Uridine-3'-CE-Phosphoramidite) were purchased from Shanghai Zhaowei Technology Development Co., Ltd., and reaction reagents (such as 40wt% methylamine aqueous solution, 28wt% ammonium hydroxide aqueous solution, etc.) were purchased from Sigma-Aldrich LLC. The siRNA synthesis and purification methods used in this paper are as described in US20130178612A1 and US2015100197A1; the synthesis methods for VPUm and APU structural sequences are as described in J.Med.Chem.2018, 61, 734-744.

[0320] (2) Preparation of double-stranded RNA (dsRNA) drugs

[0321] (a) The synthesis of the chain of justice

[0322] Solid-phase phosphoramide synthesis is a mature method for synthesizing oligonucleotides. A computer-controlled synthesizer is used, and the reaction takes place in a stainless steel column. The positive chain synthesis begins with a solid support loaded with targeting ligands (e.g., L96 and A1), or directly with the solid support. Different starting materials, reagents, and solvents are injected sequentially from the 3' to 5' positions through different tubing lines controlled by the solid-phase synthesizer, linking phosphoramide nucleoside monomers one by one. The reaction process involves four cyclic steps: DMT protection removal, condensation, oxidation or thiolation, and end-capping. One nucleotide unit is linked in each cycle, yielding an oligonucleotide sequence of 19 or 21 nucleotides. After synthesis, the protecting group (2-cyanoethyl) is removed on the solid-phase column, and the synthesized sequence is cleaved from the solid support via ammonolysis. The sequence is filtered, the filter cake is washed with ethanol, and the filtrate and washings are collected and concentrated to obtain the crude positive chain. The crude product is purified by chromatography (SOURCE 15Q) and lyophilized to obtain the target product, the positive chain. In the synthesizer, siRNA positive strand conjugates were synthesized starting with a solid support loaded with a targeting ligand (e.g., L96); siRNA was synthesized directly starting with a solid support.

[0323] (b) Synthesis of antisense chains

[0324] Similar to the sense strand synthesis, the antisense strand is synthesized using a solid-phase synthesizer. Different starting materials, reagents, and solvents are injected sequentially from the 3' to 5' ends of the sequence through different tubing, linking phosphoramidine nucleoside monomers one by one. The reaction process involves four cyclic steps: DMT protection removal, condensation, oxidation or thiolation, and end-capping. One nucleotide unit is linked in each cycle, yielding an oligonucleotide sequence of 21 or 23 nucleotides. After synthesis, the protecting group (2-cyanoethyl) is removed on a solid-phase column, and the synthesized sequence is cleaved from the solid support via ammonolysis. The sequence is filtered, the filter cake is washed with ethanol, and the filtrate and washings are collected and concentrated to obtain the crude antisense strand. The crude product is purified by chromatography (SOURCE 15Q), ultrafiltered, and lyophilized to obtain the target product, antisense siRNA.

[0325] (c) Preparation of double-stranded siRNA

[0326] The AS and SS strands were dissolved separately in injection water and mixed in a defined ratio (1.01:1.0-1.2:1.0). The mixture was incubated at 30-50°C for 30-90 minutes and then cooled to room temperature. The double-stranded siRNA product was obtained by freeze-drying.

[0327] The double-stranded siRNA agents listed in Tables 2, 3, and 4 were prepared using the same method.

[0328] Example 1. Screening of AGT-siRNA activity in in vitro liver cell lines

[0329] First, a computer-based algorithm was used to generate candidate oligonucleotide sequences complementary to human AGT mRNA (NM_000029.3, Table 1). Some of these sequences were also complementary to or had no more than two mismatches with cynomolgus monkey AGT mRNA (XM_005443695.2, Table 1). Some were designed as double-stranded siRNAs with 19 / 21 pairings on the sense and antisense strands, with the antisense strand having two drooping ends complementary to the mRNA sequence. In some cases, the drooping ends of the antisense strand were non-complementary UU. Some sequences were designed as double-stranded siRNAs with 21 / 23 pairings on the sense and antisense strands, with the antisense strand having two drooping ends complementary to the mRNA sequence. Some sequences were designed as double-stranded siRNAs with 21 / 21 and 23 / 23 pairings. In some complementary pairing sequences, the first base at the 5' end of the antisense strand (the last base at the 3' end of the sense strand) was replaced with a base that did not match the AGT mRNA.

[0330] Table 1. Human and cynomolgus monkey AGT mRNA sequences

[0331]

[0332] Some oligonucleotides may contain GNA (glucan-diol nucleic acid) modifications. In some oligonucleotides, individual ribonucleic acid units are replaced with (Tgn), which is the S-isomer of thymidine-diol nucleic acid (GNA) shown in formula (I). In some oligonucleotides, individual ribonucleic acid units are replaced with (Cgn), which is the S-isomer of cytidine-diol nucleic acid (GNA) shown in formula (II). In some oligonucleotides, individual ribonucleic acid units are replaced with (Agn), which is the S-isomer of adenosine-diol nucleic acid (GNA) shown in formula (III). In some oligonucleotides, individual ribonucleic acid units are replaced with (Ggn), which is the S-isomer of guanosine-diol nucleic acid (GNA) shown in formula (IV). This indicates the link to the rest of the oligonucleotide. The structural formulas of Tgn, Cgn, Agn, and Ggn are as follows:

[0333]

[0334] Some oligonucleotide sequences may contain a 2'-5'-phosphodiester bond, wherein adjacent nucleoside unit pairs link 2'-5' to 5'-2'. In some oligonucleotides, individual ribonucleic acid is replaced by (U-2'5'), which is uridine-2'-phosphate as shown in formula (V). In some oligonucleotides, individual ribonucleic acid is replaced by (G-2'5'), which is guanosine-2'-phosphate as shown in formula (VI). In some oligonucleotides, individual ribonucleic acid is replaced by (C-2'5'), which is cytidine-2'-phosphate as shown in formula (VII). In some oligonucleotides, individual ribonucleic acid is replaced by (A-2'5'), which is adenosine-2'-phosphate as shown in formula (VIII). In some oligonucleotides, individual ribonucleic acid is replaced by (T-2'5'), which is thymidine-2'-phosphate as shown in formula (IX).

[0335]

[0336]

[0337] In Tables 2, 3, and 4, “G”, “C”, “A”, “U”, “T”, and “I” typically represent nucleotides with guanine, cytosine, adenine, uracil, thymine, and hypoxanthine as bases, respectively. The naked sequences in Tables 2, 3, and 4 refer to unmodified oligonucleotide sequences.

[0338] For nucleotide modifications: m represents 2'-methoxy; f represents 2'-deoxy-2'-fluorine; s represents thiophosphate; APU is uridine monophosphate (2'-acetamido-5'-vinylphosphonate-uridine monophosphate) modified with the 5'-phosphate analog shown in formula (X); VPUm is uridine monophosphate (2'-methoxy-5'-vinylphosphonate-uridine monophosphate) modified with the 5'-phosphate analog shown in formula (XI).

[0339]

[0340] A1 is the GalNAc targeting ligand shown in formula (XII); L96 is N-[tris(GalNAc-alkyl)amidodecanoyl]-4-hydroxyprolyl (Hyp-(GalNAc-alkyl)3) shown in formula (XIII).

[0341]

[0342]

[0343] Table 2. Naked Oligonucleotide Sequences

[0344]

[0345]

[0346]

[0347]

[0348] Table 3 Modified oligonucleotides

[0349]

[0350]

[0351]

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358] Table 4. siRNA sequences with targeting ligands

[0359]

[0360]

[0361] (1) Hep3B cell culture and transfection:

[0362] Human liver cancer cell line Hep3B (Shanghai Fushen Biotechnology Co., Ltd.) was used. Cells were incubated at 37℃ in a 5% CO2 incubator using DMEM medium (Hyclone, SH30022.01, 2g / L Glucose) supplemented with 10% FBS (aqlabteech, AQ-MV-06600) and 1% penicillin-streptomycin (Kaiji Biotechnology, KGY0023). Once cell confluence reached 90%, cells were digested with trypsin (Amresco, 0458-250G), and cell counts were performed using a cell counter (Nexcelom, Cellometer Mini). 150μl of cell suspension per well was seeded into 96-well plates, with a cell count of 2*102. 4 Cells / wells will adhere to the culture vessel the following day for transfection.

[0363] Use Lipofectamine TMTransfection was performed using RNAiMAX (thermofisher, 13778150). 5 μl (50 nM) of the diluted compound was dispersed in 20 μL of Opti-MEM (thermofisher, 1105821), and 0.2 μL of RNAiMAX was dispersed in 25 μL of Opti-MEM. The final concentration of siRNA was 5 nM. After incubation for 5 minutes, the siRNA was mixed with the compound dispersion and incubated for 10 minutes. Cells were then added to the transfection complex (n=2) and cultured at 37°C in a 5% CO2 incubator for 24 hours.

[0364] (2) Cell lysis

[0365] Remove the culture medium one day after transfection; wash with PBS; add 50 μl of lysis buffer to each well and store at -80℃.

[0366] (3) RT-qPCR

[0367] Prepare a mixture in an RNase-free centrifuge tube: 2.5 μl buffer, 0.2 μl Enzyme Mix (Foregene, DRT-02011), 0.4 μl lysis buffer, 0.4 μl 5 μM primers, and add RNase-free ddH2O to a final volume of 5 μl. Perform triplicate replications for each sample. Place the 96-well plate in a qPCR instrument (ROCGENE, Archimed) and run the following program: stage 1, 42℃, 5 min; 95℃, 10 sec; amplification, 95℃, 5 sec; 59℃, 20 sec; 72℃, 10 sec; 40 cycles; melting curve, 95℃, 15 sec, 59℃, 60 sec, 95℃, 15 sec.

[0368] (4) Data statistical analysis:

[0369] Export the data to Excel format using CT. AGT -CT hTBP The control group was normalized. To calculate the fold change in relative silencing efficiency, the data were analyzed using the ΔΔCT method. The results are shown in Tables 5 and 6. The data in each table are from individual experiments. Due to different cell batches, the silencing efficiency of the target gene may vary.

[0370] At a dosage of 0.05 nM, the inhibitory effects of the naked sequences AL0181001-AL0061069 and AL0181070-AL0181223 on the AGT gene expression level of Hep3B cell line are shown in Tables 5 and 6. The inhibition rate was between 10% and 90%, including AL0181001, AL0181002, AL0181003, AL0181004, AL0181005, AL0181006, AL0181012, AL0181014, AL0181019, AL0181020, AL0181021, AL0181033, AL0181038, AL0181040, AL0181042, AL0181043, AL0181045, AL0181046, and AL0 181050, AL0181051, AL0181053, AL0181056, AL0181059, AL0181060, AL0181061, AL0181062, AL0181063, AL0181065, AL 0181066, AL0181067, AL0181069, AL0181153, AL0181074, AL0181154, AL0181156, AL0181077, AL0181078, AL0181160, L0181084, AL0181167, AL0181089, AL0181169, AL0181170, AL0181171, AL0181090, AL0181091, AL0181092, AL0181097, AL0181098, AL0181099, AL0181178, AL0181102, AL0181103, AL0181104, AL0181105, AL0181181, AL0181183, AL0181185 The knockdown rates of AGT mRNA in groups AL0181108, AL0181110, AL0181111, AL0181112, AL0181187, AL0181189, AL0181113, AL0181115, AL0181195, AL0181128, AL0181135, AL0181136, AL0181215, AL0181217, AL0181218, AL0181147, and AL0181222 were greater than 75%, and even greater than 90%.

[0371] Table 2. Knockdown levels of naked sequence AGT siRNA

[0372]

[0373]

[0374] Table 6. Knockdown levels of naked AGT siRNA sequence

[0375]

[0376]

[0377] After sorting the mRNA inhibition rates from high to low, the top 15 were selected, and step-by-step siRNAs were designed based on sequence positions. All sequences were chemically modified. The knockdown of AGT mRNA in the modified sequence AL0185001-AL0185180 group at dosages of 0.5 nM and 0.05 nM is shown in Table 7.

[0378] Table 7. Knockdown levels of modified AGT siRNA sequences

[0379]

[0380]

[0381]

[0382]

[0383]

[0384] Example 2. Screening of the in vitro activity of chemically modified AGT-siRNA in primary monkey hepatocytes

[0385] (1) Cynomolgus monkey hepatocyte culture and transfection:

[0386] Using cynomolgus monkey hepatocytes (Beijing Ruide Biotechnology Co., Ltd., cmTCSC), the culture medium was preheated. The thawed culture medium (Beijing Ruide Biotechnology Co., Ltd., HEPO24) was then transferred to a biosafety cabinet. 4 mL of FBS was added to 36 mL of thawed culture medium (TPCS, HEPO24) to prepare a completely thawed medium, which was then heated in a 37°C water bath for 10 minutes. The cells were then treated with coating medium (Beijing Ruide Biotechnology Co., Ltd., HEPO44) in a CO2 incubator at 37°C for 0.5 h. Cells were removed from liquid nitrogen and thawed in a 37°C water bath for approximately 2 minutes. The cell suspension was then transferred to 40 mL of preheated thawed culture medium. The cryovials were washed with 2 mL of completely thawed culture medium. The cell suspension was centrifuged at 180 × g for 1 min, the supernatant was discarded, and 2 mL of preheated CM seeding medium (Beijing Ruide Biotechnology Co., Ltd., CMHEP054) was added. The cell suspension was gently dispersed and mixed. 20 μL of the cell suspension was used for cell counting. Based on the counting results, CM seeding medium was inoculated into 12-well plates at 3*10^5 / well and incubated at 37℃ with 5% CO2. After 4-5 hours of adhesion, the medium was aspirated and replaced with preheated medium (Beijing Ruide Biotechnology Co., Ltd., CMHEP064). Transfection was performed 6 hours after adhesion. Lipofectamine was used. TM Transfection was performed using 3000 TransfectionReagent (thermofisher, L3000150). System ① was diluted with 50 μl Opti-MEM (thermofisher, 1105821) to obtain 50 nM modified siRNA (Suzhou Beixin Biotechnology Co., Ltd.). System ② was diluted with 50 μl Opti-MEM to obtain 3 μl Lip3000. After standing for 5 min, systems ① and ② were mixed and stood for another 15 min. The mixture was then added to 12-well plates. After 4 h of transfection, the medium was replaced with DMEM / F12 complete medium, and the 12-well plates were incubated in an incubator for 48 h.

[0387] (2) Total RNA was extracted using the RNA-Quick Purification Kit (RNA rapid extraction kit, Yishan Biotechnology, RN001):

[0388] Remove the 12-well plate from the incubator, aspirate the culture medium, wash once with an appropriate amount of PBS, and add 500 μl of lysis buffer to each well. Transfer the supernatant to a new 1.5 ml centrifuge tube. Add 500 μl of anhydrous ethanol to the lysed cells and mix thoroughly (if precipitation occurs, this is normal; continue the procedure). Invert the centrifuge tube several times, or use a pipette to forcefully aspirate and blow 10 times to disperse any precipitate. Then add the liquid to the centrifuge column, place the centrifuge tube symmetrically in a centrifuge (Eppendorf, 5430), and centrifuge at 4000 × g for 1 min. Remove the centrifuge tube, add 500 μl of wash buffer to the column, and centrifuge at 12000 × g for 1 min. After centrifugation, be careful not to let the waste liquid in the collection tube come into contact with the RNA column to avoid contamination. Discard the waste liquid, put the RNA column back into the collection tube, and centrifuge the empty tube once to completely remove any residual wash buffer. Place the column on a clean, RNase-free 1.5 ml centrifuge tube, open the cap, and let it air dry for 2 minutes. Add 30 μl of elution buffer to the center of the RNA column membrane, incubate at room temperature for 2 minutes, centrifuge at 2000×g for 1 min to elute the RNA, and then place on ice. Measure the concentration of the eluted RNA for subsequent experiments. The extracted RNA can be used immediately for subsequent experiments or stored at -80℃ for later use.

[0389] (3) Use IIQ RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit (Novazia, R223-01) for cDNA synthesis:

[0390] Prepare a mixture in an RNase-free centrifuge tube: 4 μl 4×g DNA wiper Mix, 1 μg template RNA, and RNase-free ddH2O to a final volume of 16 μl to remove genomic DNA. Gently pipette to mix and incubate at 42°C for 2 min. Then, directly add 4 μl 5×HiScript II qRT SuperMix II to the reaction tube and gently pipette to mix. Incubate in a PCR instrument (Applied Biosystems, 9700) at 50°C for 15 min, then at 85°C for 5 sec, and finally at 4°C. The product can be used immediately for qPCR or stored at -20°C and used within six months. For long-term storage, aliquot and store at -80°C. Avoid repeated freeze-thaw cycles for cDNA.

[0391] (4) Quantitative PCR was performed using ChamQ SYBR qPCR Master Mix (Novazia, Q311-02):

[0392] Prepare a 20 μl mixture by adding 10 μl of 2×ChamQ SYBR qPCR Master Mix, 0.5 μl of Forward primer (Ruiboxingke), 0.5 μl of Reverse primer (Ruiboxingke), 1 μl of Template cDNA, and 8 μl of ddH2O. Each sample was tested in triplicate. The 96-well plate was placed in a qPCR instrument (ROCGENE, Archimed). The following program was executed: pre-denaturation, 95℃, 30 sec; amplification, 95℃, 10 sec, 60℃, 30 sec, 40 cycles; melting curve, 95℃, 15 sec, 60℃, 60 sec, 95℃, 15 sec.

[0393] (5) Data statistical analysis:

[0394] Export the data to Excel format using CT. AGT -CT GAPDH The control group was normalized. To calculate the fold change in relative silencing efficiency, the data were analyzed using the ΔΔCT method. The mean and standard deviation of the three parallel replicates were calculated. The results of the seven screenings of monkey primary cells are shown in Tables 8-14. The data in each table are from individual experiments. Due to different cell batches, the silencing efficiency of the target gene may vary. In some experiments, low concentrations may occur due to cell state. For example, at the dosage of 0.01 nM in Table 14, the deviation between the replicates of biological replicates is relatively large. Other concentrations and data with smaller errors at the same concentration should be referred to.

[0395] As shown in Table 8, using AL0185001 as the quality control standard, at a dosage of 0.5 nM, the inhibitory effects of siRNA in groups AL0185055-AL0185057, AL0185061-64, and AL0185091-AL0185094 were all higher than 90%. At a low dosage of 0.05 nM, except for groups AL0185062 and AL01850663, the inhibition rates of other siRNAs were all greater than 80%.

[0396] As shown in Table 9, using AL0185001 as the quality control standard, at a dosage of 0.5 nM, the inhibitory effects of other siRNAs, except for AL0185081 and AL0185188, were superior to those of AL0185001. At a low dosage of 0.05 nM, the inhibition rates of other siRNAs, except for AL0185089, were superior to those of AL0185001. Groups AL0185188-AL0185195 were modified with heat-labile bases (VPU and APU) based on groups AL0185081, AL0185085, AL0185087, and AL0185089. The results indicate that VPU or APU modification can further enhance the efficacy of siRNAs.

[0397] As shown in Table 10, using AL0185001 as the quality control standard, when the dosage was 0.5 nM, the inhibitory effect of other siRNAs was around 70%, except for AL0185104. When the dosage was low at 0.05 nM, the inhibition rate of other siRNAs decreased.

[0398] As shown in Table 11, using group AL0185001 as the quality control standard, at a dosage of 0.5 nM, the inhibitory effects of siRNA in groups AL0185210, AL0185215, AL0185219, AL0185220, AL0185221, AL0185222, AL0185228, AL0185229, and AL0185230 were all higher than 98%; at a low dosage of 0.05 nM, the inhibitory effects were all higher than 94%. All the siRNAs mentioned above underwent thermally unstable base modifications (VPU and APU). Specifically, group AL0185222 also exhibited (Tgn) modification; group AL0185228 received (C-2'5') modification; group AL0185229 received (A-2'5') modification; and group AL0185230 received (U-2'5') modification. These results indicate that VPU modification further enhances the efficacy of the siRNAs. GNA and 2'5' modifications reduced miRNA-like off-target activity in the seed region (positions 2-8 of the siRNA antisense strand), and the inhibitory effect on AGT mRNA still reached greater than 98%. These results demonstrate that VPU, APU, GNA, and 2'5' modifications further improve efficacy.

[0399] As shown in Table 12, using AL0185001 as the quality control standard, the efficacy can be further improved by introducing Im modifications at certain positions when the dosage is 0.01 nM or 0.05 nM. Examples include the series AL0185234, AL0185237, and AL0185244.

[0400] As shown in Table 13, replacing VPUm or bases with DNA modification can further improve drug efficacy. For example, compared with the AL0185258 group, the efficacy can be increased by 2-3 times after adding VPUm or replacing DNA modification, especially at lower dosing concentrations. For example, the silencing efficiency of target protein mRNA in the AL0185255, AL0185259, AL0185257, AL0185268, AL0185269 and AL0185270 groups can reach more than 80%.

[0401] As shown in Table 14, the efficacy of the drug can be stabilized after adding A-2'5', U-2'5', C-2'5', or G-2'5' modification at positions 6-7 of the antisense strand. This is because the modification can reduce the thermal stability of the seed region and reduce the off-target risk of the sequence. At a dosage of 0.05 nM, the AL0185259 group has the best efficacy. At a concentration of 0.01 nM, compared with the group without A-2'5', U-2'5', C-2'5', or G-2'5' modification, the silencing activity of siRNA is improved, such as the sequences AL0185272, AL0185274, AL0185277, and AL0185278. This indicates to some extent that at relatively low dosages, A-2'5', U-2'5', C-2'5', or G-2'5' modification can sometimes achieve better target gene silencing effects.

[0402] Table 8. Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys.

[0403]

[0404] Table 9. Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys II

[0405]

[0406]

[0407] Table 10 Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys III

[0408]

[0409] Table 11 Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys IV

[0410]

[0411] Table 12 Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys V

[0412]

[0413] Table 13 Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys VI

[0414]

[0415] Table 14 Inhibition results of AGT siRNA in primary hepatocytes of cynomolgus monkeys VII

[0416]

[0417] Example 3. Activity screening of AGT siRNA in hepatocyte lines

[0418] (1) Cell culture and transfection:

[0419] Human liver cancer cell lines Hep3B, Huh7, and HepG2 (Shanghai Fushen Biotechnology Co., Ltd.) were used. Cells were incubated at 37°C in a 5% CO2 incubator using DMEM medium (Hyclone, SH30022.01, 2 g / L glucose) supplemented with 10% FBS (aqlabteech, AQ-MV-06600) and 1% penicillin-streptomycin (Kaiji Biotechnology, KGY0023). Once cell confluence reached 90%, cells were digested with trypsin (Amresco, 0458-250G), and cell counts were performed using a Nexcelom cellometer (cellometer Mini). 150 μl of cell suspension per well was seeded into 96-well plates, with a cell count of 2*102. 4 Cells / wells will adhere to the culture vessel the following day for transfection.

[0420] Use Lipofectamine TM RNAiMAX (thermofisher, 13778150) was transfected. 5 μl (5 nM, 0.5 nM, and 0.1 nM) of the diluted compound was dispersed in 20 μL of Opti-MEM (thermofisher, 1105821), and 0.2 μL of RNAiMAX was dispersed in 25 μL of Opti-MEM. The final concentrations of siRNA were 0.5 nM, 0.05 nM, and 0.01 nM, respectively. After incubation for 5 minutes, the siRNA was mixed with the compound dispersion and incubated for 10 minutes. Cells were then added to the transfection complex (n=2) and cultured at 37°C in a 5% CO2 incubator for 24 hours.

[0421] (2) Cell lysis

[0422] Remove the culture medium one day after transfection; wash with PBS; add 50 μl of lysis buffer to each well and store at -80℃.

[0423] (3) RT-qPCR

[0424] Prepare a mixture in an RNase-free centrifuge tube: 2.5 μl buffer, 0.2 μl Enzyme Mix (Foregene, DRT-02011), 0.4 μl lysis buffer, 0.4 μl 5 μM primers, and add RNase-free ddH2O to a final volume of 5 μl. Perform triplicate replications for each sample. Place the 96-well plate in a qPCR instrument (ROCGENE, Archimed) and run the following program: stage 1, 42℃, 5 min; 95℃, 10 sec; amplification, 95℃, 5 sec; 59℃, 20 sec; 72℃, 10 sec; 40 cycles; melting curve, 95℃, 15 sec, 59℃, 60 sec, 95℃, 15 sec.

[0425] (4) Data statistical analysis:

[0426] Export the data to Excel format using CT. AGT -CT hTBP The control group was normalized. To calculate the fold change in relative silencing efficiency, the data were analyzed using the ΔΔCT method. The results are shown in Tables 15 and 16. The data in each table are from individual experiments. Due to differences in cell batches, the silencing efficiency for the target gene may vary.

[0427] As shown in Table 15, at doses of 0.5 nM and 0.01 nM, the naked sequence AL0181240 group showed better average inhibition of AGT gene expression in Hep3B, HepG2 and Huh7 cell lines than other sequences in most cases, especially at the low dose of 0.01 nM.

[0428] As shown in Table 16, at dosages of 0.5 nM, 0.05 nM, and 0.01 nM, the modified sequences of the AL0185199, AL0185234, and AL0185237 groups showed significantly higher silencing efficiency for AGT mRNA than the AL0185300 group at all three dosages (P < 0.05).

[0429] Table 15 Inhibitory effect of AGT siRNA in hepatocyte lines

[0430]

[0431] Table 16 Inhibitory effect of AGT siRNA in hepatocyte lines

[0432]

[0433] Note: Perform a paired t test with AL018300.

[0434] Example 4. In vivo testing of AGT RNAi agent in mice I

[0435] The experiment used SPF-grade male B6.Cg-Tg(hAGT)2041Sig / J mice (source: Jackson Laboratory). Serum samples were obtained on day 0 of drug administration before administration, and mice were randomly assigned to groups according to their hAGT levels. B6.Cg-Tg(hAGT)2041Sig / J mice were administered a single subcutaneous dose of 3 mg / kg of AGT RNAi. Blood samples were collected from the eyes at weeks 1, 2, 3, 4, 5, 6, 7, and 8 after drug administration, and the samples were sent for testing within 1 hour of collection. hAGT expression levels were measured, with pre-administration levels serving as a control. No death or near-death symptoms were observed in any animals during the experiment. No significant abnormalities were observed in any animals during clinical observation.

[0436] The experimental groups are shown in Table 17; the hAGT change levels are as follows: Figure 3 .

[0437] Table 17 Dosing Grouping Table

[0438]

[0439]

[0440] Depend on Figure 3 It can be seen that, compared with before drug administration, at week 3 after drug intervention, the knockdown effect of all AGT siRNAs except AL0187004 reached the lowest level (above 90%), and then gradually and slowly recovered. After week 6, the level of hAGT in the blood of the AL0187002, AL0187004 and AL0187009 groups had returned to the level before drug administration. Drug intervention significantly reduced hAGT levels in mouse blood, with the most significant and longest-lasting reduction observed in groups AL0187003, AL0187006, AL0187007, AL0187008, AL0187010, and AL0187011. Even after 8 weeks of administration, the drug still maintained approximately 50% inhibition of hAGT. Groups AL0187005, AL0187006, AL0187007, AL0187008, AL0187010, and AL0187011 showed significant differences compared to group AL0187002 (P < 0.05).

[0441] Example 4. In vivo testing of AGT RNAi agent in mice II

[0442] Different modifications were made to siRNA sequences exhibiting good in vitro and in vivo efficacy to investigate the effects of these modifications on drug efficacy. SPF-grade male B6.Cg-Tg(hAGT)2041Sig / J mice (source: Jackson Laboratory) at 8–9 weeks of age were used in the experiment. Serum samples were obtained on day 0 of drug administration, and mice were randomly assigned to groups according to hAGT levels. B6.Cg-Tg(hAGT)2041Sig / J mice were administered a single subcutaneous dose of 3 mg / kg of AGT RNAi. Blood samples were collected from mice at weeks 1, 2, 3, 4, and 5 post-administration (ocular blood samples were collected and sent for testing within 1 hour of collection) to measure hAGT expression levels, using the pre-administration level as a control. No deaths or near-death symptoms were observed in any animals during the experiment. No significant abnormalities were observed in any animals during clinical observation.

[0443] The experimental groups are shown in Table 18; the hAGT change levels are as follows: Figure 4 .

[0444] Table 18 Dosing Grouping Table

[0445]

[0446] Depend on Figure 4 It can be seen that, compared with before drug administration, at week 2 after drug intervention, except for AL0187002, AL0187013, and AL0187015, the knockdown effect of all other AGT siRNAs reached its lowest level (above 90%), and then gradually and slowly recovered. After week 5, the blood hAGT level in the AL0187002 and AL0187013 groups recovered more quickly. Drug intervention can significantly reduce the blood hAGT level in mice, with the most significant reductions observed in the AL0187006, AL0187012, AL0187014, AL0187015, AL0187016, AL0187017, AL0187018, and AL0187019 groups. Furthermore, after 5 weeks of drug administration, the inhibition of hAGT by the drug was still approximately 75%, which was significantly different from the AL0187002 group (P < 0.05).

[0447] Example 5. In vivo testing of AGT RNAi agent in mice III

[0448] Different modifications were made to siRNA sequences exhibiting good in vitro and in vivo efficacy to investigate the effects of these modifications on drug efficacy. SPF-grade male B6.Cg-Tg(hAGT)2041Sig / J mice (source: Jackson Laboratory) at 8–9 weeks of age were used in the experiment. Serum samples were obtained on day 0 of drug administration, and mice were randomly assigned to groups according to hAGT levels. B6.Cg-Tg(hAGT)2041Sig / J mice were administered a single subcutaneous dose of 3 mg / kg of AGT RNAi. Blood samples were collected from mice at weeks 1, 2, 3, 4, and 5 post-administration (ocular blood samples were collected and sent for testing within 1 hour of collection) to measure hAGT expression levels, using the pre-administration level as a control. No deaths or near-death symptoms were observed in any animals during the experiment. No significant abnormalities were observed in any animals during clinical observation.

[0449] The experimental groups are shown in Table 19; the hAGT change levels are as follows: Figure 5 and Figure 6 .

[0450] Table 19 Dosing Grouping Table

[0451]

[0452]

[0453] Depend on Figure 5 and Figure 6 It can be seen that, compared with before drug administration, at week 2 after drug intervention, except for groups AL0187002, AL0187021, AL0187030, and AL0187033, the knockdown effect of other AGT siRNAs reached its lowest level (above 90%), and then gradually and slowly recovered. After week 5, the blood hAGT level in groups AL0187030, AL0187033, and AL0187002 recovered more quickly. Drug intervention can significantly reduce the blood hAGT level in mice, with the most significant reductions observed in groups AL0187020, AL0187023, AL0187024, AL0187025, and AL0187028. Furthermore, even after 5 weeks of drug administration, the inhibition of hAGT by the drug can still reach 80%, which is significantly different from group AL0187002 (P < 0.05).

[0454] Example 6. In vivo testing of AGT RNAi agent in mice IV

[0455] The experiment was the same as in Example 5, with groupings shown in Tables 20 and 21. Both experiments were conducted separately. During the experiments, no animals showed signs of death or near-death. Clinical observation revealed no significant abnormalities in any animal. hAGT levels were as follows: Figure 7 and Figure 8 .

[0456] Table 20 Dosing Grouping Table

[0457]

[0458] Table 21 Drug administration grouping table

[0459]

[0460] Depend on Figure 7 It can be seen that, compared with before drug administration, the knockdown effect of other AGTsiRNAs reached its lowest level (above 80%) in the second week after drug intervention, except for the AL0187041 group, and then gradually and slowly recovered. Drug intervention can significantly reduce the level of hAGT in the blood of mice, with the most significant reductions observed in the AL0187024, AL0187037, AL0187040, AL0187043, AL0187045, AL0187047, AL0187048, and AL0187049 groups. Furthermore, the inhibition of hAGT by the drugs can still reach 80% five weeks after drug administration.

[0461] Depend on Figure 8 It can be seen that when the dosage is 1 mg / kg, the knockdown effect of AGTsiRNA reached its lowest point in the second week after drug intervention compared with before drug administration, and then gradually and slowly recovered. Drug intervention can significantly reduce the level of hAGT in the blood of mice, with the most significant reductions observed in groups AL0187024, AL0187040, AL0187047, and AL0187051. Furthermore, the inhibition of hAGT by the drug can still reach 80% four weeks after drug administration.

[0462] Example 7. Efficacy testing of AGT RNAi agent in non-human primates (NHP)

[0463] The efficacy of siRNA sequences exhibiting good drug efficacy in hAGT transgenic mice was evaluated in cynomolgus monkeys. Male cynomolgus monkeys aged 10-22 years (from Kunming Keling Biotechnology Co., Ltd. (KBI)) were used in the experiment. Serum samples were obtained on day 0 before administration, and participants were randomly assigned to groups according to AGT levels. All experimental groups received 1 mg / kg of the AGT RNAi agent. The experiment was divided into the following three groups:

[0464] Group 1: Blood samples were collected from cynomolgus monkeys at weeks 1, 2, 3, 4, and 5 after drug administration to measure AGT expression levels, with pre-administration levels serving as a control. AGT knockdown levels were also measured. No significant abnormalities were observed in any animal during the experiment. Experimental groups are shown in Table 22; AGT level changes are as follows: Figure 9 .

[0465] Group 2: Blood samples were collected from cynomolgus monkeys at weeks 1, 2, 3, 4, 5, and 6 after drug administration to measure AGT expression levels, with the pre-administration level serving as a control. AGT knockdown levels were also measured. No significant abnormalities were observed in any animal during the experiment. Experimental groups are shown in Table 23; AGT level changes are as follows: Figure 10 .

[0466] Group 3: Blood samples were collected from cynomolgus monkeys at weeks 1, 2, 3, 4, 5, 6, 7, 8, and 10 after drug administration. AGT expression levels were measured, with pre-administration levels serving as a control. AGT knockdown levels were also measured. No significant abnormalities were observed in any animal during the experiment. Experimental groups are shown in Table 24; AGT level changes are as follows: Figure 11 .

[0467] Table 22 Dosing Grouping Table

[0468]

[0469] Table 23 Drug Grouping Table

[0470]

[0471] Table 24 Drug Grouping Table

[0472]

[0473] Depend on Figure 9 , 10 As shown in Figures 1 and 11, compared with pre-drug administration, the knockdown effect of all AGT siRNAs reached its lowest point in week 3 after drug intervention, and then gradually and slowly recovered. Drug intervention significantly reduced AGT levels in the blood of cynomolgus monkeys. In the first group of experiments, the most significant effects were observed in groups AL0187020, AL0187022, and AL0187024, and even after 5 weeks of administration, the drug-induced AGT inhibition still reached 75%, showing a significant difference compared to group AL0187002 (P < 0.05). In the second and third groups of experiments, groups AL0187047, AL0187040, and AL0187051 showed significant efficacy, and even after 7 weeks of administration, the inhibition of AGT could still reach 70%, or even more than 80%.

Claims

1. An oligonucleotide or a pharmaceutically acceptable salt thereof for reducing AGT expression, said oligonucleotide comprising a sense strand and an antisense strand, said sense strand comprising the sequence shown in SEQ ID NO: 113; said antisense strand comprising the sequence shown in SEQ ID NO: 811; wherein: The sequence shown in SEQ ID NO: 113 is as follows: GCGUUUCUCCUUGGUCUAAGA; The sequence shown in SEQ ID NO: 811 is as follows: UCUUAGACCAAGGAGAAACICCU; The sense strand is 21 to 23 nucleotides long and the antisense strand is 23 to 25 nucleotides long.

2. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1, wherein, The pharmaceutically acceptable salts of the oligonucleotides are selected from carboxylates, sodium salts, triethylamine salts, and other pharmaceutically acceptable salts.

3. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The sense strand of the oligonucleotide contains a modification sequence of the sequence shown in SEQ ID NO: 113; the antisense strand of the oligonucleotide contains a modification sequence of the sequence shown in SEQ ID NO: 811; all nucleotides in the modification sequences of the sense and antisense strands are modified nucleotides. At least one of the modified nucleotides is selected from the group consisting of: 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, 2'-5'-linked ribonucleotides, unlocked nucleotides, conformation-restricted nucleotides, restricted ethyl nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2'-methoxyethyl modified nucleotides, morpholino nucleotides, aminophosphates, tetrahydropyran modified nucleotides, 1,5-dehydrohexyl modified nucleotides, cyclohexenyl modified nucleotides, nucleotides including thiophosphate groups, nucleotides including methylphosphonate groups, nucleotides including 5'-phosphates, and nucleotides including 5'-phosphate analogs; wherein the 5'-phosphate analog modified nucleotide is APU as shown in formula (X); or, the 5'-phosphate analog modified nucleotide is VPUm as shown in formula (XI): ; 。 4. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The sense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 113; the antisense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 811; all nucleotides in the modified sequences of the sense and antisense strands are modified nucleotides; at least one of the modified nucleotides is selected from the group consisting of: LNA-modified nucleotides, HNA-modified nucleotides, CeNA-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-allyl-modified nucleotides, 2'-fluorine-modified nucleotides, and 2'-deoxy-modified nucleotides.

5. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The sense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 113; the antisense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 811; all nucleotides in the modified sequences of the sense and antisense strands are modified nucleotides; at least one of the modified nucleotides is selected from the group consisting of: deoxynucleotides, 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, ethylene glycol modified nucleotides, nucleotides including 2'-phosphate esters, and nucleotides including thiophosphate ester groups.

6. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The sense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 113; the antisense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 811; all nucleotides in the modified sequences of the sense and antisense strands are modified nucleotides; the oligonucleotide contains at least one 2'-modified nucleotide.

7. The oligonucleotide of claim 6 or a pharmaceutically acceptable salt thereof, wherein, The 2'-modified nucleotide is selected from 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-fluorine-modified nucleotides, 2'-acylamino-modified nucleotides, 2'-deoxy-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, 2'-deoxynucleotides, nucleotides including 2'-phosphate esters, and nucleotides modified with 2'-O-(N-methylacetamide).

8. The oligonucleotide of claim 6 or a pharmaceutically acceptable salt thereof, wherein, The 2'-modification is selected from the following: 2'-methoxy, 2'-acetamido, 2'-aminoethyl, 2'-fluorine, and 2'-O-methoxyethyl.

9. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The sense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 113; the antisense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 811; all nucleotides in the modified sequences of the sense and antisense strands are modified nucleotides; the oligonucleotide contains a 2'-5'-phosphodiester bond; the oligonucleotide contains a uridine-2'-phosphate ester selected from the following: uridine-2'-phosphate ester of formula (V); guanosine-2'-phosphate ester of formula (VI); cytidine-2'-phosphate ester of formula (VII); adenosine-2'-phosphate ester of formula (VIII); and thymidine-2'-phosphate ester of formula (IX); 、 、 、 、 。 10. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The sense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 113; the antisense strand of the oligonucleotide contains a modified sequence of the sequence shown in SEQ ID NO: 811; all nucleotides in the modified sequences of the sense and antisense strands are modified nucleotides; the oligonucleotide contains at least one modified nucleotide inter-bond. The at least one modified nucleotide inter-bond is a phosphate thioester bond.

11. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, The oligonucleotide comprises a combination of the following sense and antisense strands: The sense chain comprises the sequence shown in SEQ ID NO: 592, and the antisense chain comprises the sequence shown in SEQ ID NO: 857; wherein: The sequence shown in SEQ ID NO: 592 is as follows: GmsCmsGmUmUmUmCmUmCfCfUfUmGmGmUmCmUmAmAmGmAm The sequence shown in SEQ ID NO: 857 is as follows: VPUmsCfsUmUmAmGfAmCmCfAmAmGmGmAfGmAfAmAmCmImCmsCmsUm m represents 2'-methoxy; f represents 2'-fluorine; s represents that the internucleotide bond is a phosphate thioester bond; 。 12. The oligonucleotide or a pharmaceutically acceptable salt thereof according to claim 1 or 2, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

13. The oligonucleotide of claim 12 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

14. The oligonucleotide of claim 12 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 15. The oligonucleotide of claim 3 or a pharmaceutically acceptable salt thereof, wherein, The oligonucleotide contains at least one modified internucleotide bond; The at least one modified nucleotide inter-bond is a phosphate thioester bond.

16. The oligonucleotide of claim 3 or a pharmaceutically acceptable salt thereof, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

17. The oligonucleotide of claim 16 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

18. The oligonucleotide of claim 16 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 19. The oligonucleotide of claim 4 or a pharmaceutically acceptable salt thereof, wherein, The oligonucleotide contains at least one modified internucleotide bond; The at least one modified nucleotide inter-bond is a phosphate thioester bond.

20. The oligonucleotide of claim 4 or a pharmaceutically acceptable salt thereof, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

21. The oligonucleotide of claim 20 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

22. The oligonucleotide of claim 20 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 23. The oligonucleotide of claim 5 or a pharmaceutically acceptable salt thereof, wherein, The oligonucleotide contains at least one modified internucleotide bond; The at least one modified nucleotide inter-bond is a phosphate thioester bond.

24. The oligonucleotide of claim 5 or a pharmaceutically acceptable salt thereof, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

25. The oligonucleotide of claim 24 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

26. The oligonucleotide of claim 24 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 27. The oligonucleotide of claim 6 or a pharmaceutically acceptable salt thereof, wherein, The oligonucleotide contains at least one modified internucleotide bond; The at least one modified nucleotide inter-bond is a phosphate thioester bond.

28. The oligonucleotide of claim 6 or a pharmaceutically acceptable salt thereof, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

29. The oligonucleotide of claim 28 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

30. The oligonucleotide of claim 28 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 31. The oligonucleotide of claim 9 or a pharmaceutically acceptable salt thereof, wherein, The oligonucleotide contains at least one modified internucleotide bond; The at least one modified nucleotide inter-bond is a phosphate thioester bond.

32. The oligonucleotide of claim 9 or a pharmaceutically acceptable salt thereof, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

33. The oligonucleotide of claim 32 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

34. The oligonucleotide of claim 32 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 35. The oligonucleotide of claim 11 or a pharmaceutically acceptable salt thereof, wherein, At least one nucleotide of the oligonucleotide is conjugated to one or more target ligands; The targeting ligand comprises the N-acetylgalactosamine GalNAc moiety.

36. The oligonucleotide of claim 35 or a pharmaceutically acceptable salt thereof, wherein, The GalNac portion can be a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion.

37. The oligonucleotide of claim 35 or a pharmaceutically acceptable salt thereof, wherein, The targeting ligand is A1 as shown in formula (XII): And / or, the targeting ligand is L96 as shown in formula (XIII): 。 38. A composition comprising any one of the oligonucleotides of claims 1 to 37 or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier.

39. The composition of claim 38, wherein, The composition is available in oral or injectable form.

40. The composition of claim 39, wherein, The injectable is selected from intravenous injections, subcutaneous injections, and intramuscular injections.

41. Use of the oligonucleotide of any one of claims 1 to 37 or a pharmaceutically acceptable salt thereof, or the composition of any one of claims 38 to 40, in the preparation of a medicament for treating AGT-related diseases; The AGT-related diseases are selected from hypertension, preeclampsia, eclampsia, hypertensive heart disease, atherosclerosis, heart failure, myocardial infarction, diabetic nephropathy, glomerulosclerosis, chronic kidney disease, intrauterine growth retardation, and fetal growth restriction.

42. The use as described in claim 41, wherein, The hypertension referred to is selected from borderline hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic or diastolic hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

43. The use as described in claim 41, wherein, The heart failure mentioned is chronic heart failure.

44. The use as described in claim 41, wherein, The heart failure mentioned refers to left ventricular systolic dysfunction.

45. Use of the oligonucleotide of any one of claims 1 to 37 or a pharmaceutically acceptable salt thereof, or the composition of any one of claims 38 to 40, in combination with other medicaments for treating AGT-related diseases in the preparation of a medicament for treating AGT-related diseases; The AGT-related diseases are selected from hypertension, preeclampsia, eclampsia, hypertensive heart disease, atherosclerosis, heart failure, myocardial infarction, diabetic nephropathy, glomerulosclerosis, chronic kidney disease, intrauterine growth retardation, and fetal growth restriction.

46. ​​The use as described in claim 45, wherein, The hypertension referred to is selected from borderline hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive urgency, isolated systolic or diastolic hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

47. The use as described in claim 45, wherein, The heart failure mentioned is chronic heart failure.

48. The use as described in claim 45, wherein, The heart failure mentioned refers to left ventricular systolic dysfunction.