Adeno-associated virus mutants and their applications

Abstract

The present invention belongs to the field of biomedicine technology, and discloses an adeno-associated virus mutant and its application. The amino acid sequence of the adeno-associated virus capsid protein mutant of the present invention includes a sequence as shown in any one of SEQ ID No. 4. The present invention uses the adeno-associated virus capsid protein mutant and its expression vector, host cell, and recombinant adeno-associated virus in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases. The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting, and the muscle targeting is increased by about 258 times at most, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity. The present invention can promote the AAV-based gene therapy method towards large-scale and socialized application.

Description

[0001] This invention patent application is a divisional application based on Chinese patent application No. 2024108238929, filed on June 25, 2024, with the invention name “Adeno-associated virus mutants and their applications”. Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to an adeno-associated virus mutant and applications thereof. Background Art

[0003] Adeno-associated virus (AAV) is a small, non-enveloped virus encapsidated by a linear, single-stranded DNA genome. It belongs to the genus Dependovirus in the family Parvoviridae and requires a helper virus (usually an adenovirus) for replication. The AAV genome is a single-stranded DNA fragment contained within a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (the Rep gene and the Cap gene) and an inverted terminal repeat (ITR). Recombinant adeno-associated viral vectors (rAAV) are derived from non-pathogenic wild-type AAV. Due to their advantages, such as a broad host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, excellent diffusion properties, and stable physical properties, they are widely used as gene transfer vectors in gene therapy and vaccine research. In medical research, rAAV has been used in gene therapy studies for a variety of diseases (including in vitro and in vivo experiments), such as studying gene function, establishing disease models, and generating knockout mice.

[0004] In recent years, gene therapy has emerged as a novel approach for treating muscle diseases, with AAV (AAV) being widely used as an effective gene delivery vehicle. Duchenne muscular dystrophy (DMD), for example, is a rare, fatal neuromuscular genetic disease that affects one in every 3,500 to 5,000 males worldwide. DMD is caused by alterations or mutations in the gene encoding the dystrophin protein. Symptoms of DMD typically appear in infants and young children, and affected patients may experience developmental delays, such as difficulty walking, climbing stairs, or standing from a sitting position. Elevidys (trade name), also known as delandistrogene moxeparvovec and previously known as SRP-9001, is a gene therapy delivered by the AAVrh74 vector and expressing a truncated DMD gene (micro-dystrophin) in DMD patients using the MHCK7 promoter. Several other AAV treatments are currently underway or in clinical trials. However, AAV treatments also carry potential risks. For example, excessive doses may trigger an immune system response, leading to side effects. In addition, high doses also mean greater production difficulty and higher costs.

[0005] In addition, although the current AAV screening strategy based on directed evolution can obtain some effective mutants in large-scale screening, the screening process is cumbersome and expensive. In particular, the failure of targeting ability caused by species differences and the huge cost of screening in monkeys not only increase the threshold for researchers to participate, but the high development costs are ultimately reflected in the cost of medication.

[0006] Therefore, the main purpose of AAV serotype modification is to develop serotypes with better therapeutic effects, lower therapeutic doses, reduced side effects and usage costs, so as to obtain drugs with higher targeting and thus reduce drug doses, or to make drugs with better specificity and thus avoid adverse reactions. Summary of the Invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant with muscle or heart targeting and its application.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides an adeno-associated virus capsid protein mutant, the amino acid sequence of which includes a sequence as shown in any one of SEQ ID Nos. 1 to 4.

[0010] The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting, especially good targeting to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting is increased by up to about 258 times, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity.

[0011] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, a targeting peptide is inserted into the amino acid sequence; the amino acid sequence of the targeting peptide is any one of SEQ ID Nos. 5 to 8.

[0012] In a second aspect, the present invention provides a nucleic acid encoding the adeno-associated virus capsid protein mutant.

[0013] As a preferred embodiment of the nucleic acid of the present invention, its nucleotide sequence comprises the nucleotide sequences shown in SEQ ID Nos. 9 to 12.

[0014] In a third aspect, the present invention provides an expression vector comprising the nucleic acid.

[0015] In a fourth aspect, the present invention provides a host cell comprising the expression vector.

[0016] In a fifth aspect, the present invention provides a host cell that expresses the adeno-associated virus capsid protein mutant.

[0017] In a sixth aspect, the present invention provides a recombinant adeno-associated virus, comprising the adeno-associated virus capsid protein mutant.

[0018] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it also includes a heterologous target gene.

[0019] As a further preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any one of the gene products of interfering RNA, aptamer, endonuclease, and guide RNA.

[0020] In a seventh aspect, the present invention provides a method for preparing a recombinant adeno-associated virus, comprising introducing at least the following components into a host cell: 1) the nucleic acid or the expression vector, 2) an adenovirus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.

[0021] In an eighth aspect, the present invention provides rAAV prepared by the method described above.

[0022] In a ninth aspect, the present invention provides a pharmaceutical composition comprising the recombinant adeno-associated virus or the rAAV, and a pharmaceutically acceptable carrier.

[0023] In the tenth aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug or preparation for delivering gene products to cells or tissues of a subject.

[0024] As a preferred embodiment of the application of the present invention, the cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.

[0025] In the eleventh aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases.

[0026] As a preferred embodiment of the application described in the present invention, the muscle diseases include but are not limited to any one of Duchenne muscular dystrophy, Becker muscular dystrophy, X-linked myotubular myopathy, limb-girdle muscular dystrophy, myotonic dystrophy, and facioscapulohumeral muscular dystrophy; the heart diseases include but are not limited to any one of arrhythmogenic cardiomyopathy, ischemic cardiomyopathy, hypertrophic cardiomyopathy, dilated cardiomyopathy, angina pectoris, coronary heart disease, myocardial infarction, and heart failure.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention incorporates an RGD peptide segment into a low-hepatotropism backbone, resulting in an adeno-associated virus capsid protein mutant with muscle or heart targeting, particularly good targeting of different muscle tissues (quadriceps, biceps, and abdominal muscles, among others). Compared to the control AAV9, muscle targeting was increased by up to approximately 258 times, and liver tropism was nearly 100 times lower than the control group, demonstrating good specificity, safety, and a wide range of applications. The present invention develops a novel AAV gene therapy product with lower dosage requirements and costs to meet the needs of a wider range of patients and promote the large-scale, socialized application of AAV-based gene therapy methods. This will be of great significance in the future for improving the effectiveness of gene therapy and serving a wide range of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The results of in vivo imaging of Balb / c mice infected with different serotypes are shown; Figure 1 In the figure, A shows mice infected for 14 days, and B shows mice infected for 21 days.

[0030] Figure 2 Analysis of the targeting of different serotypes to the muscle (biceps brachii) of Balb / c mice (21 days); Figure 2In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0031] Figure 3 Analysis of the targeting of different serotypes to the muscle (triceps brachii) of Balb / c mice (21 days); Figure 3 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0032] Figure 4 Analysis of the targeting of different serotypes to the muscle (quadriceps femoris) of Balb / c mice (21 days); Figure 4 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0033] Figure 5 Analysis of the targeting of different serotypes to the muscle (abdominal muscle) of Balb / c mice (21 days); Figure 5 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0034] Figure 6 Analysis of the targeting of different serotypes to the muscle (gastrocnemius) of Balb / c mice (21 days); Figure 6 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0035] Figure 7 Analysis of cardiac targeting of different serotypes in Balb / c mice (21 days); Figure 7 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0036] Figure 8 Analysis of liver targeting of Balb / c mice by different serotypes (21 days); Figure 8 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0037] Figure 9 This is the targeting analysis of different serotypes on other organs of Balb / c mice (21 days, relative mRNA expression levels); Figure 9 In the diagram, A represents the lungs, B represents the kidneys, and C represents the brain.

[0038] Figure 10 To analyze the muscle targeting and liver tropism of different serotypes in cynomolgus monkeys for NGS testing; Figure 10 In Figure 1, A is the puncture at 14 days, and B is the puncture at 28 days. DETAILED DESCRIPTION

[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0040] Unless the context clearly indicates otherwise, the term "or" refers to a single element of the listed alternative elements and the term "and / or" refers to any one, any two, any three, any more or all of the listed alternative elements.

[0041] The term "comprising" or "including" means including the recited elements, integers, or steps, but does not exclude any other elements, integers, or steps. As used herein, when the term "comprising" or "including" is used, unless otherwise indicated, it also encompasses consisting of the recited elements, integers, or steps. For example, when reference is made to a polypeptide "comprising" a particular sequence, it is intended to encompass a polypeptide consisting of that particular sequence.

[0042] "Adeno-associated virus (AAV)" is a non-enveloped icosahedral capsid virus of the Parvoviridae family that includes a single-stranded DNA viral genome. The Parvoviridae family includes the genus Dependovirus, which includes AAV, which relies on the presence of a helper virus such as adenovirus for its replication. Due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integrating into the host genome, and its relatively mild immunogenicity, AAV has been shown to be useful as a biological tool for expressing a gene of interest in vitro or in vivo. Also contemplated herein are AAV-based expression vectors, including recombinant AAV (rAAV) carrying a gene of interest for therapeutic purposes.

[0043] The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule of approximately 5,000 nucleotides (nt) in length. The AAV viral genome typically includes two inverted terminal repeats (ITRs), which cap the viral genome at the 5' and 3' ends, respectively, and provide an origin of replication for the viral genome. These ITRs have a characteristic T-shaped hairpin structure and have multiple functions, including but not limited to serving as an origin of DNA replication by acting as a primer for the endogenous DNA polymerase complex of the host viral replicating cell.

[0044] The wild-type AAV viral genome also includes the Rep gene and the Cap gene, which encode four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40) and three capsid proteins or structural proteins (VP1, VP2, VP3), respectively. Rep proteins are associated with viral replication and packaging, while capsid proteins assemble to form the protein shell of AAV or AAV capsid. Alternative splicing and alternate start codons and promoters result in the production of four different Rep proteins from a single open reading frame in the Rep gene and the production of three capsid proteins from a single open reading frame in the Cap gene.

[0045] When referring to AAV, the term "viral capsid protein" or "capsid protein" refers to the protein of AAV that is capable of self-assembly to produce AAV particles, also known as coat protein or VP protein. The VP protein includes three subunits VP1, VP2 and VP3, so the changes in the VP protein mutant relative to the wild-type VP protein can be reflected in the changes in the amino acid sequences of the VP1, VP2 and VP3 subunits. Accordingly, in this article, "capsid protein mutants" include VP protein mutants, and also include VP1 VP2 and / or VP3 subunit mutants. Due to the consistency of the amino acid sequences between the VP1, VP2 and VP3 subunits expressed from the same Cap gene, when the coding sequence in the Cap gene is changed, for example, when the coding sequence of the VP1 subunit is changed, the amino acid sequences of the expressed VP2 and VP3 subunits are also changed.

[0046] The term "serotype" as used in reference to AAV refers to the distinction of the capsid protein of AAV from other AAV serotypes in serology. Serological uniqueness is determined based on the reactivity of an antibody to one AAV and the lack of cross-reactivity with other or another AAV. This difference in cross-reactivity is usually due to differences in the capsid protein sequence (or its subunit sequence) / antigenic determinants (e.g., due to differences in the VP1, VP2 and / or VP3 sequences of serotype AAV9). A variety of AAV serotypes have been discovered, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12, as well as their mutants.

[0047] When referring to the AAV capsid protein or its subunits, the term "variable region" refers to the region whose amino acid sequence varies significantly between different serotypes. This is typically achieved by comparing the amino acid sequences of AAV capsid proteins from numerous serotypes to identify relatively conserved regions. The sequences between these regions are then designated as the variable region. The variable region is likely involved in AAV binding to cell surface receptors.

[0048] "Recombinant AAV vector" refers to an AAV genome derived by removing some wild-type genes (such as Rep genes and Cap genes) from the AAV genome using molecular biological methods and replacing them with heterologous nucleic acid sequences (such as coding sequences of proteins or RNAs for therapeutic purposes). Typically, for recombinant AAV vectors, one or two inverted terminal repeat (ITR) sequences of the AAV genome are retained therein. In most cases, recombinant AAV vectors are replication-defective and lack sequences encoding functional Rep and Cap proteins in their viral genomes. These replication-defective AAV particles may lack most of the parental coding sequences and essentially carry only one or two AAV ITR sequences and target nucleic acids for delivery to cells, tissues, organs or organisms. AAV comprising recombinant AAV vectors is referred to herein as recombinant AAV (rAAV).

[0049] "Amino acid changes" herein include amino acid substitutions, deletions or insertions. The number of amino acid changes in the mutant sequence relative to the parent sequence can be calculated as the sum of the number of amino acid substitutions, the number of deleted amino acids and the number of inserted amino acids.

[0050] As used herein, the terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides. Such nucleotide polymers may contain natural and / or non-natural nucleotides and include, but are not limited to, DNA, RNA, and PNA. A "nucleic acid sequence" refers to a linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. An "isolated nucleic acid molecule" refers to a nucleic acid molecule that has been removed from its natural environment (e.g., the intracellular environment) and is substantially free of one or more substances normally associated with it in nature, such as proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or is an artificially prepared (e.g., synthetic) nucleic acid molecule.

[0051] The term "expression vector" refers to a nucleic acid molecule comprising various expression elements for expressing a target protein or target RNA in a host cell. For expression vectors for expressing a target protein in eukaryotic cells, these expression elements typically include a promoter, an enhancer, a polyadenylation signal sequence, etc. For ease of amplification in Escherichia coli, the expression vector typically also includes an Escherichia coli replicon sequence. In addition, the expression vector may also include an antibiotic resistance gene or a selective marker gene (e.g., ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR) etc.) for screening and a multiple cloning site (MCS) for insertion of the target gene.

[0052] The term "host cell" refers to cells in which an expression vector can be maintained and / or replicated, including prokaryotic and eukaryotic cells, such as bacteria (such as E. coli), fungi (yeast), insect cells (such as SF9), and mammalian cells (such as HEK-293T).

[0053] When referring to a pharmaceutical composition, the term "pharmaceutically acceptable carrier" refers to a solid or liquid diluent, filler, antioxidant, stabilizer, or other substance that can be safely administered to humans and / or animals without excessive adverse side effects and is suitable for maintaining the activity of the drug or active agent contained therein. Depending on the route of administration, a variety of carriers well known in the art may be used, including, but not limited to, sugars, starches, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer, emulsifiers, isotonic saline, and / or pyrogen-free water.

[0054] The "targeting" of AAV or rAAV refers to its relative accumulation in specific tissues or organs upon introduction into the body. For example, targeting can be manifested as a higher concentration in tissue A than in tissue B. This targeting can be assessed by measuring the amount or concentration of the genome in different tissues or organs.

[0055] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0056] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0057] Example 1: Construction of AAV capsid protein mutants and virus production

[0058] (1) Discovery and determination of targeting peptide sequences

[0059] This study explores the structural and functional analysis of naturally occurring viruses or ligand peptides, applying different strategies to construct candidate serotype mutants in a more direct and cost-effective manner. The RGD motif can bind to the motif of integrin receptors, and some integrin receptors are relatively specifically expressed in muscle cells. By screening for integrin receptor-related ligands and muscle-infecting viruses, potential muscle-targeting peptides were identified, particularly those containing the RGD motif, and then subjected to relevant experimental verification and analysis.

[0060] RGD peptides of different sequences, peptides of different lengths, and different insertion or replacement methods may have a significant impact on the final targeting effect. The peptide sequences selected in the present invention are shown in Table 1:

[0061] Table 1 Selected peptide sequences

[0062] type Sequence source Peptide sequence Remark viral peptides FMDV O VP1 SPNLRGDLQVLAA Mutant 1 targeting peptide viral peptides FMDV O VP1 SNLRGDLQVLA Mutant 5 targeting peptide viral peptides FMDV C VP1 SASARGDLAHLTA Mutant 2 targeting peptide viral peptides FMDV C VP1 SSARGDLAHLA Mutant 6 targeting peptide Ligand peptide TGFβ STGRRGDLATIHA Mutant 3 targeting peptide Ligand peptide TGFβ SGRRGDLATIA Mutant 7 targeting peptide Ligand peptide Tenascin(TNC) SISRRGDMSSNPA Mutant 4 targeting peptide Ligand peptide Tenascin(TNC) SSRRGDMSSNA Mutant 8 targeting peptide

[0063] The "S" and "A" at both ends of the amino acid sequence in Table 1 are used as the connecting sequence between the serotype VP1 backbone and the targeting peptide. For example, the above-mentioned targeting peptide amino acid sequence is replaced with R584 to R587 of the low hepatotropic serotype (SEQ ID NO.13) VP1, or S584 to R594 of the serotype 109 (SEQ ID NO.14) VP1 to form a new serotype VP1 sequence.

[0064] (2) Construction of mutant serotype vector and plasmid extraction

[0065] The AAV9 Rep-CAP plasmid (purchased from Guangzhou Paizhen Biotechnology Co., Ltd.) was double-digested with Smi I and BshT I, and a fragment band of about 5000 bp was cut out for gel electrophoresis and gel recovery to obtain the enzyme-digested backbone fragment.

[0066] Based on the Cap sequence of mutant 1, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ561-R primers for amplification and gel recovery to obtain the target product YJ561-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ561-F+cap-r primers for amplification and gel recovery to obtain the target product YJ561-2; and by mixing the backbone fragment, YJ561-1, and YJ561-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 1 was recombinantly constructed;

[0067] Based on the Cap sequence of mutant 2, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ563-R primers for amplification and gel recovery to obtain the target product YJ563-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ563-F+cap-r primers for amplification and gel recovery to obtain the target product YJ563-2; and by mixing the backbone fragment, YJ563-1, and YJ563-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 2 was recombinantly constructed;

[0068] Based on the Cap sequence of mutant 3, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ565-R primers for amplification and gel recovery to obtain the target product YJ565-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ565-F+cap-r primers for amplification and gel recovery to obtain the target product YJ565-2; and by mixing the backbone fragment, YJ565-1, and YJ565-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 3 was recombinantly constructed;

[0069] Based on the Cap sequence of mutant 4, the following primers were designed. Specifically, the following steps were performed: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ567-R primers for amplification and gel recovery to obtain the target product YJ567-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ567-F+cap-r primers for amplification and gel recovery to obtain the target product YJ567-2; and by mixing the backbone fragment, YJ567-1, and YJ567-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 4 was recombinantly constructed;

[0070] Based on the Cap sequence of mutant 5, the following primers were designed. The specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ562-R primers for amplification and gel recovery to obtain the target product YJ562-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ562-F+cap-r primers for amplification and gel recovery to obtain the target product YJ562-2; by mixing the backbone fragment, YJ562-1, and YJ562-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 5 can be recombined and constructed;

[0071] Based on the Cap sequence of mutant 6, the following primers were designed. The specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ564-R primers for amplification and gel recovery to obtain the target product YJ564-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ564-F+cap-r primers for amplification and gel recovery to obtain the target product YJ564-2; by mixing the backbone fragment, YJ564-1, and YJ564-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 6 can be recombined and constructed;

[0072] Based on the Cap sequence of mutant 7, the following primers were designed. The specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ566-R primers for amplification and gel recovery to obtain the target product YJ566-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ566-F+cap-r primers for amplification and gel recovery to obtain the target product YJ566-2; by mixing the backbone fragment, YJ566-1, and YJ566-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 7 can be recombined and constructed;

[0073] Based on the Cap sequence of mutant 8, the following primers were designed. The specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ568-R primers for amplification and gel recovery to obtain the target product YJ568-1; using the Rep-CAP plasmid of serotype 109 as a template, using the YJ568-F+cap-r primers for amplification and gel recovery to obtain the target product YJ568-2; by mixing the backbone fragment, YJ568-1, and YJ568-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 8 can be recombined and constructed;

[0074] The primers involved in the construction of the Rep-CAP vector of the above-mentioned AAV capsid protein mutant are shown in Table 2:

[0075] Table 2 Primer sequences

[0076] Primer name Primer sequence (5'->3') Cap-f CATCTTTGAACAATAAATGATTTAAATCAGGTATG cap-r TCAACTGAAACGAATCAACCGGTTT YJ561-R GACCTGGAGGTCTCCTTCCAGGTTAGGGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ561-F GAGAGGAGACCTCCAGGTCCTGGCTGCTCAAGCAGCTACCGCAGAT YJ563-R ATGAGCGAGGTCTCCTCTTGCAGAAGCGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ563-F AGAGGAGACCTCGCTCATCTGACAGCTCAAGCAGCTACCGCAGAT YJ565-R ATAGTAGCGAGGTCTCCTCTTCGACCAGTGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ565-F AGAGGAGACCTCGCTACTATCCATGCTCAAGCAGCTACCGCAGAT YJ567-R TTGGAAGACATGTCTCCTCTTCGAGAGATGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ567-F AGAGGAGACATGTCTTCCAATCCTGCTCAAGCAGCTACCGCAGAT YJ562-R GACCTGGAGGTCTCCTCTCAGGTTGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ562-F GAGAGGAGACCTCCAGGTCCTGGCTCAAGCAGCTACCGCAGAT YJ564-R ATGAGCGAGGTCTCCTCTTGCAGAGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ564-F AGAGGAGACCTCGCTCATCTGGCTCAAGCAGCTACCGCAGAT YJ566-R ATAGTAGCGAGGTCTCCTCTTCGACCGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ566-F AGAGGAGACCTCGCTACTATCGCTCAAGCAGCTACCGCAGAT YJ568-R TTGGAAGACATGTCTCCTCTTCGAGAGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ568-F AGAGGAGACATGTCTTCCAATGCTCAAGCAGCTACCGCAGAT

[0077] Label a clean 200µL PCR tube and place it on ice. Combine the digested backbone and each target fragment at a 1:3 molar ratio of backbone to fragment. Incubate in a PCR machine at 50°C for 30 minutes for recombination ligation. Thaw 50µL of competent cells on ice, mix 10µL of the ligation product with DH5α competent cells, and incubate on ice for 20-30 minutes. Heat shock at 42°C for 45 seconds. Quickly place on ice for 2 minutes, add 400µL of recovery SOC medium (without antibiotics), and incubate at 37°C, 200 rpm, for 1 hour. Spread evenly on an Amp-resistant plate (50µg / mL) and incubate at 37°C for 14 hours. Select a single colony and expand it in 4ml of liquid LB medium (Amp+ resistant) and incubate at 37°C for 14 hours.

[0078] The bacterial solution was centrifuged at 12000rpm for 1 minute, and the supernatant culture medium was discarded; 250μL of buffer P1 / RNaseA mixture was added and the bacteria were resuspended by high-speed vortexing; 250μL of buffer P2 was added and the solution was inverted 8-10 times; 350μL of buffer P3 was added and the solution was immediately inverted and mixed 8-10 times to completely neutralize the solution; centrifuged at 13000rpm for 10 minutes, the supernatant was taken and passed through the column; centrifuged at 12000 for 1 minute, the waste liquid was discarded, 500μL of PW1 was added, and the waste liquid was discarded; 600μL of PW2 was added, and the supernatant was discarded; 600μL of PW2 was added, and the solution was centrifuged at 12000 for 1 minute, and the supernatant was discarded; the solution was idling at 12000rpm for 2 minutes; 30-50μL of 55℃ preheated eluent was added, the solution was allowed to stand for 2 minutes, and the solution was centrifuged at 12000rpm for 1 minute. A micro-volume nucleic acid quantifier was used for concentration detection.

[0079] The obtained plasmids were tested for concentration, and 10 μL of the positive plasmids identified by enzyme digestion were sent for sequencing and stored at -20°C. Sequencing results showed that the obtained plasmids could encode the variant capsid protein VP1. Finally, according to the amount of virus required for subsequent testing, the relevant Helper plasmids, the Rep-Cap plasmids for each group (control serotypes AAV2, AAV9, MyoAAV 4A, 109, and mutants 1-8) plasmids, and the GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) were extracted.

[0080] (3) Packaging and purification of mutant serotype viruses

[0081] The Rep-Cap plasmids of each group (control serotype and AAV mutants 1-8), the GOI plasmid expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts. The AAV virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured and the appropriate titer was 1E+12GC / mL-1E+13GC / mL. The cells were placed at -80°C for use.

[0082] Example 2: Comparative testing of various indicators of mutant serotypes

[0083] (1) Mouse injection and dissection

[0084] The animal experiments used 6-8 week old Balb / c male mice. The relevant viruses were prepared according to the designed experimental and control groups (due to the low virus yield of mutant 5, only one mouse was used). Each mouse in each group was injected with 2E11GC virus. In vivo imaging was performed 14 and 21 days after injection. The animals were dissected and organs were collected 21 days after injection. The samples were immediately snap-frozen in liquid nitrogen and used for subsequent experiments such as RNA extraction and western blotting.

[0085] (2) In vivo imaging

[0086] Live imaging was performed on mice 14 and 21 days after injection. The mice were weighed before imaging, and the animal live imaging system (Guangzhou Bolu Teng Biotechnology Co., Ltd., AniView100) was turned on in advance and the small animal anesthesia system was debugged. Set the image save path, shooting parameters and other information. Each mouse was intraperitoneally injected with luciferin (15 mg / mL, Promega, E1605) at a dose of 150 mg / kg, or 10 uL / g. Imaging began 10 minutes after injection of each group. Each batch of mice was photographed in the order of supine, left lateral, prone, and right lateral. After the shooting was completed, the mice were put back into the cage to wait for anesthesia to wake up, and the mice were observed for any abnormalities.

[0087] (3) Detection of target gene mRNA expression level

[0088] (3.1) Total RNA extraction and reverse transcription:

[0089] Sample Grinding: Pre-cool the grinder 10 minutes in advance and set the grinding parameters. Remove the animal tissue sample from the -80°C freezer and cut approximately 50-100 mg of tissue into pea-sized pieces in a sterile Petri dish. Transfer the sample to a 1.5 ml RNase-free EP tube. Add an appropriate amount of TransZol Up at a ratio of 1 ml TransZol Up per 50-100 mg of tissue. Add two clean, sterile 3 mm grinding steel beads and wrap with Parafilm. Place the sample in a 24-well grinding adapter, level it, tighten the screws, and press the lid button to close. Start the grinding program. After the instrument finishes, remove the sample and inspect the grind size. If no large pieces of tissue remain, proceed to extraction. Centrifuge the ground sample at 12,000 × g for 2 minutes at 4°C. Aspirate the supernatant and transfer it to a new, labeled 1.5 ml RNase-free EP tube.

[0090] Extract total RNA from samples: Refer to the TransZol Up Plus RNA Kit (Beijing Quanshijin, Cat. No. ER501) for details. For every 1 ml of TranZol Up, add 0.2 ml of RNA Extraction Agent, shake vigorously for 5 minutes, and centrifuge at 12,000 × g at 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5 ml RNase-free EP tube, add an equal volume of anhydrous ethanol (precipitate may appear at this time), and gently invert to mix; add the resulting solution and precipitate to the centrifuge column, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; add 500 μL CB9, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; repeat the above steps once; add 500 μL WB9, centrifuge at 12,000 × g at room temperature for 30 seconds, and discard the filtrate; repeat the above steps once; centrifuge at 12,000 × g at room temperature for 2 minutes to completely remove residual ethanol; place the centrifuge column in a 1.5 ml RNase-free EP tube, add 30-50 μL (depending on the size of the tissue) RNase-free water in the center of the centrifuge column, and let it stand at room temperature for 1 minute; centrifuge at 12,000 × g at room temperature for 1 minute to elute RNA;

[0091] Determination of sample nucleic acid concentration: Use a micro-nucleic acid quantification instrument detector to detect RNA concentration, record the concentration, OD260 / 280, and OD260 / 230, and store the RNA at -80°C.

[0092] Reverse transcription: Each RNA sample was used All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (Beijing Quanshijin, Cat. No. AE341-03). For specific steps, refer to the instruction manual.

[0093] (3.2) Quantitative PCR (qPCR) experiments:

[0094] Each cDNA group was used as a template and the qPCR system was configured according to the instructions of 2x SYBR Green qPCR Master Mix (Bimake, Cat. No.: B21203):

[0095] Table 3 qPCR system

[0096] Reagents Usage 2x SYBR Green qPCR Master Mix 10ul cDNA template 2ul Upstream primer (10 μM) 1ul Downstream primer (10 μM) 1ul ROX Reference Dye 0.4ul Deionized water Up to 20ul

[0097] Table 4 qPCR program settings

[0098]

[0099] Table 5 qPCR primer sequences

[0100] Primer name Primer sequence (5'->3') Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC

[0101] (3.3) Data analysis

[0102] According to the Ct value of each group, according to formula 2 -ΔΔct Calculate the relative expression level.

[0103] (4) Western blotting to detect the expression level of the target protein

[0104] Sample pretreatment: Cut the tissue into small pieces, weigh and record the weight, place in a 1.5 mL or 2 mL centrifuge tube, label the tube, and freeze at -80°C until use. Pre-cool the cryo-grinder; dissolve in RIPA (Biyuntian, P0013B) lysis buffer (add PMSF within a few minutes before use to a final PMSF concentration of 1 mM);

[0105] Add 150-250 μL of the complete lysis buffer to every 20 mg of tissue. Then, add two sterilized zirconium oxide grinding beads and grind the sample directly in the lysis buffer (for brain and spinal cord tissue samples: temperature -20°C, frequency 70 Hz, oscillation time 50 seconds, pause 10 seconds, 3-4 cycles; for muscle and liver samples: temperature -20°C, frequency 70 Hz, oscillation time 50 seconds, pause 10 seconds, 5-7 cycles). After grinding, centrifuge the sample at 12,000 × g in a refrigerated centrifuge at 4°C for 5-10 minutes. Transfer the supernatant to a new sterilized EP tube and store at -20°C or -80°C.

[0106] Protein concentration determination: After determining the protein concentration according to the modified BCA protein concentration determination kit (Sanggong, Cat. No. C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix with the corresponding amount of 5X SDS-PAGE protein loading buffer, boil in water bath for 10 minutes, cool, centrifuge at low speed for a while, and wait for sample loading.

[0107] WB (Western Blot) detection:

[0108] A.SDS-PAGE electrophoresis: Determine the appropriate loading volume based on protein concentration and expression level, which should be less than 20μL / well. The loading volume of tissue homogenate protein is about 20-50μg. The specific operation process of electrophoresis is as follows: Pull out the comb on the precast gel, install the gel into the electrophoresis tank, add electrophoresis buffer to both the inner and outer tanks, add freshly prepared buffer to the inner tank, and check for leaks. If there are no leaks, add electrophoresis buffer to the outer tank; Load an appropriate amount of treated protein sample, use pre-stained standard protein as a reference, and perform 100V constant voltage electrophoresis on the Tianneng electrophoresis device for 100 minutes, until bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, remove the gel, and place it in transfer buffer and wait for subsequent operations;

[0109] B. Transfer: Cut 6 pieces of filter paper and 1 piece of PVDF membrane according to the gel area. Soak the PVDF membrane in methanol for 5-10 seconds, then transfer it to transfer buffer and soak for 5 minutes. The filter paper should also be pre-wetted in transfer buffer. Install the transfer device: negative electrode (blackboard) - sponge - 3 layers of wet filter paper - gel - PVDF membrane - 3 layers of wet filter paper - sponge - positive electrode (transparent plate). Expel bubbles from each layer to avoid affecting the transfer effect, clamp the bracket, and place it in the electroporation tank; use a 100V constant voltage ice bath to transfer the membrane for 100 minutes; determine whether the transfer is successful based on whether the pre-stained protein molecular weight standard bands are completely transferred to the PVDF membrane; soak the transferred PVDF membrane in PBST solution and wash it at room temperature for 5 minutes. Cut the PVDF membrane as needed. Be careful not to let the PVDF membrane dry during the cutting process.

[0110] C. Blocking and Antibody Incubation: Incubate the PVDF membrane with blocking solution (5% skim milk powder) at room temperature for 2 hours or at 4°C overnight. Transfer the blocked PVDF membrane to the primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000) and add each to 4 ml of QuickBlock ELISA. TMThe washed PVDF membrane was transferred to the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, SA00001-2) at a ratio of 1:5000 and added to 4 ml of QuickBlock TM Western secondary antibody diluent (Biyuntian, P0258), i.e., secondary antibody hybridization solution), incubated at room temperature for 1 h, and washed with PBST for 3 × 5 min;

[0111] D. Color development: Mix equal volumes of Solution A and Solution B of the ECL chemiluminescence kit. Vortex to mix thoroughly. Drop the luminescent solution onto the PVDF membrane so that the membrane is completely covered with the solution. Adjust the exposure time to make the protein bands clear. Take photos with the instrument.

[0112] (5) Cynomolgus monkey injection, puncture, and NGS analysis

[0113] Animal experiments were conducted using approximately 4-year-old male cynomolgus macaques, which had passed AAV2 and AAV9 neutralizing antibody testing before use. Different serotype mutants and control serotypes were packaged with different GOIs (ssAAV.CAG.Fluc.WPRE.polyA vectors carrying different barcodes) and injected intravenously with equal viral loads (total mixed viral dose controlled to 3E13 GC / kg). Muscle punctures at different sites and liver punctures were performed at 2 and 4 weeks, respectively. Tissue RNA was extracted, RT-PCR was performed, and next-generation sequencing was performed. NGS data were analyzed to determine the multiple of each serotype mutant relative to the control AAV9.

[0114] The results of the above-mentioned multiple validation experiments show that although the sequences of serotypes with different ligand peptides and different insertion strategies all contain the RGD motif, the effects are very different. For example, serotype mutants 1-4 with longer inserted peptides are significantly better than mutants 5-8 with shorter lengths. In addition, mutant 4 has the best targeting effect on mouse muscle, followed by mutants 2 and 3. In the gastrocnemius, quadriceps, triceps, biceps and abdominal muscles, the infection effect of mutant 4 is 53.84 times, 55.76 times, 257.58 times, 12.63 times and 54.47 times that of AAV9, respectively. Among them, the effect in the biceps and abdominal muscles is better than that of the control MyoAAV 4A, which may be related to the low liver tropism backbone developed in the early stage (109 using the same backbone has a similar trend). In cardiac tissue, the effect of mutant 4 was inferior to that of mutant 2 and mutant 3 (10.16 times and 10.36 times that of AAV9, respectively) and the control MyoAAV 4A, indicating that it has stronger muscle specificity. In mouse liver, the characteristics of the low liver tropism backbone are particularly obvious. Different targeting peptides using this backbone are significantly lower than AAV9 and MyoAAV 4A based on the AAV9 backbone. The liver expression of mutants 1-4 is 0.02 times, 0.01 times, 0.01 times, and 0.01 times that of AAV9, respectively. The effects of the above serotype mutants on muscle and liver mRNA are basically consistent with the results of in vivo imaging and WB, supporting each other. In addition, the targeting effect on different tissues such as the brain, lungs, and kidneys is basically lower than that of AAV9, except for some serotypes that are slightly higher than AAV9 (for example, mutant 2 in the brain is 1.85 times higher than AAV9, and mutant 5 in the kidneys is 1.82 times higher than AAV9). Especially in the brain and kidneys, the differences between different serotypes are not obvious.

[0115] To further demonstrate the potential clinical utility of the present serotypes, mutant and control serotype viruses were mixed in equal amounts and injected intravenously into cynomolgus macaques. NGS analysis was then performed to determine the relative expression of the different serotypes in muscle and liver tissue. Significantly different from the mouse results, mutant 4, which performed best in mouse muscle, performed poorly in cynomolgus macaques. Conversely, mutant 3 was the most effective among the mutants, a discrepancy likely due to species differences. Furthermore, consistent with the mouse results, serotypes 1-4, which have longer inserted peptides, were significantly more effective than mutants 5-8, which have shorter inserts, a key innovation of the present invention. Another point consistent with the mouse results was the liver tropism of the different serotypes. 109 and other mutants, using a low-liver-tropism backbone, exhibited low liver tropism compared to AAV9 and MyoAAV 4A, which uses an AAV9 backbone, and the trends observed at 2 and 4 weeks were consistent.

[0116] In summary, by utilizing naturally occurring peptides containing the RGD motif, such as those found in certain viruses or integrin ligands, and employing various construction strategies, we screened for peptides that better match and are compatible with the previously developed low-liver-tropism AAV backbone. This led to the generation of multiple serotype mutants with superior muscle targeting compared to AAV9. mRNA and protein expression levels confirmed their efficacy in muscle tissues, including the gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, and abdominal muscles, with reduced liver tropism and excellent specificity. These mutants can be further evaluated for their clinical application and safety, providing more useful and alternative vector tools for gene therapy of muscle diseases, benefiting a wide range of patients.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An adeno-associated virus capsid protein mutant, characterized in that: Its amino acid sequence is shown in SEQ ID No.

4.

2. A nucleic acid encoding the adeno-associated virus capsid protein mutant according to claim 1.

3. The nucleic acid according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID No.

12.

4. An expression vector, characterized in that It comprises the nucleic acid according to claim 2 or 3.

5. A host cell, characterized in that It comprises the expression vector according to claim 4.

6. A host cell, characterized in that It expresses the adeno-associated virus capsid protein mutant according to claim 1.

7. A recombinant adeno-associated virus, characterized in that The invention comprises the adeno-associated virus capsid protein mutant according to claim 1.

8. The recombinant adeno-associated virus according to claim 7, characterized in that Heterologous genes of interest are also included.

9. The recombinant adeno-associated virus according to claim 8, characterized in that The heterologous target gene encodes any one of the gene products of interfering RNA, aptamer, endonuclease, and guide RNA.

10. A method for preparing a recombinant adeno-associated virus, characterized in that: The method comprises introducing at least the following components into a host cell: 1) the nucleic acid according to claim 2 or 3 or the expression vector according to claim 4, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.

11. rAAV prepared by the method according to claim 10.

12. A pharmaceutical composition comprising the recombinant adeno-associated virus according to any one of claims 7 to 9 or the rAAV according to claim 11, and a pharmaceutically acceptable carrier.

13. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 4, the host cell according to claim 5 or 6, the recombinant adeno-associated virus according to any one of claims 7 to 9, or the rAAV according to claim 11 in preparing a preparation for delivering a gene product to cells or tissues of a subject, characterized in that: The cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.

Images