Specific binding proteins targeting CD40

Abstract

The present invention relates to antibodies or antigen binding fragments thereof targeting CD40. The present invention also relates to bispecific binding proteins targeting CD40 and PD1, said specific binding proteins being capable of specifically binding to CD40 and PD1 or fragments thereof. The invention also relates to the use of the specific binding protein in the treatment, prevention and / or diagnosis of diseases such as immune diseases, acute and chronic inflammatory diseases and tumor diseases.

Description

Technical Field

[0001] The present disclosure belongs to the field of biotechnology, specifically to the field of antibody therapy, and more specifically to a specific binding protein targeting CD40. Background Technology

[0002] Cancer is the leading cause of death worldwide. Tumor immunity in the third-generation cancer treatment has become a hot topic in tumor treatment research due to its excellent clinical treatment effect. Tumor immunity targets immune checkpoint inhibitors (ICI), mainly by using monoclonal antibodies (mAb) or small molecule inhibitors to inhibit the inhibitory effect of tumor cells in the tumor microenvironment (TME) on the body's immune system, thereby activating immune cells in the body and enhancing the body's anti-tumor immune response, specifically removing tiny residual tumor lesions, inhibiting tumor growth, and breaking immune tolerance.

[0003] The main mechanism of immune checkpoint inhibitor therapy in tumor immunity is to establish anti-tumor activity by removing the body's negative immune regulation of the tumor site through inhibitors. In contrast, stimulatory immunotherapy targets, such as CD40, ICOS, CD27, GITR, OX40 and 4-1BB, act as agonists to activate the body's immune response and kill tumors in the early stages of the immune response. The first of these molecules to act is likely to be CD40, because it plays a key role in antigen presentation and T cell activation.

[0004] Early CD40 agonist antibodies were mainly monoclonal antibodies, relying on the ADCC effect of the antibody Fc region to activate CD40 signaling and enhance the killing effect on cancer cells. Although the clinical data of such monoclonal antibodies showed good therapeutic effects, related adverse events including cytokine release syndrome and elevated liver enzymes were also observed. These results indicated that due to the widespread expression of CD40 in lymphocytes, the safety of its agonist antibodies needed to be improved. For this, the second-generation CD40 agonist represented by APX005M optimized its antibody Fc region, specifically targeted the CD40 and its ligand binding region, thereby selectively increasing the FcγRIIB affinity and reducing the ADCC activity. This enhanced the cross-linking reaction to improve the agonist activity and reduce the toxicity caused by ADCC. Although APX005M showed good safety, its therapeutic effect was not ideal. In the phase II clinical trial of APX005M combined with drug O and chemotherapy for first-line metastatic pancreatic cancer, the effect of APX005M combined with PD-1 and chemotherapy was not as good as that of PD-1 and chemotherapy. Therefore, the current monoclonal antibody agonists targeting CD40 do not achieve good levels in both safety and effectiveness. Summary of the Invention

[0005] Aiming at the deficiencies in safety and effectiveness of the current CD40 agonist antibodies, the present invention provides a new specific binding protein targeting CD40, aiming to improve the safety of CD40 agonist antibodies while enhancing their effectiveness. By safely activating the signal transduction pathway of CD40 on antigen-presenting cells (APCs), the killing effect of the body's immune system on cancer cells is strengthened, so as to achieve the therapeutic effect on cancer.

[0006] One aspect of the present invention provides an antibody or its antigen-binding fragment that specifically binds to CD40 and / or its fragment, and the antibody or its antigen-binding fragment comprises at least one heavy-chain variable region and at least one light-chain variable region.

[0007] In some embodiments, the heavy-chain variable region comprises: HCDR1 as shown in any one of SEQ ID NO: 32-62; and / or HCDR2 as shown in any one of SEQ ID NO: 63-93; and / or HCDR3 as shown in any one of SEQ ID NO: 94-124.

[0008] In some embodiments, the light-chain variable region comprises LCDR1 as shown in any one of SEQ ID NO: 156-186; and / or LCDR2 as shown in any one of SEQ ID NO: 187-217; and / or LCDR3 as shown in any one of SEQ ID NO: 218-248.

[0009] In some embodiments, the heavy chain variable region comprises: HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 32, SEQ ID NO: 63, and SEQ ID NO: 94, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 33, SEQ ID NO: 64, and SEQ ID NO: 95, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 34, SEQ ID NO: 65, and SEQ ID NO: 96, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 35, SEQ ID NO: 66, and SEQ ID NO: 97, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 36, SEQ ID NO: 67, and SEQ ID NO: 98, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 37, SEQ ID NO: 68, and SEQ ID NO: 99, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 38, SEQ ID NO: 69, and SEQ ID NO: 100, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 39, SEQ ID NO: 70, and SEQ ID NO: 101, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 40, SEQ ID NO: 71, and SEQ ID NO: 102, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 41, SEQ ID NO: 72, and SEQ ID NO: 103, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 42, SEQ ID NO: 73, and SEQ ID NO: 104, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 43, SEQ ID NO: 74, and SEQ ID NO: 105, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 44, SEQ ID NO: 75, and SEQ ID NO: 106, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 45, SEQ ID NO: 76, and SEQ ID NO: 107, respectively; or HCDR1, HCDR2, and HCDR3 as set forth in SEQ ID NO: 46, SEQ ID NO: 77, and SEQ ID NO: 108, respectively;HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:47, SEQ ID NO:78, and SEQ ID NO:109, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:48, SEQ ID NO:79, and SEQ ID NO:110, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:49, SEQ ID NO:80, and SEQ ID NO:111, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:50, SEQ ID NO:81, and SEQ ID NO:112, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:51, SEQ ID NO:82, and SEQ ID NO:113, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:52, SEQ ID NO:83, and SEQ ID NO:114, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:53, SEQ ID NO:84, and SEQ ID NO:115, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:54, SEQ ID NO:85, and SEQ ID NO:116, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:55, SEQ ID NO:86, and SEQ ID NO:117, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:56, SEQ ID NO:87, and SEQ ID NO:118, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:57, SEQ ID NO:88, and SEQ ID NO:119, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:58, SEQ ID NO:89, and SEQ ID NO:120, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:59, SEQ ID NO:90, and SEQ ID NO:121, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:60, SEQ ID NO:91, and SEQ ID NO:122, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:61, SEQ ID NO:92, and SEQ ID NO:123, respectively;or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:62, SEQ ID NO:93, and SEQ ID NO:124, respectively;

[0010] In some embodiments, the light chain variable region comprises: LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 156, SEQ ID NO: 187, and SEQ ID NO: 218, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 157, SEQ ID NO: 188, and SEQ ID NO: 219, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 158, SEQ ID NO: 189, and SEQ ID NO: 220, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 159, SEQ ID NO: 190, and SEQ ID NO: 221, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 160, SEQ ID NO: 191, and SEQ ID NO: 222, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 161, SEQ ID NO: 192, and SEQ ID NO: 223, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 162, SEQ ID NO: 193, and SEQ ID NO: 224, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 163, SEQ ID NO: 194, and SEQ ID NO: 225, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 164, SEQ ID NO: 195, and SEQ ID NO: 226, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 165, SEQ ID NO: 196, and SEQ ID NO: 227, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 166, SEQ ID NO: 197, and SEQ ID NO: 228, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 167, SEQ ID NO: 198, and SEQ ID NO: 229, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 168, SEQ ID NO: 199, and SEQ ID NO: 230, respectively; or LCDR1, LCDR2, and LCDR3 as set forth in SEQ ID NO: 169, SEQ ID NO: 200, and SEQ ID NO: 231, respectively;LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:170, SEQ ID NO:201, and SEQ ID NO:232, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:171, SEQ ID NO:202, and SEQ ID NO:233, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:172, SEQ ID NO:203, and SEQ ID NO:234, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:173, SEQ ID NO:204, and SEQ ID NO:235, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:174, SEQ ID NO:205, and SEQ ID NO:236, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:175, SEQ ID NO:206, and SEQ ID NO:237, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:176, SEQ ID NO:207, and SEQ ID NO:238, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:177, SEQ ID NO:208, and SEQ ID NO:239, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:178, SEQ ID NO:209, and SEQ ID NO:240, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:179, SEQ ID NO:210, and SEQ ID NO:241, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:180, SEQ ID NO:211, and SEQ ID NO:242, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:181, SEQ ID NO:212, and SEQ ID NO:243, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:182, SEQ ID NO:213, and SEQ ID NO:244, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:183, SEQ ID NO:214, and SEQ ID NO:245, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:184, SEQ ID NO:215, and SEQ ID NO:246, respectively;LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:185, SEQ ID NO:216, and SEQ ID NO:247, respectively; or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:186, SEQ ID NO:217, and SEQ ID NO:248, respectively.

[0011] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:32, SEQ ID NO:63, and SEQ ID NO:94, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:156, SEQ ID NO:187, and SEQ ID NO:218, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:33, SEQ ID NO:64, and SEQ ID NO:95, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:157, SEQ ID NO:188, and SEQ ID NO:219, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:34, SEQ ID NO:65, and SEQ ID NO:96, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:158, SEQ ID NO:189, and SEQ ID NO:220, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:35, SEQ ID NO:66, and SEQ ID NO:97, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:159, SEQ ID NO:190, and SEQ ID NO:221, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:36, SEQ ID NO:67, and SEQ ID NO:98, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:160, SEQ ID NO:191, and SEQ ID NO:222, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:37, SEQ ID NO:68, and SEQ ID NO:99, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:161, SEQ ID NO:192, and SEQ ID NO:223, respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:38, SEQ ID NO:69, and SEQ ID NO:100, respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:162, SEQ ID NO:193, and SEQ ID NO:224, respectively;HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:39, SEQ ID NO:70, and SEQ ID NO:101 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:163, SEQ ID NO:194, and SEQ ID NO:225 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:40, SEQ ID NO:71, and SEQ ID NO:102 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:164, SEQ ID NO:195, and SEQ ID NO:226 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:41, SEQ ID NO:72, and SEQ ID NO:103 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:165, SEQ ID NO:196, and SEQ ID NO:227 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:42, SEQ ID NO:73, and SEQ ID NO:104 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:166, SEQ ID NO:197, and SEQ ID NO:228 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:43, SEQ ID NO:74, and SEQ ID NO:105 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:167, SEQ ID NO:198, and SEQ ID NO:229 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:44, SEQ ID NO:75, and SEQ ID NO:106 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:168, SEQ ID NO:199, and SEQ ID NO:230 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:45, SEQ ID NO:76, and SEQ ID NO:107 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:169, SEQ ID NO:200, and SEQ ID NO:231 respectively;HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:46, SEQ ID NO:77, and SEQ ID NO:108 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:170, SEQ ID NO:201, and SEQ ID NO:232 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:47, SEQ ID NO:78, and SEQ ID NO:109 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:171, SEQ ID NO:202, and SEQ ID NO:233 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:48, SEQ ID NO:79, and SEQ ID NO:110 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:172, SEQ ID NO:203, and SEQ ID NO:234 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:49, SEQ ID NO:80, and SEQ ID NO:111 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:173, SEQ ID NO:204, and SEQ ID NO:235 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:50, SEQ ID NO:81, and SEQ ID NO:112 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:174, SEQ ID NO:205, and SEQ ID NO:236 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:51, SEQ ID NO:82, and SEQ ID NO:113 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:175, SEQ ID NO:206, and SEQ ID NO:237 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:52, SEQ ID NO:83, and SEQ ID NO:114 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:176, SEQ ID NO:207, and SEQ ID NO:238 respectively;or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:53, SEQ ID NO:84, and SEQ ID NO:115 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:177, SEQ ID NO:208, and SEQ ID NO:239 respectively; HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:54, SEQ ID NO:85, and SEQ ID NO:116 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:178, SEQ ID NO:209, and SEQ ID NO:240 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:55, SEQ ID NO:86, and SEQ ID NO:117 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:179, SEQ ID NO:210, and SEQ ID NO:241 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:56, SEQ ID NO:87, and SEQ ID NO:118 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:180, SEQ ID NO:211, and SEQ ID NO:242 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:57, SEQ ID NO:88, and SEQ ID NO:119 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:181, SEQ ID NO:212, and SEQ ID NO:243 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:58, SEQ ID NO:89, and SEQ ID NO:120 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:182, SEQ ID NO:213, and SEQ ID NO:244 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:59, SEQ ID NO:90, and SEQ ID NO:121 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:183, SEQ ID NO:214, and SEQ ID NO:245 respectively;HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:60, SEQ ID NO:91, and SEQ ID NO:122 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:184, SEQ ID NO:215, and SEQ ID NO:246 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:61, SEQ ID NO:92, and SEQ ID NO:123 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:185, SEQ ID NO:216, and SEQ ID NO:247 respectively; or HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:62, SEQ ID NO:93, and SEQ ID NO:124 respectively, and LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:186, SEQ ID NO:217, and SEQ ID NO:248 respectively.

[0012] In some embodiments, these CDRs may contain amino acid mutations and can maintain the function of the antibody specifically binding to CD40. Preferably, the amino acid mutations are amino acid substitutions, and the number of the amino acid substitutions may be 1-3.

[0013] In some embodiments, the heavy chain variable region comprises the amino acid sequence shown in any one of SEQ ID NO:1-31 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0014] In some embodiments, the light chain variable region comprises the amino acid sequence shown in any one of SEQ ID NO:125-155 or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0015] In some embodiments, the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 1 and a light chain variable region as shown in SEQ ID NO: 125; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 2 and a light chain variable region as shown in SEQ ID NO: 126; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 3 and a light chain variable region as shown in SEQ ID NO: 127; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 4 and a light chain variable region as shown in SEQ ID NO: 128; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 5 and a light chain variable region as shown in SEQ ID NO: 129; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 6 and a light chain variable region as shown in SEQ ID NO: 130; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 7 and a light chain variable region as shown in SEQ ID NO: 131; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 8 and a light chain variable region as shown in SEQ ID NO: 132; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 9 and a light chain variable region as shown in SEQ ID NO: 133; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 10 and a light chain variable region as shown in SEQ ID NO: 134; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 11 and a light chain variable region as shown in SEQ ID NO: 135; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 12 and a light chain variable region as shown in SEQ ID NO: 136; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 13 and a light chain variable region as shown in SEQ ID NO: 137; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 14 and a light chain variable region as shown in SEQ ID NO: 138; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 15 and a light chain variable region as shown in SEQ ID NO: 139; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 16 and a light chain variable region as shown in SEQ ID NO: 140;or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 17 and a light chain variable region as shown in SEQ ID NO: 141; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 18 and a light chain variable region as shown in SEQ ID NO: 142; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 19 and a light chain variable region as shown in SEQ ID NO: 143; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 20 and a light chain variable region as shown in SEQ ID NO: 144; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 21 and a light chain variable region as shown in SEQ ID NO: 145; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 22 and a light chain variable region as shown in SEQ ID NO: 146; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 23 and a light chain variable region as shown in SEQ ID NO: 147; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 24 and a light chain variable region as shown in SEQ ID NO: 148; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 25 and a light chain variable region as shown in SEQ ID NO: 149; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 26 and a light chain variable region as shown in SEQ ID NO: 150; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 27 and a light chain variable region as shown in SEQ ID NO: 151; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 28 and a light chain variable region as shown in SEQ ID NO: 152; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 29 and a light chain variable region as shown in SEQ ID NO: 153; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 30 and a light chain variable region as shown in SEQ ID NO: 154; or the antibody or its antigen-binding fragment comprises a heavy chain variable region as shown in SEQ ID NO: 31 and a light chain variable region as shown in SEQ ID NO: 155.;

[0016] In some embodiments, the antibody or its antigen-binding fragment is a humanized antibody.

[0017] In some embodiments, the antibody or its antigen-binding fragment further comprises a heavy chain constant region and / or a light chain constant region. In some embodiments, the heavy chain constant region is selected from the hIgG1, hIgG2, hIgG3 or hIgG4 heavy chain constant regions. In some embodiments, the light chain constant region may be selected from the κ chain or the λ chain. In some embodiments, the above-mentioned specific antibody or its antigen-binding fragment may be a polyclonal antibody or a monoclonal antibody obtained.

[0018] In some embodiments, the Fc of the above-mentioned antibody or its antigen-binding fragment is the Fc of human IgG1. In some embodiments, the Fc of the above-mentioned antibody or its antigen-binding fragment is the Fc of human IgG4.

[0019] Another aspect of the present invention provides a chimeric antigen receptor, which comprises an extracellular antigen-binding domain, a transmembrane domain and an intracellular signaling domain, wherein the extracellular antigen-binding domain comprises the antibody or its antigen-binding fragment of the present invention.

[0020] Another aspect of the present invention provides a modified immune cell, which comprises the chimeric antigen receptor according to the present invention.

[0021] Another aspect of the present invention provides a multispecific antibody, which comprises two or more antigen-binding domains, wherein one antigen-binding domain comprises the antibody or its antigen-binding fragment that specifically binds to CD40 and / or its fragment according to the present invention.

[0022] Another aspect of the present invention provides a method for detecting CD40 in a sample, the method comprising the step of detecting CD40 in the sample with the antibody or its antigen-binding fragment according to the present invention.

[0023] In some embodiments, the sample is whole blood, red blood cell concentrate, platelet concentrate, white blood cell concentrate, tissue, bone marrow aspirate, plasma, serum, cerebrospinal fluid, feces, urine, cultured cells, saliva, oral secretions and / or nasal secretions.

[0024] In one embodiment, the method is a method for non-diagnostic purposes.

[0025] Another aspect of the present invention provides a bispecific binding protein, which comprises a first domain and a second domain, the first domain binds to CD40 or its fragment, the second domain binds to PD1 or its fragment, wherein the first domain is the antibody or its antigen-binding fragment that specifically binds to CD40 and / or its fragment according to the present invention.

[0026] In some embodiments, the first domain and / or the second domain are selected from the forms of IgG, Fab, Fab’, F(ab’) 2 , Fv or scFv.

[0027] In some embodiments, the number of the IgG, Fab, Fab’, F(ab’) 2 , Fv or scFv is 1 or more.

[0028] In some embodiments, the heavy chain constant region of the IgG is a human IgG1, human IgG2, human IgG3 or human IgG4 heavy chain constant region.

[0029] In some embodiments, the first domain is in the form of IgG and the second domain is in the form of IgG. In some embodiments, the first domain is in the form of scFv and the second domain is in the form of scFv. In some embodiments, the first domain is in the form of IgG and the second domain is in the form of scFv. In some embodiments, the first domain is in the form of scFv and the second domain is in the form of IgG.

[0030] In some embodiments, the first domain and the second domain are directly connected or connected via a linker peptide L to form a bispecific binding protein.

[0031] In some embodiments, the second domain is connected to the C-terminus or N-terminus of the first domain.

[0032] In some embodiments, the bispecific binding protein comprises polypeptide chain 1 and polypeptide chain 2, wherein the polypeptide chain 1 comprises a structure shown as N’-VL 1 -CL 1 -C’; the polypeptide chain 2 comprises a structure shown as N’-VH 1 -CH1 1 -h-CH2 1 -CH3 1 -L-VH 2 -L-VL 2 -C’; or the polypeptide chain 1 comprises a structure shown as N’-VL 2 -CL 2 -C’; the polypeptide chain 2 comprises a structure shown as N’-VH 2 -CH1 2 -h-CH2 2 -CH3 2 -L-VH 1 -L-VL 1 -C’; wherein, the VL 1 and VH 1Are respectively the variable region of the light chain and the variable region of the heavy chain of the first domain, and said VL 2 and VH 2 Are the variable region of the light chain and the variable region of the heavy chain of the second domain, said h is the hinge region, said L is the linker peptide, and said CL 1 、CH1 1 、CH2 1 and CH3 1 Are the constant region of the light chain and the constant region of the heavy chain of the first domain, and said CL 2 、CH1 2 、CH2 2 and CH3 2 Are the constant region of the light chain and the constant region of the heavy chain of the first domain.

[0033] In some embodiments, said linker peptide is a peptide with a length of 0-30 amino acids.

[0034] In some embodiments, said polypeptide chain 1 and said polypeptide chain 2 form a tetravalent structure. In some embodiments, said polypeptide chain 1 and said polypeptide chain 2 form a tetravalent symmetric structure.

[0035] In some embodiments, said hinge region h is a common hinge region in the immunoglobulin field, usually contains a large amount of proline, has flexibility, and forms 2-5 disulfide bonds.

[0036] In some embodiments, said linker peptide comprises the following amino acid sequences:

[0037] H1: EPKSSDKTHTPPPPP (SEQ ID NO: 271)

[0038] (G2S)2: GGSGGS (SEQ ID NO: 272)

[0039] (G4S)3: GGGGSGGGGSGGGGS (SEQ ID NO: 273)

[0040] (G4S)2: GGGGSGGGGS (SEQ ID NO: 274)

[0041] GS_2: GS

[0042] GS_4: GSGS (SEQ ID NO: 275)

[0043] GS_5: GGGGS (SEQ ID NO: 276)

[0044] GS_7: GGGGSGS (SEQ ID NO: 277)

[0045] GS_20: GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:278)

[0046] GS_25: GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO:279)

[0047] LH1: DKTHTCPPCP (SEQ ID NO:280)

[0048] G5-LH: GGGGGDKTHTCPPCP (SEQ ID NO:281)

[0049] H1_15-RT: EPKSSDKTHTPPPPPRT (SEQ ID NO:282)

[0050] L-GS_15-RT: LGGGGSGGGGSGGGGSRT (SEQ ID NO:283)

[0051] L-H1_15-RT: LEPKSSDKTHTPPPPPRT (SEQ ID NO:284)

[0052] KL-H1_15-RT: KLEPKSSDKTHTPPPPPRT (SEQ ID NO:285)

[0053] KL-H1_15-AS: KLEPKSSDKTHTPPPPPAS (SEQ ID NO:286)

[0054] RT-GS_5-KL: RTGGGGSKL (SEQ ID NO:287)

[0055] RT-GS_15-KL: RTGGGGSGGGGSGGGGSKL (SEQ ID NO:288)

[0056] RT-GS_25-KL: RTGGGGSGGGGSGGGGSGGGGSGGGGSKL (SEQ ID NO:289)

[0057] Human IgG1 hinge: EPKSCDKTHTCPPCP (SEQ ID NO:290)

[0058] Human IgG1 hinge: (C220S)EPKSSDKTHTCPPCP (SEQ ID NO:291)

[0059] Human IgG2 hinge: ERKCCVECPPCP (SEQ ID NO:292)

[0060] Human IgG4 hinge: ESKYGPPCPSCP (SEQ ID NO:293)

[0061] Human IgG4 hinge (S228P): ESKYGPPCPPCP (SEQ ID NO:294).

[0062] In some embodiments, the second domain is selected from an antibody against PD1 or an antigen-binding fragment thereof.

[0063] In some embodiments, the second domain comprises a light chain variable region VL and a heavy chain variable region VH.

[0064] In some embodiments, the second domain comprises HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:250, SEQ ID NO:251, and SEQ ID NO:252, respectively, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:254, SEQ ID NO:255, and SEQ ID NO:256, respectively.

[0065] In some embodiments, the second domain comprises HCDR1, HCDR2, and HCDR3 as shown in SEQ ID NO:258, SEQ ID NO:259, and SEQ ID NO:260, respectively, and / or LCDR1, LCDR2, and LCDR3 as shown in SEQ ID NO:262, SEQ ID NO:263, and SEQ ID NO:264, respectively.

[0066] In some embodiments, the second domain comprises a heavy chain variable region having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% identity to the amino acid sequence shown in SEQ ID NO:249 or 257.

[0067] In some embodiments, the second domain comprises a light chain variable region having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% identity to the amino acid sequence shown in SEQ ID NO:253 or 261.

[0068] In some embodiments, the second domain comprises the heavy chain variable region shown in SEQ ID NO:249 and the light chain variable region shown in SEQ ID NO:253, or the second domain comprises the heavy chain variable region shown in SEQ ID NO:257 and the light chain variable region shown in SEQ ID NO:261.

[0069] The present invention provides a bispecific binding protein that can simultaneously bind to and activate CD40 and bind to PD-1. This bispecific molecule can activate T cells and reduce the immunotoxicity caused by CD40 activation. The bispecific antibody structure of the present invention that links a CD40 agonist and a PD-1 antibody, including symmetric IgG-IgG, scFv-scFv and other structures, asymmetric structures, and antibody-drug conjugates that link a CD40 small molecule agonist and a PD-1 antibody, can all achieve similar effects.

[0070] In some specific embodiments, a bispecific binding protein composed of a full-length IgG CD40 antibody and a single-chain PD-1 antibody is provided. Among them, the full-length CD40 can specifically recognize CD40, block its binding to the ligand CD40L, and activate its downstream signaling pathway. It is composed of variable regions connected to the IgG4 Fc region through a hinge region; the single-chain PD-1 antibody is composed of the heavy and light chain variable regions of PD-1 that can specifically recognize PD-1, block its binding to the ligand PDL1, and activate T cells, which are connected by a linker; the full-length CD40 antibody is connected to the single-chain PD-1 antibody through a linker.

[0071] The bispecific binding protein according to the present invention can specifically activate CD40L transduction, activate T cells in in vitro cell experiments, significantly reduce liver toxicity and effectively inhibit tumor growth in a mouse model, while improving the safety and effectiveness of the CD40 antibody.

[0072] Another aspect of the present invention provides a method for detecting CD40 and PD-1 in a sample, and the method includes the step of detecting CD40 and PD-1 in the sample with the specific binding protein according to the present invention.

[0073] In some embodiments, the sample is whole blood, red blood cell concentrate, platelet concentrate, white blood cell concentrate, tissue, bone marrow aspirate, plasma, serum, cerebrospinal fluid, feces, urine, cultured cells, saliva, oral secretions, and / or nasal secretions.

[0074] In some embodiments, the method is a method for non-diagnostic purposes.

[0075] Another aspect of the present invention provides an isolated nucleic acid encoding the antibody or its antigen-binding fragment or the bispecific binding protein according to the present invention.

[0076] In some embodiments, the nucleic acid molecule is an mRNA molecule.

[0077] Another aspect of the present invention provides an expression vector containing the isolated nucleic acid according to the present invention.

[0078] In some embodiments, the expression vector may be a eukaryotic cell expression vector and / or a prokaryotic cell expression vector, such as a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated vector or a herpes simplex vector.

[0079] In some embodiments, the expression vector is present in nanoparticles, liposomes, exosomes, microbubbles or gene guns.

[0080] Another aspect of the present invention provides a host cell comprising the isolated nucleic acid or the expression vector of the present invention.

[0081] In some embodiments, the host cell is a conventional host cell in the art, as long as it can stably express the nucleic acid molecule carried by the expression vector as the antibody or its antigen-binding fragment or the bispecific binding protein of the present invention. Preferably, the host cell is a prokaryotic cell and / or a eukaryotic cell. The prokaryotic cell is preferably an E. coli cell such as TG1 or BL21 (expressing single-chain antibody or Fab antibody), and the eukaryotic cell is preferably a HEK293 cell or a CHO cell (expressing full-length IgG antibody). The host cell of the present invention can be obtained by transforming the expression vector into the host cell. The transformation method is a conventional transformation method in the art, preferably a chemical transformation method, a heat shock method or an electroporation method.

[0082] Another aspect of the present invention provides an antibody-drug conjugate, which comprises: the antibody or its antigen-binding fragment or the bispecific binding protein according to the present invention; and a drug covalently linked to the antibody or its antigen-binding fragment or the bispecific binding protein.

[0083] In some embodiments, the drug is selected from chemotherapeutic agents, radiotherapeutic agents, immunosuppressive agents and cytotoxic drugs.

[0084] Another aspect of the present invention provides a pharmaceutical composition, which comprises: the antibody or its antigen-binding fragment, the bispecific binding protein, or the antibody-drug conjugate according to the present invention; and a pharmaceutically acceptable carrier.

[0085] In some embodiments, the pharmaceutical composition further comprises a therapeutic agent selected from chemotherapeutic agents, radiotherapeutic agents, immunosuppressive agents and cytotoxic drugs.

[0086] In some embodiments, the pharmaceutically acceptable carrier may be a conventional carrier in the art, and the carrier may be any suitable physiological or pharmaceutically acceptable pharmaceutical excipient. The pharmaceutical excipient is a conventional pharmaceutical excipient in the art, and preferably includes pharmaceutically acceptable excipients, fillers, diluents, etc. More preferably, the pharmaceutical composition comprises 0.01-99.99% of the specific binding protein and / or other small molecule drugs, antibodies or polypeptides, and 0.01-99.99% of a pharmaceutical carrier, and the percentages are mass percentages of the pharmaceutical composition.

[0087] In some embodiments, the administration route of the pharmaceutical composition may be parenteral, by injection or oral administration. The pharmaceutical composition can be prepared in a form suitable for administration, such as a solid, semi-solid or liquid form, and can be an aqueous solution, non-aqueous solution or suspension, powder, tablet, capsule, granule, injection or infusion form. It can be administered intravascularly, subcutaneously, intraperitoneally, intramuscularly, by inhalation, intranasally, by airway instillation or by intrapleural instillation. The pharmaceutical composition can also be administered in the form of an aerosol or spray, such as intranasally; alternatively, intrathecally, intramedullary or intraventricularly, and can also be administered transdermally, percutaneous, topically, enterally, vaginally, sublingually or rectally. The pharmaceutical composition can be made into various dosage forms as needed, and a physician can determine a dose beneficial to the patient according to factors such as the type of patient, age, weight, general disease condition, and administration method.

[0088] In some embodiments, the specific binding protein in the pharmaceutical composition and other active ingredients can be administered simultaneously or sequentially.

[0089] Another aspect of the present invention provides the use of the antibody or its antigen-binding fragment, the bispecific binding protein, the isolated nucleic acid, the antibody-drug conjugate or the pharmaceutical composition according to the present invention in the preparation of a drug for preventing, treating and / or diagnosing immune diseases, acute and chronic inflammatory diseases, and tumor diseases.

[0090] In some embodiments, the tumor is one or more of breast cancer, renal cell carcinoma, melanoma, colon cancer, B-cell lymphoma, melanoma, head and neck cancer, bladder cancer, gastric cancer, ovarian cancer, malignant sarcoma, urothelial cancer, liver cancer, esophageal cancer, gastroesophageal junction cancer, nasopharyngeal cancer, small cell lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, prostate cancer, glioma, non-small cell lung cancer, acute myeloid leukemia, Hodgkin lymphoma, cutaneous squamous cell carcinoma, locally advanced and metastatic malignancies.

[0091] In some embodiments, the inflammatory disease is one or more of atopic dermatitis or ulcerative colitis.

[0092] In some embodiments, the immune disease is one or more of graft-versus-host disease, rheumatoid arthritis, systemic lupus erythematosus, or asthma.

[0093] Yet another aspect of the present invention provides a kit of medicaments, which comprises one or more medicine boxes, and the medicine boxes contain the antibody or its antigen-binding fragment, the bispecific binding protein, the antibody-drug conjugate or the pharmaceutical composition according to the present invention.

[0094] In some embodiments, the kit of medicaments comprises a first medicine box and a second medicine box. Among them, the first medicine box contains the antibody or its antigen-binding fragment, the bispecific binding protein, the antibody-drug conjugate or the pharmaceutical composition according to the present invention, and the second medicine box contains a therapeutic agent selected from chemotherapeutic agents, radiotherapeutic agents, immunosuppressive agents, and cytotoxic drugs.

[0095] Yet another aspect of the present invention provides a drug delivery device, which contains the antibody or its antigen-binding fragment, the bispecific binding protein, the antibody-drug conjugate or the pharmaceutical composition according to the present invention.

[0096] In some embodiments, the drug delivery device is a pre-filled syringe.

[0097] Yet another aspect of the present invention provides a method for preventing, treating, and / or diagnosing tumor diseases, acute and chronic inflammatory diseases, and / or immune diseases, which comprises administering to a subject a therapeutically effective amount of the antibody or its antigen-binding fragment, the bispecific binding protein, the antibody-drug conjugate or the pharmaceutical composition according to the present invention.

[0098] In some embodiments, the tumor is one or more of breast cancer, renal cell carcinoma, melanoma, colon cancer, B-cell lymphoma, melanoma, head and neck cancer, bladder cancer, gastric cancer, ovarian cancer, malignant sarcoma, urothelial carcinoma, liver cancer, esophageal cancer, gastroesophageal junction cancer, nasopharyngeal cancer, small cell lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, prostate cancer, glioma, non-small cell lung cancer, acute myeloid leukemia, Hodgkin lymphoma, cutaneous squamous cell carcinoma, locally advanced and metastatic malignancies.

[0099] In some embodiments, the inflammatory disease is one or more of atopic dermatitis or ulcerative colitis.

[0100] In some embodiments, the immune disease is one or more of graft-versus-host disease, rheumatoid arthritis, systemic lupus erythematosus, or asthma.

[0101] CD40, as an immune cell co - stimulatory molecule, is widely expressed in platelets, B cells, and myeloid cells, as well as other non - hematopoietic cells such as endothelial cells, fibroblasts, smooth muscle cells, and certain types of tumor cells. Due to the wide expression of CD40 in immune cells and its function of activating T cells through the activation of antigen - presenting cells (APCs), and the fact that IgG1 Fc can induce the ADCC effect, resulting in safety problems caused by CD40 agonists leading to the enhancement of the systemic immune system, the bispecific binding protein of the present invention uses a single - chain antibody that can only bind to CD40 as an agonist of CD40, and uses an IgG1 Fc mutant that weakens the ADCC effect to reduce the systemic immune enhancement caused by CD40 activation, thereby enhancing safety. While enhancing safety, the bispecific antibody or its antigen - binding fragment of the present invention links the CD40 agonist and the PD1 antibody together. The PD1 antibody can not only act as a tumor checkpoint inhibitor to inhibit the inhibitory effect of the tumor microenvironment on the immune system, but also act as a targeting molecule to direct APC cells expressing CD40 to T cells expressing PD1, promoting the antigen presentation from APC cells to T cells, and thereby enhancing the effectiveness of the CD40 agonist.

[0102] Another aspect of the present invention provides a detection kit, which includes the antibody or its antigen - binding fragment of the present invention or the bispecific binding protein of the present invention.

[0103] In some embodiments, the detection kit further includes a detectable label that can be linked to the antibody or the bispecific binding protein. The detectable label is linked to the antibody or the bispecific binding protein or exists separately in the kit.

[0104] In some embodiments, the detection kit further includes a substrate corresponding to the detectable label and / or an instruction manual. BRIEF DESCRIPTION OF THE DRAWINGS

[0105] Figure 1 Shows the detection results of the serum titer of mouse immunized with CD40. Among them, A is the detection result of the serum titer of CD40 immunogen using the Fc tag, and B is the detection result of the serum titer of CD40 immunogen using the His tag.

[0106] Figure 2 Shows the detection results of the binding affinity of murine anti - human CD40 monoclonal antibody to human CD40.

[0107] Figure 3 Shows the detection results of the binding affinity of murine anti - murine CD40 monoclonal antibody to murine CD40.

[0108] Figure 4Shows the detection results of the binding affinity of murine CD40 monoclonal antibody to simian CD40.

[0109] Figure 5 Shows the blocking effect of murine CD40 monoclonal antibody on CD40 / CD40L.

[0110] Figure 6 Shows the results of the Jurkat-CD40 reporter cell activation assay of murine CD40 monoclonal antibody.

[0111] Figure 7 Shows the results of the mixed lymphocyte reaction assay of murine CD40 monoclonal antibody.

[0112] Figure 8 Shows the schematic diagram of the bispecific antibody structure design.

[0113] Figure 9 Shows the detection results of the binding affinity of the bispecific antibody to antigens CD40 and PD1.

[0114] Figure 10 Shows the results of the Jurkat-CD40 reporter cell activation assay of the bispecific antibody.

[0115] Figure 11 Shows the detection results of the binding affinity of the #39 humanized antibody to CD40.

[0116] Figure 12 Shows the results of the Jurkat-CD40 reporter cell activation assay of the #39 humanized antibody.

[0117] Figure 13 Shows the detection results of the binding affinity of bispecific antibody NivH4 to CD40 and PD1.

[0118] Figure 14 Shows the results of the Jurkat-CD40 reporter cell activation assay of bispecific antibody NivH4.

[0119] Figure 15 Shows the results of the mixed lymphocyte reaction assay of bispecific antibody NivH4.

[0120] Figure 16 Shows the results of the in vivo pharmacokinetics (PK) experiment of bispecific antibody NivH4 in mice.

[0121] Figure 17 Shows the detection results of the in vivo tumor growth inhibition of bispecific antibody NivH4 in mice. Detailed implementation methods

[0122] The following describes the preferred embodiments of the present disclosure, and the present disclosure is not limited to the following preferred embodiments. It should be noted that for those skilled in the art, based on the inventive concept of this invention, several modifications and improvements made all fall within the protection scope of the present disclosure. Reagents without indicating the manufacturer can be obtained as conventional products through commercial purchase.

[0123] The main mechanism of immune checkpoint inhibitor therapy in tumor immunity is to relieve the immune negative regulation of the body on the tumor site through inhibitors, thereby establishing anti-tumor activity. CD40 is a member of the tumor necrosis factor receptor superfamily (TNFRSF). It can be activated by a ligand on the surface of another cell through direct cell-cell contact, or by a soluble ligand in the environment. After CD40 binds to its receptor, it can induce the formation of a trimeric signal complex, thereby promoting the recruitment of TNF receptor-associated factors (TRAFs) and NFκB activator-1 (Act1). Different cell types have different signal complex conductions and trigger various downstream activation pathways. For example, the binding to TRAF6 mainly activates the JAK / Stat3 pathway, while TRAF1 / 2 can induce MKK / p38 / ERK1 / 2 signal transduction. Act1 has multiple functions in the NFkB pathway, JNK, and PI3K signal transduction, and together with TRAF3 amplifies the MKK / p38 / ERK1 / 2 signal. CD40 is mainly expressed on B cells. The interaction between CD40 in B cells and T cells that are activated and express CD40L increases the expression of co-stimulatory molecules such as MHC-II and CD80 or CD86. Activated B cells migrate to lymphoid organs, where they present antigens to T cells. CD40-activated DCs and B cells support the immune response by releasing immune-stimulatory cytokines and chemokines such as IL-6, IL-12p70, IFNγ, CXCL10, and TNFα. In addition, CD40-activated B cells can induce antigen-specific CD8 + T cells by promoting the secretion of cytokines such as TNFα and IFNγ. Studies have shown that in vitro-activated B cells expressing CD40 are fully functional antigen-presenting B cells, and subsequent adoptive cell transfer therapy with these cells can improve the anti-tumor efficacy.

[0124] Due to the crucial role of CD40 in anti-tumor immune responses, various strategies to activate CD40 signaling have been widely explored. Monoclonal antibody agonists of CD40 are a hot topic among them. There are 8 publicly disclosed CD40 agonists undergoing clinical trials. Although these early clinical trials have shown some encouraging results, since the agonistic therapeutic antibodies used rely on secondary cross-linking through Fcγ receptors (FcγR) to obtain biological activity, this results in these anti-CD40 antibodies having multiple mixed modes of action and thus having a certain impact on their safety. Based on this, bispecific antibodies (bsAbs) can highlight corresponding advantages in the development of CD40 agonistic antibodies because they can be constructed based on various different structural forms and methods to recognize two different epitopes in cis or trans, or even a bispecific antibody in which a targeting domain and a functional domain are combined in one molecule.

[0125] PD1 (Programmed death 1) / PDL1 (Programmed death ligand 1) is the earliest and most thoroughly studied pair of tumor immune targets. PD1 is an immune checkpoint molecule belonging to the CD28 protein family. In T cells, the expression of PD1 is significantly upregulated when T cells are stimulated by antigens or cytokines released by T cell activation. In addition, PD1 is also expressed on B cells, monocytes, and dendritic cells (DCs) and regulates their immune functions. PDL1 is a type I transmembrane glycoprotein of the B7 ligand family, and PDL1 is expressed on activated T cells and B cells as well as some non-hematopoietic cells. PDL1 is also expressed on the surface of tumor cells and its expression can be upregulated by interferon γ (IFN-γ) produced by activated T cells. The binding of PDL1 to PD1 weakens T cell-mediated immune surveillance, leading to the absence of immune responses and even apoptosis of T cells. It also inhibits tumor-infiltrating CD4 + / CD8 + T cells (CD4 + / CD8 + TILs), resulting in the reduction of cytokines including tumor necrosis factor (TNF), IFN-γ, and interleukin-2 (IL-2), providing a way for cancer cells to escape immune responses. Therefore, PD1 / PDL1 inhibitors can relieve the immune suppression of anti-tumor T cells, induce T cell proliferation and infiltration into the tumor microenvironment (TME), thereby triggering anti-tumor responses.

[0126] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the art to which this invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form and vice versa.

[0127] Unless the context clearly dictates otherwise, the expressions "a" and "an" as used herein include plural referents. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so on.

[0128] The term "about" as used herein means a range of ±20% of the value that follows. In some embodiments, the term "about" means a range of ±10% of the value that follows. In some embodiments, the term "about" means a range of ±5% of the value that follows.

[0129] The term "specific binding protein" generally refers to a molecule that specifically binds to an epitope. Antigen-binding molecules or specific binding proteins include, for example, antibodies, antibody fragments, and framework antibodies or antigen-binding fragments thereof.

[0130] The term "antibody" of this invention encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific or trispecific antibodies), single-chain molecules, and antibody fragments, so long as they exhibit the required antigen-binding activity.

[0131] The term "monoclonal antibody" of this invention refers to an antibody obtained from a substantially homogeneous group of antibodies, i.e., the individual antibodies comprising the group are identical and / or bind the same epitope, except for variant antibodies that may be present in trace amounts (e.g., containing naturally occurring mutations or arising during the production of the monoclonal antibody preparation and typically present in small amounts). Different from polyclonal antibody preparations, which generally include different antibodies directed against different antigenic determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation is directed against a single determinant on the antigen.

[0132] The term "multispecific antibody" of the present invention is used in its broadest sense and encompasses antibodies having multi-epitope specificity. These multispecific antibodies include, but are not limited to: antibodies comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH-VL unit has multi-epitope specificity; antibodies having two or more VL and VH regions, each VH-VL unit binding to a different target or different epitopes of the same target; antibodies having two or more single variable regions, each single variable region binding to a different target or different epitopes of the same target; full-length antibodies, antibody fragments, diabodies, and triabodies, antibody fragments covalently or non-covalently linked together, etc.

[0133] The term "bispecific binding protein" or "bispecific antibody" of the present invention refers to a molecule capable of specifically binding at least two different antigenic determinants, for example, two binding sites each formed by a pair of antibody heavy chain variable domains (VH) and antibody light chain variable domains (VL) binding to different antigens or different epitopes on the same antigen. The bispecific antibody can be in the 1+1 form, 2+1 form (comprising two binding sites for a first antigen or epitope and one binding site for a second antigen or epitope) or 2+2 form (comprising two binding sites for a first antigen or epitope and two binding sites for a second antigen or epitope). Generally, a bispecific antibody comprises two antigen-binding sites, each antigen-binding site being specific for a different antigenic determinant.

[0134] The term "valence" of the present invention refers to the presence of a specified number of binding domains in an antigen-binding molecule. Thus, the terms "bivalent", "tetravalent" and "hexavalent" respectively refer to the presence of two binding domains, four binding domains and six binding domains in an antigen-binding molecule. The bispecific antibody is at least "bivalent" and can be "trivalent", "tetravalent" or "more valent"). In some cases, the antibody has two or more binding sites and is bispecific. That is, even in the presence of more than two binding sites (i.e., the antibody is trivalent or multivalent), the antibody can still be bispecific.

[0135] The terms "full-length antibody" and "intact antibody" of the present invention are used interchangeably herein and refer to antibodies that are substantially similar in structure to natural antibodies. A "natural antibody" refers to an immunoglobulin molecule that exists in nature. For example, a natural IgG class antibody is a heterotetrameric glycoprotein of approximately 150,000 daltons, composed of two light chains and two heavy chains linked by disulfide bonds. From the N-terminus to the C-terminus, each heavy chain has a variable region (VH) (also referred to as a variable heavy chain domain or heavy chain variable domain) and three constant domains (CH1, CH2, and CH3) (also referred to as heavy chain constant regions). From the N-terminus to the C-terminus, each light chain has a variable region (VL) (also referred to as a variable light chain domain or light chain variable domain) and a light chain constant domain (CL) (also referred to as a light chain constant region). The heavy chain of an antibody can be one of five types, namely α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), and can be further divided into subtypes, such as γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). The light chain of an antibody can be one of two types, namely κ light chain and λ light chain, based on the amino acid sequence of its constant domain.

[0136] Within the light chain and heavy chain, the variable region and the constant region are joined by a "J" region of approximately 12 or more amino acids, and the heavy chain also contains a "D" region of approximately 3 or more amino acids. Each heavy chain is composed of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region is composed of 3 domains (CH1, CH2, and CH3). Each light chain is composed of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region is composed of one domain CL. The constant region of an antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

[0137] The term "variable region" or "variable domain" of the present invention refers to the domain of the heavy or light chain of an antibody that participates in the binding of the antigen-binding molecule to an antigen. The variable domains (VH and VL, respectively) of the heavy and light chains of a natural antibody generally have similar structures, each containing four conserved framework regions (FR) and three hypervariable regions (HVR). A single VH or VL domain may be sufficient to confer antigen-binding specificity.

[0138] The term "variable" in the context of the present invention refers to the fact that certain segments of the variable domains are generally different in sequence between antibodies. The V domains mediate antigen binding and define the specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domain. Instead, it is concentrated in three segments within the variable domains of the light and heavy chains, called hypervariable regions (HVRs). The more highly conserved portions of the variable domain are called framework regions (FRs). The variable domains of the native heavy and light chains each contain four FR regions, mostly adopting a β-sheet conformation, connected by three HVRs, which form loop connections and in some cases form part of the β-sheet structure. The HVRs in each chain are held tightly together by the FR regions and, together with the HVRs of the other chain, contribute to the formation of the antigen-binding site of the antibody (see Kabat et al., Sequences of Immunological Interest, 5th Edition, National Institute of Health, Bethesda, MD (1991)). The constant domains do not directly participate in antibody-antigen binding and have other effector functions, such as participating in antibody-dependent cell cytotoxicity of the antibody.

[0139] The term "hypervariable region" or "HVR" of the present invention refers to a region in the antibody variable domain region that is highly variable in sequence and / or forms a structurally defined loop ("hypervariable loop"). Generally, a native four-chain antibody contains six HVRs: three in VH (H1, H2, H3) and three in VL (L1, L2, L3). HVRs generally contain amino acid residues from hypervariable loops and / or from "complementary determining regions (CDRs)", and the amino acid residues from "complementary determining regions (CDRs)" have the highest sequence variability and / or are involved in antigen recognition. Exemplary CDRs (LCDR1, LCDR2, LCDR3, HCDR1, HCDR2, and HCDR3) occur at amino acid residues 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2), and 96-101 (H3) (Chothia et al., J. Mol. Biol. 196:901-917 (1987)). Exemplary CDRs (LCDR1, LCDR2, LCDR3, HCDR1, HCDR2, and HCDR3) occur at amino acid residues 24-34 (L1), amino acid residues 50-56 (L2), amino acid residues 89-97 (L3), amino acid residues 31-35 (H1), amino acid residues 50-65 (H2), and amino acid residues 95-102 (H3) (Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991)). For comparison, the corresponding amino acid residues containing the CDRs defined in the above-cited references are listed in the following table. In the present application, the amino acid sequences of the above-listed CDRs are shown according to the IMGT definition rules (the sequences shown in the claims of the present application are also according to the IMGT definition rules). Those skilled in the art should understand that, unless otherwise specified, the terms "CDR" and "complementary determining region" of a given antibody or its region (e.g., variable region) should be understood to cover the complementary determining regions defined by any of the above-known schemes described in the present invention. Although the scope claimed in the present invention is based on the sequences shown according to the IMGT definition rules, the amino acid sequences corresponding to other CDR definition rules should also fall within the protection scope of the present invention.

[0140] Positions of the CDR definitions of the present invention in the antibody light or heavy chain under different numberings

[0141] CDR\Numbering System Kabat Chothia Combined LCDR1 24-34 26-32 24-34 LCDR2 50-56 50-52 50-56 LCDR3 89-97 91-96 89-97 HCDR1 31-35 26-32 26-35 HCDR2 50-65 52-58 50-65 HCDR3 95-102 95-102 95-102

[0142] "Framework" or "FR" refers to the variable domain residues other than the hypervariable region (HVR) residues. The FRs of a variable domain typically consist of the following four FR domains: FR1, FR2, FR3, and FR4. Thus, the HVR and FR sequences typically occur in VH (or VL) in the following sequence: FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.

[0143] The "class" of an antibody refers to the type of constant domain or constant region possessed by the heavy chain of the antibody. There are five classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are designated α, δ, ε, γ, and μ, respectively.

[0144] A "humanized antibody" contains amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody contains at least one, and typically two, variable domains in which all or substantially all of the HVRs (e.g., CDRs) correspond to the HVRs of a non-human antibody and all or substantially all of the FRs correspond to the FRs of a human antibody. A humanized antibody optionally may contain at least a portion of an antibody constant region derived from a human antibody. An antibody in a "humanized form", such as a non-human antibody, refers to an antibody that has been humanized.

[0145] A "humanized antibody" has an amino acid sequence corresponding to that of an antibody produced by a human or human cell or derived from a non-human source using a human antibody library or other human antibody-encoding sequences. This definition of a human antibody specifically excludes humanized antibodies that contain non-human antigen-binding residues.

[0146] The term "Fc domain" or "Fc region" of the present invention is used to define the C-terminal region of the antibody heavy chain containing at least a portion of the constant region. This term includes native sequence Fc regions and variant Fc regions. The IgG Fc region comprises the IgG CH2 domain and the IgG CH3 domain. The CH2 domain herein can be a native sequence CH2 domain or a variant CH2 domain. The CH3 region herein can be a native sequence CH3 domain or a variant CH3 domain. The CH2 domain may contain one or more mutations that reduce or eliminate the binding of the CH2 domain to one or more Fcγ receptors (such as FcγRI, FcγRIIa, FcγRIIb, FcγRIII) and / or complement. It is hypothesized that reducing or eliminating the binding to Fc receptor γ will reduce or eliminate antibody molecule-mediated ADCC. Similarly, reducing or eliminating the binding to complement is expected to reduce or eliminate antibody molecule-mediated CDC. Mutations that reduce or eliminate the binding of the CH2 domain to one or more Fcγ receptors and / or complement are known in the art (Wang et al., 2018). These mutations include the so-called "LALA mutations", which involve replacing the leucine residues at positions 1.3 and 1.2 of the IMGT position of the CH2 domain with alanine (L1.3A and L1.2A). Alternatively, it is also known to mutate the conserved N-linked glycosylation site to produce a-glycosylated antibodies by mutating the asparagine (N) at position 84.4 of the IMGT position in the CH2 domain to alanine, glycine or glutamine (N84.4A, N84.4G or N84.4Q) to reduce IgG1 effector function (Wang et al., 2018). As another alternative, it is known that complement activation (C1q binding) and ADCC can be reduced by mutating the proline at position 114 of the IMGT position of the CH2 domain to alanine or glycine (P114A or P114G) (Idusogie et al., 2000; Klein et al., 2016). These mutations can be combined to produce antibody molecules with further reduced or no ADCC or CDC activity.

[0147] "Regions equivalent to the Fc region of an immunoglobulin" include variants of naturally occurring alleles of the immunoglobulin Fc region, as well as modified variants having the ability to produce substitutions, additions or deletions but substantially not reducing immunoglobulin-mediated effector functions such as antibody-dependent cytotoxicity. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of the Fc region of an immunoglobulin without substantially losing biological function. Such variants can be selected according to the general rules known in the art so as to have a minimal impact on activity (see, for example, Bowie, J.U. et al., Science 247:1306-10 (1990)).

[0148] The term "effector function" of the present invention is attributable to the Fc region of an antibody and is a biological activity that varies with the antibody isotype. Examples of antibody effector functions include: C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), cytokine secretion, antigen uptake by immune complex-mediated antigen-presenting cells, downregulation of cell surface receptors (e.g., B cell receptors), and B cell activation, etc.

[0149] The present invention also relates to amino acid sequence variants, which can be prepared by introducing appropriate modifications into the nucleotide sequence encoding the molecule or by peptide synthesis. Such modifications include, for example, deletions, insertions, and / or substitutions of residues in the antibody amino acid sequence. Any combination of deletions, insertions, and substitutions can be made to obtain the final construct, which has the desired properties, such as antigen-binding activity. The sites for substitution generally include HVR and framework (FR). See the possible substitutions of the following amino acids.

[0150] Conservative amino acid substitutions

[0151] Amino Acid Residue Conservative Substitution Preferred Conservative Substitution Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Asp; Lys; Arg Gln Asp(D) Glu; Asn Glu Cys(C) Ser; Ala Ser Gln(Q) Asn; Glu Asn Glu(E) Asp; Gln Asp Gly(G) Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe; Nle Leu Leu(L) Nle; Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Trp; Leu; Val; Ile; Ala; Tyr Tyr Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Val; Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala; Nle Leu

[0152] The term "polynucleotide" or "nucleic acid" or "nucleotide sequence" of the present invention refers to an isolated nucleic acid molecule or construct, such as messenger RNA (mRNA), virus-derived RNA, or plasmid DNA (pDNA). The polynucleotide may contain conventional phosphodiester bonds or unconventional bonds (e.g., amide bonds, such as those found in peptide nucleic acids (PNAs)). The term "nucleic acid molecule" refers to any one or more nucleic acid segments present in the polynucleotide, such as DNA or RNA fragments.

[0153] "Antibody fragment" comprises a portion of a whole antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab’, F(ab’) 2 and Fv; diabodies, triabodies, tetra-bodies, cross-Fab fragments; linear antibodies; single-chain antibody molecules (e.g., scFv); multispecific antibodies formed by antibody fragments and single-domain antibodies (single-domain antibodies).

[0154] The term "antigen-binding domain" or "antigen-binding site" of the present invention refers to the part of an antigen-binding molecule that specifically binds to an antigenic determinant. More specifically, the term "antigen-binding domain" refers to a part of an antibody that contains regions that specifically bind to and are complementary to a part or all of an antigen. In the case where the antigen molecule is very large, the antigen-binding molecule may only bind to a specific part of the antigen, which is called an epitope. The antigen-binding domain can be provided by, for example, one or more variable domains (also called variable regions). Preferably, the antigen-binding domain comprises the variable light chain region (VL) and the variable heavy chain region (VH) of an antibody. In one aspect, the antigen-binding domain is capable of binding to its antigen and blocking or partially blocking the function of the antigen.

[0155] The term "antigenic determinant" of the present invention is synonymous with "antigen" and "epitope", and refers to a site on a polypeptide macromolecule (such as a continuous stretch of amino acids or a conformational configuration composed of different regions of non-contiguous amino acids) to which the antigen-binding moiety binds, thereby forming an antigen-binding moiety-antigen complex. Antigenic determinants can be present, for example, on the surface of tumor cells, the surface of microbially infected cells, the surface of other diseased cells, the surface of immune cells, in free substances in serum and / or in the extracellular matrix (ECM). Unless otherwise specified, the proteins used as antigens in the present invention can be any natural form of protein from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats). The antigen can also be a human protein, or the antigen is a "full-length", unprocessed protein, and any form of protein produced by intracellular processing, or a naturally occurring protein variant, such as a splice variant or an allelic variant.

[0156] "Specifically bind" means having binding selectivity for an antigen and can be distinguished from unwanted or non-specific binding. The ability of an antigen-binding molecule to bind to a specific antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art (such as surface plasmon resonance (SPR) techniques and traditional binding assays). In one embodiment, for example, as measured by SPR, the degree of binding of the antigen-binding molecule to an unrelated protein is less than about 10% of the degree of binding of the antigen-binding molecule to the antigen. In certain embodiments, the dissociation constant (Kd) of the molecule that binds to the antigen is ≤1 M, ≤100 nM, ≤10 nM, ≤1 nM, ≤0.1 nM, ≤0.01 nM or ≤0.001 nM (e.g., 10-7 M or lower, e.g., 10-7 M to 10-13 M, e.g., 10-9 M to 10-13 M).

[0157] In some embodiments, the specific binding protein comprises a first domain and a second domain, wherein the first domain binds to CD40 or a fragment thereof, and the second domain binds to PD1 or a fragment thereof.

[0158] The terms "bispecific antibody comprising a first domain that specifically binds CD40 and a second domain that specifically binds PD1", "bispecific antibody that specifically binds CD40 and PD1", "bispecific antigen-binding molecule that is specific for CD40 and PD1", or "anti-CD40 / anti-PD1 antibody" are used interchangeably herein and refer to a bispecific antibody that is capable of binding CD40 and PD1 with sufficient affinity such that the antibody can be used as a diagnostic and / or therapeutic agent targeting CD40 and PD1.

[0159] "Affinity" or "binding affinity" refers to the strength of non-covalent interactions between a single binding site of a molecule (such as an antibody) and its binding ligand (such as an antigen). Binding affinity can generally be expressed by the dissociation constant (Kd), which is the ratio of the dissociation rate constant to the association rate constant (Koff and Kon, respectively). Thus, equivalent affinities can include different rate constants as long as the ratio of the rate constants remains the same. Affinity can be measured by conventional methods known in the art, such as surface plasmon resonance (SPR).

[0160] The term "isolated" nucleic acid molecule or polynucleotide of the present invention refers to a nucleic acid molecule, DNA or RNA, that has been separated from its natural environment. In the present invention, a recombinant polynucleotide encoding a polypeptide contained in a vector is also isolated. Other examples of isolated polynucleotides include recombinant polynucleotides in heterologous host cells or polynucleotides purified in solution. Isolated polynucleotides include polynucleotide molecules that are normally contained in a cell containing the polynucleotide molecule, but the polynucleotide molecule is present extrachromosomally or at a chromosomal location different from its natural chromosomal location. Isolated RNA molecules include RNA transcripts of the present invention in vivo or in vitro, in positive and negative strand forms, and in double-stranded forms. The isolated polynucleotides or nucleic acids of the present invention further include such molecules generated synthetically. Additionally, the polynucleotide or nucleic acid can be or can include regulatory elements, such as promoters, ribosome binding sites, or transcription terminators.

[0161] The terms "vector" or "expression vector" of the present invention are used interchangeably with "expression construct", and refer to a DNA molecule that introduces a specific gene operably linked thereto into a target cell and directs its expression. The vectors include vectors as self-replicating nucleic acid structures and vectors incorporated into the genome of the host cell into which they have been introduced. The expression vectors of the present invention contain expression cassettes. The expression vectors can transcribe a large amount of stable mRNA. Once the expression vector is within the target cell, ribonucleic acid molecules or proteins encoded by the gene are generated by the cellular transcription and / or translation machinery. In one embodiment, the expression vectors of the present invention include expression cassettes containing polynucleotide sequences encoding the bispecific antigen-binding molecules or fragments thereof of the present invention. The term "expression cassette" of the present invention refers to a recombinant or synthetically generated polynucleotide having a series of nucleic acid elements that permit transcription of a specific nucleic acid in a target cell. The recombinant expression cassette can be introduced into plasmids, chromosomes, mitochondrial DNA, plastid DNA, viruses, or nucleic acid fragments. Typically, in addition to other sequences, the recombinant expression cassette portion of the expression vector includes the nucleic acid sequence to be transcribed and a promoter. In certain embodiments, the expression cassettes of the present invention contain polynucleotide sequences encoding the bispecific antigen-binding molecules or fragments thereof of the present invention.

[0162] The terms "host cell", "host cell line", and "host cell culture" are used interchangeably and refer to a cell into which exogenous nucleic acid has been introduced, and also include the progeny of such cells. Host cells include "transformants / transfectants" and "transformed cells", including primary transformed cells and progeny derived therefrom. The nucleic acid of the progeny may not be identical to that of the parental cell and may contain mutations. A host cell is any type of cell that can be used to produce the bispecific antigen-binding molecules of the present invention. Host cells include cultured cells, such as cultured mammalian cells, such as CHO cells, HEK293 cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells, yeast cells, insect cells, and plant cells, and also include cells contained within transgenic animals, transgenic plants, or cultured plant or animal tissues.

[0163] The term "antibody-drug conjugate" or "ADC" refers to a binding protein (such as an antibody or an antigen-binding fragment thereof) that is chemically linked to one or more chemical drugs. In a preferred embodiment, the ADC includes a binding protein, a drug, and a linker that links the binding protein to the drug.

[0164] The term "chimeric antigen receptor" or "CAR" refers to a receptor having a desired antigen specificity and a signaling domain to propagate an intracellular signal upon antigen binding. For example, T lymphocytes recognize specific antigens via the interaction of the T cell receptor (TCR) with short peptides presented by class I or class II major histocompatibility complex (MHC) molecules. For initial activation and clonal expansion, naive T cells rely on antigen-presenting cells (APCs) that provide additional co-stimulatory signals. In some embodiments, monocytes and macrophages can be engineered to express, for example, a chimeric antigen receptor (CAR). The modified cells can be recruited to the tumor microenvironment, where they serve as potent immune effectors by infiltrating the tumor and killing target cancer cells. A CAR can include an antigen-binding domain, a transmembrane domain, and an intracellular domain. The antigen-binding domain binds to an antigen on the target cell. Examples of cell surface markers of antigens that can be used as the antigen-binding domain of a CAR binding to a CAR include those associated with viral, bacterial, parasitic infections, autoimmune diseases, and cancer cells (such as tumor antigens).

[0165] The term "modified immune cell" refers to an immune cell that has been genetically modified to express a CAR. In some embodiments, the immune cell is a T cell, or a cell derived therefrom. In some embodiments, the immune cell is a natural killer (NK) cell, or a cell derived therefrom. In some embodiments, the immune cell is a B cell, or a cell derived therefrom. In some embodiments, the immune cell is a B cell, or a cell derived therefrom. In some embodiments, the immune cell is a monocyte or macrophage, or a cell derived therefrom.

[0166] The term "kit" refers to a combination in which one or more active ingredients are present in a single unit. When multiple active ingredients are present in a kit, the active ingredients can be administered simultaneously or sequentially.

[0167] The term "administration device" refers to any tool for administering a drug to a subject.

[0168] The term "prefilled syringe" refers to a syringe that has been loaded with a drug before the operator of the syringe approaches or uses it. A prefilled syringe can be made of any material (e.g., glass, plastic, or metal). In some embodiments, the prefilled syringe is a glass syringe.

[0169] An "effective amount" of a drug refers to the amount necessary to cause a physiological change in a cell or tissue to which it is administered. An "effective amount" includes an amount sufficient to ameliorate or prevent the symptoms or conditions of a medical disease. An effective amount also means an amount sufficient to permit or facilitate diagnosis. The effective amount for a particular patient or veterinary subject can vary depending on factors such as, for example, the condition to be treated, the overall health of the patient, the method of administration and dosage, and the severity of side effects. The effective amount can be the maximum dose or dosing regimen that avoids significant side or toxic effects.

[0170] The bispecific antibodies according to the present invention have a synergistic effect. "Synergistic effect" means that the combined effect of two drugs is greater than the sum of their individual effects and is statistically different from the control and the single drugs. The additive effect of the present invention means that the combined effect of two drugs is the sum of their individual effects and is statistically different from the control and / or the single drugs.

[0171] A "therapeutically effective amount" of a drug (such as a pharmaceutical composition) refers to the amount necessary to effectively achieve the desired therapeutic or prophylactic effect at a dose, dosing interval, and time. For example, a therapeutically effective amount of a drug eliminates, alleviates / reduces, delays, minimizes, or prevents the adverse effects of a disease.

[0172] The terms "individual" or "subject" refer to a mammal. Mammals include, but are not limited to, domesticated animals (such as cows, sheep, cats, dogs, and horses), primates (such as humans and non-human primates, such as monkeys), rabbits, and rodents (such as mice and rats). Specifically, the individual or subject is a human.

[0173] The term "pharmaceutical composition" refers to a mixture containing one or more antibodies or antigen-binding fragments thereof of the present disclosure and other chemical components, such as physiological / pharmaceutically acceptable carriers or excipients. The purpose of the pharmaceutical composition is to facilitate administration to an organism, promote absorption of the active ingredient, and thereby exert its biological activity.

[0174] The term "pharmaceutically acceptable carrier" refers to a component in a pharmaceutical composition that is non-toxic to the subject in addition to the active ingredient. Pharmaceutically acceptable excipients include, but are not limited to, buffers, stabilizers, and / or preservatives.

[0175] The term "cancer" refers to a disorder in mammals characterized by unregulated cell growth. Examples of cancer include, but are not limited to, tumors, lymphomas, blastomas, sarcomas, and leukemias or lymphoid malignancies. More specific examples of cancer include, but are not limited to, squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma, and squamous cell carcinoma of the lung), peritoneal cancer, hepatocellular carcinoma, gastric cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), bone cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, urethral cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer or cervical cancer, salivary gland cancer, kidney or ureteral cancer, prostate cancer, vaginal cancer, vulvar cancer, thyroid cancer, anal cancer, penile cancer, melanoma, cholangiocarcinoma, central nervous system (CNS) tumors, spinal axis tumors, brainstem glioma, glioblastoma multiforme, astrocytoma, schwannoma, ependymoma, medulloblastoma, meningioma, squamous cell carcinoma, pituitary adenoma, and Ewing's sarcoma, superficial spreading melanoma, lentigo maligna melanoma, acral lentiginous melanoma, nodular melanoma, multiple myeloma, and B-cell lymphoma, chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), hairy cell leukemia, chronic myelogenous leukemia, and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phakomatoses, edema (such as that associated with brain tumors), and Meigs' syndrome, brain tumors and brain cancer, and head or neck cancer and associated metastatic cancer.

[0176] The term "treatment" refers to administering a therapeutic agent, either internally or externally, to a patient, such as a composition comprising any one of the antibodies or antigen-binding fragments thereof of the present disclosure or a nucleic acid molecule encoding an antibody or antigen-binding fragment thereof, the patient having one or more diseases or symptoms, the therapeutic agent having a therapeutic effect on these diseases or symptoms. Generally, the therapeutic agent is administered in an amount effective to alleviate one or more diseases or symptoms in the treated patient or population to induce regression of such symptoms or inhibit the development of such symptoms to any clinically measurable degree.

[0177] The term "preventing cancer" refers to delaying, inhibiting, or preventing the onset of cancer in a mammal in which the initiation of carcinogenesis or tumorigenesis has not been confirmed, but which has been identified, by, for example, genetic screening or other methods, as having a susceptibility to cancer. The term also includes treating a mammal having a pre-cancerous condition to terminate the progression of the pre-cancerous condition to a malignant tumor or cause its regression.

[0178] The term "detectable label" encompasses labels that can be detected directly or indirectly, and the detectable labels are linked to the antibody or the bispecific binding protein, or are present separately in the kit. Suitable labels include, but are not limited to, molecules detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. Suitable labels include, but are not limited to, fluorescent dyes (such as GFT and its variants, FITC, TRITC, fluorescein, and rhodamine, etc.), electron-dense reagents (such as gold), enzymes (such as horseradish peroxidase (HRP), alkaline phosphatase (AP), glucose oxidase, β–D-galactosidase, urease, catalase, or glucoamylase), molecules containing radionuclides (i.e., radioisotopes), chemiluminescent molecules, electrochemiluminescent molecules, biotin, digoxin / digoxigenin, or haptens and other entities that are or can become detectable. The antibody or its antigen-binding fragment or bispecific binding protein in the present disclosure is linked with a "detectable label" and thus is detectably labeled.

[0179] Example

[0180] Example 1 Preparation of murine monoclonal antibody against CD40 using hybridoma technology

[0181] Immunization Female Balb / C and C57BL / 6 mice at 6 - 8 weeks old were immunized with the immunogen CD40 (purchased from ACRO, product number CD0-H5253), and the mice were raised under SPF conditions. At the primary immunization, the immunogen CD40 protein and Freund's complete adjuvant (purchased from Sigma) were mixed and emulsified at a ratio of 1:1, and then 0.3 mL was injected subcutaneously at multiple points and intraperitoneally, that is, 100 micrograms of the immunogen CD40 was injected into each mouse. At the primary booster immunization, the immunogen CD40 and Freund's incomplete adjuvant (purchased from Sigma) were mixed and emulsified at a ratio of 1:1, and then 0.3 mL was injected intraperitoneally, that is, 100 micrograms of the immunogen was injected into each mouse. The interval between the primary immunization and the first booster immunization was 2 weeks, and the interval between each subsequent booster immunization was 2 weeks. The immunogen CD40 and Freund's incomplete adjuvant (purchased from Sigma) were mixed at a ratio of 1:1. Blood was collected one week after each booster immunization, and the antibody titer of the immunogen CD40 in the serum titer was detected by ELISA.

[0182] The serum titers of the immunized mice were detected by ELISA, and the results are as Figure 1 A and Figure 1 B. The results showed that the sera of the mice immunized with CD40 had binding to the immunogen to varying degrees, presenting an antigen-antibody reaction. Among them, the highest dilution gradient of the immunogen CD40 with Fc tag and His tag was greater than 64K (6.4×10 4 ).

[0183] The selected mice were boosted twice consecutively by intraperitoneal injection of 50 μg of CD40 protein, with a 1-day interval between the two immunizations. 3 - 4 days after the second boost, the mice were sacrificed, and splenocytes were collected, counted, and centrifuged at 400 g / min for 5 minutes. An appropriate amount of DMEM medium was added to resuspend the splenocytes, and the density of the splenocytes was adjusted to 1×10 8 cells / mL. Plasma cells were screened out using a CD138 kit (purchased from STEMCELL). The screened plasma cells were mixed with mouse myeloma cells SP2 / 0 at a ratio of 1:5 based on the number of viable cells, and then washed twice by centrifugation at 400 g / min for 5 minutes with DMEM medium. Cell fusion was performed using the PEG fusion method. After fusion, the cells were centrifuged at 1000 rpm / min for 7 minutes. The centrifuged cells were diluted into 400 mL of DMEM medium (purchased from Sigma) containing 20% fetal bovine serum from Australia (purchased from Gibco) and 1×HAT (purchased from Gibco), where the percentage is by mass. Then, 200 μL was added to each well of a 96-well cell culture plate and placed in a 5% CO 2 2, 37°C incubator, where the percentage is by volume. 7 - 10 days later, the supernatant of the cell fusion plate was screened by ELISA (coated with CD40 protein). The positive selection clone plates with OD450nm > 0.4 in ELISA were supplemented with 100 μL of 400 mL of DMEM medium containing 20% fetal bovine serum from Australia and 1×HT (purchased from Gibco) and cultured overnight in a 5% CO 2 2, 37°C incubator. The next day, the positive selection clones were re-screened by ELISA (coated with CD40 protein).

[0184] According to the screening results of the re-screening, the double-positive hybridoma cells were selected and subcloned in a 96-well plate using the gradient dilution method. In DMEM medium containing 15% fetal bovine serum from Australia, in a 5% CO 2 2, 37°C incubator. 7 - 10 days after subcloning, screening was performed by ELISA (coated with CD40 protein) to select single double-positive positive selection monoclonal clones. 1 - 2 rounds of subcloning were continued.

[0185] After the third round of subcloning, the optimal monoclonal clone was selected and expanded in DMEM medium containing 15% fetal bovine serum from Australia in a 5% CO 2 2, 37°C incubator, and cryopreserved in liquid nitrogen to obtain the hybridoma cells of the present invention, which can be used for subsequent antibody production and purification.

[0186] Example 2 Expression and Purification of Anti-CD40 Monoclonal Antibody Ascites

[0187] Purchase Balb / C mice at 6 - 8 weeks old and raise them under SPF conditions. Pretreat the mice with liquid paraffin (purchased from Xilong Scientific) one week in advance. Inject two mice pretreated with the sensitizer with each strain of cells, and inject 0.5 - 1×10 6 The hybridoma cells obtained in Example 1. Start closely observing the ascites growth and health status of the mice around the 6th day after injection. When there is obvious mobile ascites in the mouse abdomen, start collecting the ascites. Wipe the injection site with an alcohol cotton ball (about 0.5 - 1 cm away from the right hind limb), and then insert a 12 - gauge syringe needle (purchased from KDL) into the mouse abdomen. Due to the pressure in the mouse abdomen, the ascites will flow out along the needle, and the outflowing ascites is collected with a 50 mL centrifuge tube (purchased from NEST). Immediately centrifuge the collected ascites at 4500 rpm for 5 minutes, take the supernatant, and store it in a -20℃ refrigerator. Collect it about once every two days, and about 5 mL can be collected from each mouse under normal circumstances.

[0188] Purify the hybridoma ascites with a 1 mL protein A gravity column. Equilibrate the protein A column with 5 column volumes of equilibration buffer (PBS phosphate buffer, pH 7.2, purchased from Solarbio). Take out 2 mL of the mouse ascites to be purified after thawing, centrifuge at 10000 rpm / min for 15 min, and then filter the supernatant through a 0.22 μm filter. After the column is equilibrated, load the ascites supernatant onto the protein A column. After loading, wash the protein A column with the equilibration buffer, and the equilibration buffer is 4 protein A column volumes. Elute the antibody bound to the protein A column with the eluent (0.1 M citric acid buffer, pH 3.0). Collect the eluted antibody, add 15% of 2 M Tris - HCl buffer (pH 8.0) to neutralize the pH, and the percentage is by volume. Then ultrafilter the eluent with a 30 KD ultrafiltration tube to replace the liquid, about 5 times in total. Collect the replaced antibody and store it at -80℃. Detect the protein concentration (Nanodrop), purity and subtype of the purified antibody, and the results are shown in Table 1.

[0189] Table 1

[0190] Antibody Number Subtype Purity Antibody Number Subtype Purity 1# IgG1 >90％ 23# IgG1 >90％ 2# IgG1 >90％ 24# IgG1 >90％ 3# IgA >90％ 25# IgA >90％ 4# IgG1 >90％ 26# IgG1 >90％ 5# IgG1 >90％ 27# IgG1 >90％ 6# IgG1 >90％ 28# IgG1 >90％ 7# IgG1 >90％ 29# IgG1 >90％ 8# IgG1 >90％ 30# IgG1 >90％ 9# IgG1 >90％ 31# IgG1 >90％ 10# IgG1 >90％ 32# IgG1 >90％ 11# IgG1 >90％ 33# IgG1 >90％ 12# IgG1 >90％ 34# IgG1 >90％ 13# IgG1 >90％ 35# IgG1 >90％ 14# IgG1 >90％ 36# IgG1 >90％ 15# IgG1 >90％ 37# IgG1 >90％ 16# IgG1 >90％ 38# Ig2a >90％ 17# Ig2b >90％ 39# IgG1 >90％ 18# IgG1 >90％ 40# IgG1 >90％ 19# IgG1 >90％ 41# IgG1 >90％ 20# IgG1 >90％ 42# IgG1 >90％ 21# IgA >90％ 43# IgG1 >90％ 22# IgG1 >90％ 44# IgG1 >90％

[0191] Example 3 Determination of the sequence of the anti - CD40 monoclonal antibody and recombinant expression

[0192] After detecting the antigen - antibody binding in the subcloning culture supernatant in Example 1, collect 1x10 5 -1x10 6 hybridoma cells by centrifugation, add 1 mL of Trizol and mix well. Freeze the sample at -80℃ or directly proceed with the following sequencing steps.

[0193] RNA Extraction: Take 0.5 mL to 1.5 mL of the Trizol sample and transfer it to a centrifuge tube. Add 100 μL of chloroform to each tube. Vigorously shake it on a shaker for 15 seconds and then let it stand at room temperature for 5 minutes. Pre-cool the centrifuge to 4°C and centrifuge the above samples at 12,000 g for 15 minutes. After centrifugation, layering occurs. Carefully transfer the top transparent layer to a new 1.5 mL centrifuge tube free of RNase and DNase using a pipette. Add 250 μL of isopropanol to each tube, mix well by inverting up and down multiple times and then let it stand at room temperature for 10 minutes. Centrifuge at 12,000 g for 10 minutes in a pre-cooled centrifuge at 4°C, remove the supernatant and retain the precipitate. Add 1 mL of 75% ethanol to each tube and invert up and down multiple times to suspend the precipitate. Centrifuge at 7,500 g for 5 minutes in a pre-cooled centrifuge at 4°C, remove the supernatant and retain the precipitate. Keep the centrifuge tube opening open and let it dry at room temperature for 5 minutes. Then add 10 μL of DEPC-treated water to each tube to dissolve it and incubate at 55°C for 10 minutes to ensure complete dissolution of the RNA. Centrifuge at 7,500 g for 5 minutes in a pre-cooled centrifuge at 4°C and carefully aspirate the supernatant into the same centrifuge tube to obtain the total RNA. Take 1 μL of the above total RNA for 1% agarose gel electrophoresis to detect the integrity of the total RNA, and at the same time take 2 μL to detect the concentration of the RNA using a nucleic acid concentration meter.

[0194] Reverse Transcription and PCR: Use the total RNA immediately after extraction A 1st strand cDNA kit (purchased from Takara) is used for reverse transcription to reduce RNA degradation. Configure the reaction solution in a 1.5 mL centrifuge tube using the Oligo dT Primer in the kit as the primer according to the ratio in Table 2 below.

[0195] Table 2

[0196] Reagent Usage Amount Oligo dT Primer(50μM) 1μL dNTP Mix 1μL Total RNA 5μg <![CDATA[ddH 2 O]]> Up to 10μL

[0197] Put the centrifuge tube containing the above reaction solution into a metal heater and react at 65°C for 5 minutes. After the reaction, quickly cool it on ice. Configure the reaction solution in the above 1.5 mL centrifuge tube according to the ratio in Table 3 below.

[0198] Table 3

[0199] Reagent Usage Amount Previous Reaction Solution 10μL 5×PrimeScript II Buffer 4μL RNase Inhibitor 0.5μL PrimeScript II RTase 1μL <![CDATA[ddH 2 O]]> Up to 20μL

[0200] After slow mixing, the centrifuge tube containing the above reaction solution was placed in a metal heater and reacted at 45 °C for 60 minutes, then reacted at 75 °C for 15 minutes, and cooled on ice to obtain cDNA after reverse transcription of total RNA. The obtained cDNA was used as a template for two PCR reactions to amplify the light chain and heavy chain respectively. For the heavy chain, MH1 (ctt ccg gaa ttc SAR GTN MAG CTG SAGSAG TC, SEQ ID NO: 265) and IgG1 (gga aga tct ATA GAC AGA TGG GGG TGT CGT TTT GGC, SEQ ID NO: 266) were used as primers. For the light chain, Kc (ggt gca tgc GGA TAC AGT TGG TGC AGCATC, SEQ ID NO: 267) and Mk (gg gag ctc GAY ATT GTG MTS ACM CAR WCT MCA, SEQ ID NO: 268) were used as primers. The PCR reaction system was configured according to Table 4 below. Among them, in the said primers, S is c or g; R is a or g; N is a, c, g or t; M is a or c; Y is c or t; W is a or t.

[0201] Table 4

[0202] Reagent Usage Amount Obtained cDNA 2μL Forward Primer / Reverse Primer(10μM) 2μL / 2μL dNTP Mix 4μL 10×ExTaq Buffer 5μL HS Ex Taq 0.25μL <![CDATA[ddH 2 O]]> Up to 50μL

[0203] After configuration, the PCR reaction was configured and carried out according to Table 5 below:

[0204] Table 5

[0205]

[0206] After the reaction was completed, 2 μL of the PCR product was taken for 1% agarose gel electrophoresis to determine whether the amplification was successful. For those with obvious amplification bands, the PCR reaction solution was recovered using a DNA recovery reagent (purchased from Tiangen) to obtain the amplified fragment.

[0207] Cloning and sequencing: The amplified bands of the light and heavy chains obtained after purification were respectively used with pMD TMTA cloning was performed using the 19-T Vector Cloning Kit (purchased from Takara). 2.5 μL of Solution I in the kit was mixed with 0.5 μL of the purified fragment, 0.5 μL of pMD T vector, and 1.5 μL of sterile water, and incubated at 4°C for 30 minutes. One tube of DH5α competent cells (purchased from Kangti Life) was taken, allowed to stand on ice for 10 minutes, and then the above-mentioned mixed solution was added. After continuing to stand on ice for 30 minutes, it was heat-shocked in a 42°C water bath for 1 minute, quickly placed on ice, 1 mL of LB liquid medium was added, and cultured with shaking at 37°C and 220 rpm for 1 h. Then it was plated on a solid LB plate containing 50 μg / mL carbenicillin and cultured overnight until monoclonal bacteria grew. Three monoclonal colonies were picked and sent for sequencing. Sequencing was performed using the pMD19 T sequencing primer GAGCGGATAACAATTTCACACAGG (SEQ ID NO: 269) to obtain the heavy and light chain DNA sequences, and then the antibody amino acid sequence was obtained. The results are shown in Table 6 below.

[0208] Recombinant expression: 1) Cell preparation: Thaw and resuscitate the 293F cells used, and perform suspension culture in a 37°C 5% CO 2 incubator. The shaking speed of the shaker is adjusted according to the model of the shaker (about 85 - 120 rpm). At the same time, monitor the cell growth situation. When the cell density reaches 4 - 6×10 6 cells / mL and the viability is over 95%, subculture is carried out; generally, the freshly resuscitated cells need to be subcultured 2 - 3 times before being used for expression. The subculture density is 0.6×10 6 cultured for 3 days, 0.3×10 6 cultured for 4 days, and the specific situation is appropriately adjusted according to your own cells and needs. The expression density is generally 2×10 6 cells / mL and the viability > 95%. 2) Expression: Taking a 25 mL transfection system as an example, prepare 2 sterile 15 mL centrifuge tubes. In tube 1, add 1 mL of transfection buffer and 25 μg of plasmid (the transfection buffer can be the culture medium or a special transfection buffer purchased). In tube 2, add 1 mL of transfection buffer and 125 μL of transfection reagent (PEI). Mix the solutions in the two centrifuge tubes and let stand at room temperature for 10 min. Then slowly add the mixed solution to the prepared cells (2×10 6Cell viability > 95% (cells / mL); and place the cells in an incubator for culturing (the incubator parameters are the same as above). After culturing for 24 h, add the feed, and add 0.25 mL of the feed with a concentration of 100×. (Note: The final concentration of the plasmid is 1 μg / mL, and the mass ratio of the plasmid to the transfection reagent is 1:3 - 1:6). 3) Detection of expression level: After culturing for 5 - 7 days, SDS-PAGE can be used for gel electrophoresis to check the expression level. 4) After the expression ends, centrifuge it at 10000 rpm / min and filter it with a 0.22 μm filter membrane; 5) Perform subsequent purification work. If not purified, freeze it in an -80°C refrigerator.

[0209] Antibody purification: Purify with a 1 mL protein A gravity column. The protein A column is equilibrated with 5 column volumes of equilibration buffer (PBS phosphate buffer, pH 7.2, purchased from Solarbio). Centrifuge the expression supernatant to be purified at 12000 rpm for 30 min, carefully aspirate the supernatant and filter it with a 0.22 μm filter membrane. After the column is equilibrated, load the ascites supernatant onto the protein A column. After loading, wash the protein A column with the equilibration buffer, and the equilibration buffer is 4 column volumes of the protein A column. Elute the antibody bound to the protein A column with the elution buffer (0.1 M citric acid buffer, pH 3.0). Collect the eluted antibody, add 15% of 2 M Tris-HCl buffer (pH 8.0) to neutralize the pH, and the percentage is by volume. Then ultrafilter the elution buffer with a 30 KD ultrafiltration tube to replace the liquid, and replace it about 5 times. Collect the antibody after replacement and store it at -80°C. Detect the protein concentration (Nanodrop) and purity of the purified antibody.

[0210] Table 6

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] Example 4 ELISA determination of the binding ability of anti-CD40 monoclonal antibody

[0219] The purified antibody from Example 3 was detected for its binding to human CD40 (purchased from ACRO, catalog number CD0-H5253), mouse CD40 (purchased from ACRO, catalog number TN5-M525H8), and monkey CD40 (purchased from ACRO, catalog number CD0-C52H6) by ELISA method. And APX005M (a human monoclonal antibody against CD40 from US2018 / 0327496A1) was used as a positive control, and isotype control (a human monoclonal antibody against Siglec-15 from US2019 / 0202912A1) was used as a negative control. 100 μl of 0.1 μg / ml human, mouse, and monkey CD40 were respectively coated onto ELISA plates (purchased from NEST) and incubated overnight in a 4°C refrigerator. The next day, 150 μl of blocking solution was added to each well and incubated in a 37°C incubator for 1.5 hours. Subsequently, 100 μl of 5 μg / ml CD40 antibody was added to each well and incubated at 37°C for 1 hour. After 1 hour, 100 μl of anti-mouse enzyme-labeled secondary antibody (purchased from Jackson) was added to each well and incubated at 37°C for 1 hour. After incubation, it was washed 4 times with PBST (purchased from Solarbio) and patted dry. 100 μl of single-component TMB chromogenic solution (purchased from Solarbio) was added to each well and developed at room temperature for 5 - 10 minutes. Finally, 50 μl of stop solution (purchased from Solarbio) was added to each well to terminate the reaction, and the OD450 was measured by a detector. The results are as Figures 2 - 4 shown. The results indicate that monoclonal antibodies 1#, 5#, 7#, 9#, 11#, 13#, 14#, 17#, 18#, 22#, 26#, 27#, 30#, 33#, 36#, 37#, 38#, 39#, 41#, 43# can bind to human CD40, 1#, 5#, 7#, 9#, 11#, 17#, 36#, 43# can bind to mouse CD40, and 1#, 5#, 7#, 9#, 11#, 13#, 14#, 17#, 18#, 22#, 26#, 27#, 30#, 33#, 36#, 37#, 38#, 39#, 43# can bind to monkey CD40.

[0220] Example 5 ELISA determination of the blocking ability of anti-CD40 mouse monoclonal CD40 / CD40L

[0221] The purified antibody from Example 3 was detected by ELISA to determine its ability to block the binding of human CD40 (purchased from ACRO, catalog number CD0-H5253) and CD40L (purchased from ACRO, catalog number CDL-H52DB). 100 μl of 0.1 μg / ml human CD40 was coated onto an ELISA plate (purchased from NEST) and incubated overnight in a 4°C refrigerator. The next day, 150 μl of blocking solution was added to each well and incubated in a 37°C incubator for 1.5 hours. Subsequently, 100 μl of 5 μg / ml CD40 antibody was added to each well and incubated at 37°C for 1 hour. After 1 hour, 100 μl of His-tagged CD40L was added to each well and incubated at room temperature for 1 hour. Then, an anti-His enzyme-labeled secondary antibody (purchased from Jackson) was added and incubated at 37°C for 1 hour. After incubation, the plate was washed 4 times with PBST (purchased from Solarbio) and patted dry. 100 μl of single-component TMB chromogenic solution (purchased from Solarbio) was added to each well and allowed to develop color at room temperature for 5 - 10 minutes. Finally, 50 μl of stop solution (purchased from Solarbio) was added to each well to terminate the reaction, and the OD450 was measured using a microplate reader. The results are as Figure 5 shown. Wells 1#, 5#, 7#, 9#, 11#, 13#, 14#, 17#, 18#, 22#, 26#, 27#, 30#, 33#, 36#, 37#, 38#, 39#, 41#, and 43# were able to effectively block the interaction between CD40 and CD40L.

[0222] Example 6 Jurkat-hCD40 Reporter Cell Activation Assay

[0223] Jurkat cells (purchased from ATCC) were transfected with the human CD40 gene (plasmid purchased from Vazyme Biotech), NF-κB Luc luciferase reporter gene (plasmid purchased from Yeasen), the human CD40 gene (plasmid purchased from Vazyme Biotech), and the NF-κB Luc luciferase reporter gene (plasmid purchased from Yeasen) using lentivirus to construct Jurkat-hCD40, Jurkat-Luc-NFkB, and Jurkat-hCD40-Luc-NFkB cell lines respectively. The cells were grown and cultured in RPMI 1640 medium (purchased from Gibco) supplemented with 10% FBS (purchased from Gibco) and 1% penicillin-streptomycin mixed antibiotics (purchased from Solarbio) at 37°C in a 5% carbon dioxide incubator until they reached an appropriate density. The purified antibody from Example 3 was diluted to 3000 nM and filtered using a 0.22 μm filter. The cultured Jurkat-hCD40-Luc-NFkB cells were collected by centrifugation and resuspended in medium to a concentration of 2.5×10 5 / mL. Add 100 μL to each well of a 96-well plate. At the same time, use Jurkat-hCD40 and Jurkat-Luc-NFkB with the same number of cells in parallel without adding antibodies as controls. Perform 10-fold serial dilutions of the antibodies for a total of 6 dilution steps, and add 50 μL of the diluted antibody to each well. After incubating in a 37 °C incubator for 7 h, add 50 μL of the mixed One-Glo reagent (purchased from Promega) to each well. Read the luminescence signal after incubating at room temperature for 5 minutes. Exemplary results are as Figure 6 shown. Antibodies #26, #33, #36, and #39 can act as agonists to activate CD40, thereby activating the NFkB signaling pathway in T cells.

[0224] Example 7 Mixed Lymphocyte Reaction Assay

[0225] Human peripheral blood mononuclear cells (PMBCs) (purchased from Aoneng Biotech) isolated and induced dendritic cells (DCs) and CD4 + T cells were taken out from the liquid nitrogen tank and thawed in a 37 °C water bath for 1 - 2 minutes; the thawed cells were transferred to a 15 mL centrifuge tube, and 5 mL of RPMI 1640 medium (RPMI 1640 + 10% FBS + 1% P / S) was added to each cell tube. After centrifuging the cells at 1000 × g, 25 °C for 5 minutes, the supernatant was removed, 1 mL of RPMI 1640 medium was added to resuspend the cells, 15 μL of the cells were taken into a 1.5 mL tube, 5 μL of 0.4% trypan blue staining agent was added, and the cell count and viability were calculated after incubating at room temperature for 3 minutes; Mitomycin C (50 μg / mL, Sigma) was added to the DCs, and after treating at 37 °C for 20 minutes, they were washed three times with 10 mL of 1640 medium; according to the calculated cell density, 10,000 DCs and 100,000 CD4 + T cells were added to each well of a 96-well plate, and at the same time, the purified antibody from Example 3 after dilution was added to each well; the content of the cytokine IFNγ was measured after culturing at 37 °C for 5 days. Exemplary results are as Figure 7 shown. Antibodies #13 and #39 can enhance the activation of T cells by DCs.

[0226] Example 8 Construction and Expression of Anti-CD40 & Anti-PD1 Bispecific Antibodies

[0227] In this example, two bispecific antibodies were designed and constructed, as Figure 8As shown, CD40-IgG-PD1-scFv consists of a full-length IgG antibody against CD40, which is connected to a single-chain antibody against PD1 through a linker (GGGSGGGSGGGS, SEQ ID NO: 270). PD1-IgG-CD40-scFv consists of a full-length IgG antibody against PD1, which is connected to a single-chain antibody against CD40 through a linker (GGGSGGGSGGGS, SEQ ID NO: 270). The Fc of the bispecific antibody is derived from the Fc of human IgG1 and contains the S267E mutation.

[0228] Taking the #39 antibody as an example, the full-length and single-chain antibody heavy and light chains against CD40 in the bispecific antibody are derived from the #39 antibody, and the full-length and single-chain antibodies against PD1 are derived from nivolumab (niv) or pimivalimab (pimi). Thus, the bispecific antibodies CD40-IgG-PD1-scFv h39-niv and h39-pimi and the bispecific antibodies PD1-IgG-CD40-scFv Niv-h39 and Pim-h39 are constructed.

[0229] The heavy and light chain sequences encoding the designed bispecific antibody are cloned into the pcDNA3.4 expression vector and co-transfected into 293F cells at a 1:1 molar ratio. After 5 days of culture, the cell supernatant is collected, preliminarily purified through a protein A affinity column, and then separated and purified through a molecular sieve to obtain the bispecific antibody.

[0230] Among them, the sequences of the heavy chain variable region and light chain variable region of nivolumab and pimivalimab and their CDR sequences are shown in Table 7 and Table 8 below.

[0231] Table 7

[0232]

[0233]

[0234] Table 8

[0235]

[0236] Example 9 Affinity Determination of Anti-CD40 & Anti-PD1 Bispecific Antibody

[0237] The purified bispecific antibody from Example 8 was detected for its binding to human CD40 by ELISA. 100 μL of 0.1 μg / mL CD40 (purchased from ACRO, catalog number CD0-H5253) was respectively coated onto ELISA plates (purchased from NEST) and incubated overnight in a 4 °C refrigerator. The next day, 150 μL of blocking solution was added to each well and incubated in a 37 °C incubator for 1.5 hours. Subsequently, 100 μL of 5 μg / mL Tau antibody was added to each well and incubated at 37 °C for 1 hour. After 1 hour, 100 μL of anti-human enzyme-labeled secondary antibody (purchased from Jackson) was added to each well and incubated at 37 °C for 1 hour. After incubation, it was washed 4 times with PBST (purchased from Solarbio) and patted dry. 100 μL of single-component TMB chromogenic solution (purchased from Solarbio) was added to each well and developed color at room temperature for 5 - 10 minutes. Finally, 50 μL of stop solution (purchased from Solarbio) was added to each well to terminate the reaction, and the OD450 was measured on a detector.

[0238] The results showed that the bispecific antibodies of the present invention all showed binding to antigens hCD40 and hPD1, and the measured binding constant Kd was below the nanomolar level. Among them, Figure 9 exemplarily showed the binding of bispecific antibodies h39-niv, h39-pimi, Niv-h39, and Pim-h39 to antigens hCD40 and hPD1.

[0239] Example 10 Jurkat-hCD40 Reporter Cell Activation Assay of Anti-CD40 & Anti-PD1 Bispecific Antibodies

[0240] Jurkat-hCD40-Luc-NFkB cells were grown and cultured in RPMI1640 (purchased from Gibco) medium supplemented with 10% FBS (purchased from Gibco) and 1% penicillin-streptomycin mixed antibiotics (purchased from Solarbio) at 37 °C and 5% carbon dioxide until an appropriate density. The antibody purified in Example 8 was diluted to 3000 nM and filtered using a 0.22 μm filter. After centrifuging and collecting the cultured Jurkat cells, the cells were resuspended in the medium to 2.5×10 5 / mL, and 100 μL was added to each well in a 96-well plate. The antibody was serially diluted 10-fold for a total of 6 dilution steps, and 50 μL of the diluted antibody was added to each well. After incubating in a 37 °C incubator for 7 h, 50 μL of the mixed One-Glo reagent (purchased from Promega) was added to each well, and the luminescence signal was read after incubating at room temperature for 5 minutes.

[0241] The results showed that the bispecific antibodies of the present invention were all able to act as agonists to activate CD40, thereby activating the NFkB signaling pathway in T cells. Among them, Figure 10Exemplarily, it is shown that bispecific antibodies h39-niv, h39-pimi, Niv-h39, and Pim-h39 can activate CD40, thereby activating the NFkB signaling pathway in T cells.

[0242] Example 11 Affinity ELISA Assay of Humanized Antibodies

[0243] Using the light chain variable region and heavy chain variable region of the #39 antibody as templates, humanization design was carried out to obtain 5 pairs of humanized antibodies H1-H5, and the sequences are shown in Table 9 below.

[0244] The purified bispecific antibody was detected for its binding to human CD40 by ELISA. 100 μL of 0.1 μg / mL CD40 (purchased from ACRO, product number CD0-H5253) was coated onto ELISA plates (purchased from NEST) respectively and left overnight in a 4°C refrigerator. The next day, 150 μL of blocking solution was added to each well and incubated in a 37°C incubator for 1.5 hours. Subsequently, 100 μL of the antibody to be tested at 5 μg / mL was added to each well and incubated at 37°C for 1 hour. After 1 hour, 100 μL of anti-human enzyme-labeled secondary antibody (purchased from Jackson) was added to each well and incubated at 37°C for 1 hour. After incubation, it was washed 4 times with PBST (purchased from Solarbio) and patted dry. 100 μL of single-component TMB chromogenic solution (purchased from Solarbio) was added to each well and developed at room temperature for 5 - 10 minutes. Finally, 50 μL of stop solution (purchased from Solarbio) was added to each well to terminate the reaction, and the OD450 was measured by a detector.

[0245] Figure 11 The EC50 results in Table 9 show that the affinity of the humanized antibody of the present invention for the antigen CD40 is comparable to that of the parental antibody.

[0246] Table 9

[0247]

[0248] Example 12 Jurkat-hCD40 Reporter Cell Activation Assay of Humanized Antibodies

[0249] Jurkat-hCD40, Jurkat-Luc-NFkB, and Jurkat-hCD40-Luc-NFkB cells were grown and cultured in a medium to an appropriate density. The antibody was diluted to 3000 nM and filtered using a 0.22 μm filter. After centrifuging and collecting the cultured Jurkat cells, the cells were resuspended in the medium to 2.5×10 5 / mL, and 100 μL was added to each well of a 96-well plate. The humanized antibody obtained in Example 11 was serially diluted 10-fold for a total of 6 dilutions, and 50 μL of the diluted antibody was added to each well. After incubation in a 37 °C incubator for 7 h, 50 μL of the mixed One-Glo reagent (purchased from Promega) was added to each well, and the luminescence signal was read after incubation at room temperature for 5 minutes.

[0250] Figure 12 The results showed that the humanized antibodies of the present invention could all act as agonists to activate CD40, thereby activating the NFkB signaling pathway in T cells.

[0251] Example 13 Construction and Expression of Humanized Anti-CD40 & Anti-PD1 Bispecific Antibody

[0252] In this example, a bispecific antibody was designed and constructed, which comprised a full-length IgG antibody against PD1, connected by a linker portion to a single-chain antibody against CD40. The Fc of the bispecific antibody was derived from the Fc of human IgG4.

[0253] Taking the humanized antibody of the #39 antibody as an example, the full-length anti-CD40 and the light and heavy chains of the single-chain antibody in the bispecific antibody were derived from the #39 humanized antibody H4 screened in the foregoing example, and the full-length anti-PD1 and the single-chain antibody were derived from nivolumab. Thus, the bispecific antibody Niv-H4 was constructed. The light and heavy chain sequences encoding the designed bispecific antibody were cloned into the pcDNA3.4 expression vector and co-transfected into 293F cells at a molar ratio of 1:1. After 5 days of culture, the cell supernatant was collected, preliminarily purified through a Protein A affinity column, and then further purified through size exclusion chromatography to obtain the bispecific antibody.

[0254] Example 14 Affinity ELISA Assay of Humanized Anti-CD40 & Anti-PD1 Bispecific Antibody

[0255] The purified bispecific antibody of Example 13 was detected for its binding to human CD40 and PD1 by ELISA. 100 μL of 0.1 μg / mL CD40 (purchased from ACRO, catalog number CD0-H5253) and PD1 (purchased from ACRO, catalog number PD1-H5258) were respectively coated onto ELISA plates (purchased from NEST) and left overnight in a 4 °C refrigerator. The next day, 150 μL of blocking solution was added to each well and incubated in a 37 °C incubator for 1.5 hours. Subsequently, 100 μL of the antibody to be tested at 5 μg / mL was added to each well and incubated at 37 °C for 1 hour. After 1 hour, 100 μL of anti-human enzyme-labeled secondary antibody (purchased from Jackson) was added to each well and incubated at 37 °C for 1 hour. After incubation, it was washed 4 times with PBST (purchased from Solarbio) and patted dry. 100 μL of single-component TMB chromogenic solution (purchased from Solarbio) was added to each well and developed color at room temperature for 5 - 10 minutes. Finally, 50 μL of stop solution (purchased from Solarbio) was added to each well to terminate the reaction, and the OD450 was measured by a detector.

[0256] Figure 13 The results showed that the bispecific antibody of the present invention had an affinity for antigens CD40 and PD1 reaching the nM level.

[0257] Example 15 Jurkat-hCD40 Reporter Cell Activation Assay of Humanized Anti-CD40 & Anti-PD1 Bispecific Antibody

[0258] Jurkat-hCD40, Jurkat-Luc-NFkB, and Jurkat-hCD40-Luc-NFkB cells were grown and cultured in a medium to an appropriate density. The antibody was diluted to 3000 nM and filtered using a 0.22 μm filter. After centrifuging and collecting the cultured Jurkat cells, the cells were resuspended in the medium to 2.5×10 5 / mL, and 100 μL was added to each well of a 96-well plate. The bispecific antibody obtained in Example 13 was serially diluted 10-fold for a total of 6 dilution steps, and 50 μL of the diluted antibody was added to each well. After incubating in a 37 °C incubator for 7 h, 50 μL of the mixed One-Glo reagent (purchased from Promega) was added to each well, and the luminescence signal was read after incubating at room temperature for 5 minutes.

[0259] Figure 14 The results showed that the bispecific antibody of the present invention could act as an agonist to activate CD40 and thus activate the NFkB signaling pathway in T cells.

[0260] Example 16 Mixed Lymphocyte Reaction Assay of Humanized Anti-CD40 & Anti-PD1 Bispecific Antibody

[0261] Take out the DCs and CD4+ T cells induced by PMBC separation from the liquid nitrogen tank and thaw them in a 37°C water bath for 1 - 2 minutes; transfer the thawed cells to a 15 mL centrifuge tube, and add 5 mL of RPMI 1640 medium (RPMI1640 + 10% FBS + 1% P / S) to each cell tube. After centrifuging the cells at 1000×g, 25°C for 5 minutes, remove the supernatant, add 1 mL of RPMI1640 medium to resuspend the cells, take 15 μL of the cells into a 1.5 mL tube, add 5 μL of 0.4% trypan blue staining agent, and incubate at room temperature for 3 minutes, then calculate the cell number and viability; add mitomycin C (50 μg / mL, Sigma) to the DCs, and after treating at 37°C for 20 minutes, wash three times with 10 mL of 1640 medium; according to the calculated cell density, add 10,000 DCs and 100,000 CD4 + T cells to each well of a 96-well plate, and at the same time add the diluted bispecific antibody obtained in Example 13 to each well; measure the content of the cytokine IFNγ after culturing at 37°C for 5 days.

[0262] Figure 15 The results show that the bispecific antibody of the present invention can stimulate T cells to produce IFNγ, indicating that it can enhance the activation of DCs on T cells in a dose-dependent manner.

[0263] Example 17 Pharmacokinetic (PK) Experiment of Humanized Anti-CD40 & Anti-PD1 Bispecific Antibody in Mice

[0264] Determine the pharmacokinetic (PK) parameters of the bispecific antibody obtained in Example 13 in C57BL mice.

[0265] Select 24 healthy 8-week-old C57BL female mice, weigh them and divide them evenly into 6 groups. Group 1 was injected with 2 mg / kg of bispecific antibody Niv-H4 via the tail vein, Group 2 was injected with 13 mg / kg of bispecific antibody Niv-H4 via the tail vein, Group 3 was injected with 2 mg / kg of bispecific antibody Niv-H4 via the abdominal cavity, Group 4 was injected with 13 mg / kg of bispecific antibody via the abdominal cavity, Group 5 was used as a control and injected with PBS via the tail vein, and Group 6 was injected with PBS via the abdominal cavity. After administration in all groups, 3 drops of about 100 μL of blood were taken from the mouse orbital cavity at 10 minutes, 30 minutes, 2 hours, 7 hours, 24 hours, 2 days, 3 days, 5 days, 7 days, 10 days, 14 days, 21 days, and 28 days. The bispecific antibody Niv-H4 was quantified by sandwich ELISA to obtain the antibody concentration in the mouse serum at different time points. The results are as Figure 16 shown, and the concentrations of the bispecific antibody Niv-H4 in both Group 5 and Group 6 of the control group were lower than the lower limit of measurement.

[0266] The pharmacokinetic (PK) parameters of Niv-H4 in animals were obtained by fitting the antibody concentration using NCA in Pheonix as shown in Table 10. The experimental results showed that the half-life of the anti-CD40 & anti-PD1 bispecific antibody Niv-H4 in mice was 3-5 days, and the pharmacokinetic parameters were similar to those of other monoclonal antibodies (Clinical Pharmacokinetics, 58(7), 835–857.).

[0267] Table 10

[0268]

[0269] Example 18 Inhibition of Tumor Growth in Mice by Anti-CD40 & Anti-PD1 Bispecific Antibody

[0270] In this example, the tumor inhibitory effect of the bispecific antibody Niv-H4 obtained in Example 13 in mice was detected.

[0271] 10 CD40 / PD1 human knockout C57BL mice (purchased from Model Animal Research Center) were weighed and intraperitoneally implanted with 1 million stably transfected human hPD-L1 MC38 cells (purchased from Model Animal Research Center). On the 9th day, 6 mice with obvious and similarly sized tumors in the abdominal cavity were selected and divided into two groups. On the 9th, 11th, 15th, 18th, 22nd, and 25th days, group 1 (vehicel) was intraperitoneally injected with PBS, and group 2 (Nivh4 10mpk) was intraperitoneally injected with 10 mg / kg of the bispecific antibody Niv-H4. A total of 6 administrations were performed. After the start of administration, the body weight of the mice and the length, width, and depth of the tumors were measured and recorded daily. The tumor volume was calculated as 4 / 3 x 3.14 x depth / 2 x width / 2 x height / 2.

[0272] The changes in tumor size and body weight in the experimental mice were as Figure 17 shown, indicating that the bispecific antibody Niv-H4 could inhibit the growth of MC38 tumors without affecting the body weight of the mice.

[0273] The technical solutions of the present disclosure are not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solutions of the present disclosure falls within the protection scope of the present disclosure.

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds to CD40 and / or a fragment thereof, comprising at least one heavy chain variable region and at least one light chain variable region, The heavy chain variable region comprises: HCDR1 as shown in any one of SEQ ID NOs: 32-62; HCDR2 as shown in any one of SEQ ID NOs: 63-93; and HCDR3 as shown in any one of SEQ ID NOs: 94-124; and / or The light chain variable region comprises: LCDR1 as shown in any one of SEQ ID NOs: 156-186; LCDR2 as shown in any one of SEQ ID NOs: 187-217; and The LCDR3 as shown in any one of SEQ ID NOs: 218-248.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein The heavy chain variable region comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:32, SEQ ID NO:63 and SEQ ID NO:94, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:33, SEQ ID NO:64 and SEQ ID NO:95, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:34, SEQ ID NO:65 and SEQ ID NO:96, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:35, SEQ ID NO:66 and SEQ ID NO:97, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:36, SEQ ID NO:67 and SEQ ID NO:98, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:37, SEQ ID NO:68 and SEQ ID NO:99, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:38, SEQ ID NO:69 and SEQ ID NO:100, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:39, SEQ ID NO:70 and SEQ ID NO:101, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:40, SEQ ID NO:71 and SEQ ID NO:102, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:41, SEQ ID NO:72 and SEQ ID NO:103, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:42, SEQ ID NO:73 and SEQ ID NO:104, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:43, SEQ ID NO:74 and SEQ ID NO:105, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:44, SEQ ID NO:75 and SEQ ID NO:106, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:45, SEQ ID NO:76 and SEQ ID NO:107, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:46, SEQ ID NO:77 and SEQ ID NO:108, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:47, SEQ ID NO:78 and SEQ ID NO:109, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:48, SEQ ID NO:79 and SEQ ID NO:110, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:49, SEQ ID NO:80 and SEQ ID NO:111, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:50, SEQ ID NO:81 and SEQ ID NO:112, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:51, SEQ ID NO:82 and SEQ ID NO:113, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:52, SEQ ID NO:83 and SEQ ID NO:114, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:53, SEQ ID NO:84 and SEQ ID NO:115, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:54, SEQ ID NO:85 and SEQ ID NO:116, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:55, SEQ ID NO:86 and SEQ ID NO:117, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:56, SEQ ID NO:87 and SEQ ID NO:118, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:57, SEQ ID NO:88 and SEQ ID NO:119, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:58, SEQ ID NO:89 and SEQ ID NO:120, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:59, SEQ ID NO:90 and SEQ ID NO:121, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:60, SEQ ID NO:91 and SEQ ID NO:122, respectively; or HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO:61, SEQ ID NO:92 and SEQ ID NO:123, respectively; or HCDR1, HCDR2 and HCDR3 are shown as SEQ ID NO:62, SEQ ID NO:93 and SEQ ID NO:124 respectively.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein The light chain variable region comprises: LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 156, SEQ ID NO: 187 and SEQ ID NO: 218, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 157, SEQ ID NO: 188 and SEQ ID NO: 219, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 158, SEQ ID NO: 189 and SEQ ID NO: 220, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 159, SEQ ID NO: 190 and SEQ ID NO: 221, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 160, SEQ ID NO: 191 and SEQ ID NO: 222, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 161, SEQ ID NO: 192 and SEQ ID NO: 223, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 162, SEQ ID NO: 193 and SEQ ID NO: 224, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 163, SEQ ID NO: 194 and SEQ ID NO: 225, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 164, SEQ ID NO: 195 and SEQ ID NO: 226, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 165, SEQ ID NO: 196 and SEQ ID NO: 227, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 166, SEQ ID NO: 197 and SEQ ID NO: 228, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 167, SEQ ID NO: 198 and SEQ ID NO: 229, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 168, SEQ ID NO: 199 and SEQ ID NO: 230, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 169, SEQ ID NO: 200 and SEQ ID NO: 231, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 170, SEQ ID NO: 201 and SEQ ID NO: 232, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 171, SEQ ID NO: 202 and SEQ ID NO: 233, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 172, SEQ ID NO: 203 and SEQ ID NO: 234, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 173, SEQ ID NO: 204 and SEQ ID NO: 235, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 174, SEQ ID NO: 205 and SEQ ID NO: 236, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 175, SEQ ID NO: 206 and SEQ ID NO: 237, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 176, SEQ ID NO: 207 and SEQ ID NO: 238, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 177, SEQ ID NO: 208 and SEQ ID NO: 239, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 178, SEQ ID NO: 209 and SEQ ID NO: 240, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 179, SEQ ID NO: 210 and SEQ ID NO: 241, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 180, SEQ ID NO: 211 and SEQ ID NO: 242, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 181, SEQ ID NO: 212 and SEQ ID NO: 243, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 182, SEQ ID NO: 213 and SEQ ID NO: 244, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 183, SEQ ID NO: 214 and SEQ ID NO: 245, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 184, SEQ ID NO: 215 and SEQ ID NO: 246, respectively; or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 185, SEQ ID NO: 216 and SEQ ID NO: 247, respectively; or LCDR1, LCDR2 and LCDR3 are shown in SEQ ID NO: 186, SEQ ID NO: 217 and SEQ ID NO: 248 respectively.

4. The antibody or antigen-binding fragment thereof according to claim 1, wherein The heavy chain variable region comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-31, or an amino acid sequence that is at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identical thereto; and / or The light chain variable region comprises the amino acid sequence shown in any one of SEQ ID NOs: 125-155, or an amino acid sequence that is at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identical thereto; Preferably, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 1 and a light chain variable region as shown in SEQ ID NO: 125; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 2 and a light chain variable region as shown in SEQ ID NO: 126; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 3 and a light chain variable region as shown in SEQ ID NO: 127; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 4 and a light chain variable region as shown in SEQ ID NO: 128; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 5 and a light chain variable region as shown in SEQ ID NO: 129; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 6 and a light chain variable region as shown in SEQ ID NO: 130; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 7 and a light chain variable region as shown in SEQ ID NO: 131; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 8 and a light chain variable region as shown in SEQ ID NO: 132; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 9 and a light chain variable region as shown in SEQ ID NO: 133; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 10 and a light chain variable region as shown in SEQ ID NO: 134; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 11 and a light chain variable region as shown in SEQ ID NO: 135; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 12 and a light chain variable region as shown in SEQ ID NO: 136; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 13 and a light chain variable region as shown in SEQ ID NO: 137; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 14 and a light chain variable region as shown in SEQ ID NO: 138; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 15 and a light chain variable region as shown in SEQ ID NO: 139; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 16 and a light chain variable region as shown in SEQ ID NO: 140; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 17 and a light chain variable region as shown in SEQ ID NO: 141; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 18 and a light chain variable region as shown in SEQ ID NO: 142; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 19 and a light chain variable region as shown in SEQ ID NO: 143; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 20 and a light chain variable region as shown in SEQ ID NO: 144; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 21 and a light chain variable region as shown in SEQ ID NO: 145; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 22 and a light chain variable region as shown in SEQ ID NO: 146; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 23 and a light chain variable region as shown in SEQ ID NO: 147; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 24 and a light chain variable region as shown in SEQ ID NO: 148; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 25 and a light chain variable region as shown in SEQ ID NO: 149; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 26 and a light chain variable region as shown in SEQ ID NO: 150; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 27 and a light chain variable region as shown in SEQ ID NO: 151; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 28 and a light chain variable region as shown in SEQ ID NO: 152; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 29 and a light chain variable region as shown in SEQ ID NO: 153; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO: 30 and a light chain variable region as shown in SEQ ID NO: 154; or The antibody or antigen-binding fragment thereof comprises a heavy chain variable region as shown in SEQ ID NO:31 and a light chain variable region as shown in SEQ ID NO:

155.

5. The antibody or antigen-binding fragment thereof according to claim 1, wherein The antibody or antigen-binding fragment thereof is a humanized antibody, Preferably, the antibody or antigen-binding fragment thereof further comprises a heavy chain constant region and / or a light chain constant region; More preferably, the heavy chain constant region is selected from hIgG1, hIgG2, hIgG3 or hIgG4 heavy chain constant region.

6. A chimeric antigen receptor comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the extracellular antigen binding domain comprises the antibody or antigen binding fragment thereof according to any one of claims 1 to 5.

7. A modified immune cell comprising the chimeric antigen receptor according to claim 6.

8. A multispecific antibody comprising two or more antigen-binding domains, wherein one antigen-binding domain comprises the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5.

9. A method for detecting CD40 in a sample, the method comprising the step of detecting CD40 in a sample using the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, Preferably, the sample is whole blood, red blood cell concentrate, platelet concentrate, white blood cell concentrate, tissue, bone marrow aspirate, plasma, serum, cerebrospinal fluid, feces, urine, cultured cells, saliva, oral secretions and / or nasal secretions.

10. A bispecific binding protein comprising a first domain and a second domain, wherein the first domain binds to CD40 or a fragment thereof, and the second domain binds to PD1 or a fragment thereof, wherein: The first domain is the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5.

11. The bispecific binding protein according to claim 10, wherein The first domain and / or the second domain are selected from the form of IgG, Fab, Fab', F(ab')2, Fv or scFv; Preferably, the number of the IgG, Fab, Fab', F(ab')2, Fv or scFv is 1 or more. Preferably, the heavy chain constant region of IgG is human IgG1, human IgG2, human IgG3 or human IgG4 heavy chain constant region.

12. The bispecific binding protein according to claim 10, wherein The first domain is in the form of IgG, the second domain is in the form of IgG, or The first domain is in the form of scFv, the second domain is in the form of scFv, or The first domain is in the form of IgG, and the second domain is in the form of scFv, or The first domain is in the form of scFv and the second domain is in the form of IgG.

13. The bispecific binding protein according to claim 10, wherein The first domain is directly connected to the second domain or connected via a connecting peptide L to form a bispecific binding protein. Preferably, the second domain is linked to the C-terminus or N-terminus of the first domain.

14. The bispecific binding protein according to claim 13, wherein The bispecific binding protein comprises polypeptide chain 1 and polypeptide chain 2, wherein: The polypeptide chain 1 comprises the structure shown in N'-VL1-CL1-C'; the polypeptide chain 2 comprises the structure shown in N'-VH1-CH11-h-CH21-CH31-L-VH2-L-VL2-C'; or The polypeptide chain 1 comprises the structure shown in N'-VL2-CL2-C'; the polypeptide chain 2 comprises the structure shown in N'-VH2-CH12-h-CH22-CH32-L-VH1-L-VL1-C'; Wherein, the VL1 and VH1 are the light chain variable region and the heavy chain variable region of the first domain, respectively, the VL2 and VH2 are the light chain variable region and the heavy chain variable region of the second domain, the h is a hinge region, the L is a connecting peptide, the CL1, CH11, CH21 and CH31 are the light chain constant region and the heavy chain constant region of the first domain, and the CL2, CH12, CH22 and CH32 are the light chain constant region and the heavy chain constant region of the first domain; Preferably, the connecting peptide is a peptide with a length of 0-30 amino acids; Preferably, the polypeptide chain 1 and the polypeptide chain 2 form a tetravalent structure.

15. The bispecific binding protein according to claim 10, wherein The second domain is selected from an antibody or an antigen-binding fragment thereof of PD1, Preferably, the second domain comprises a light chain variable region VL and a heavy chain variable region VH, Preferably, the second domain comprises HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 250, SEQ ID NO: 251 and SEQ ID NO: 252, respectively, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 254, SEQ ID NO: 255 and SEQ ID NO: 256, respectively; Preferably, the second domain comprises HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 258, SEQ ID NO: 259 and SEQ ID NO: 260, respectively, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 262, SEQ ID NO: 263 and SEQ ID NO: 264, respectively; Preferably, the second domain comprises a heavy chain variable region comprising at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity to the amino acid sequence shown in SEQ ID NO: 249 or 257; Preferably, the second domain comprises a light chain variable region comprising at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% or 100% identity to the amino acid sequence shown in SEQ ID NO: 253 or 261; More preferably, the second domain comprises a heavy chain variable region as shown in SEQ ID NO: 249 and a light chain variable region as shown in SEQ ID NO: 253, or the second domain comprises a heavy chain variable region as shown in SEQ ID NO: 257 and a light chain variable region as shown in SEQ ID NO:

261.

16. A method for detecting CD40 and PD1 in a sample, the method comprising the step of detecting CD40 and PD1 in a sample using a specific binding protein according to any one of claims 10 to 15, Preferably, the sample is whole blood, red blood cell concentrate, platelet concentrate, white blood cell concentrate, tissue, bone marrow aspirate, plasma, serum, cerebrospinal fluid, feces, urine, cultured cells, saliva, oral secretions and / or nasal secretions.

17. An isolated nucleic acid encoding the antibody or antigen-binding fragment thereof according to any one of claims 1-5 or the bispecific binding protein according to any one of claims 10-15.

18. An expression vector comprising the isolated nucleic acid according to claim 17.

19. A host cell comprising the isolated nucleic acid according to claim 17, or the expression vector according to claim 18.

20. An antibody-drug conjugate comprising: an antibody or antigen-binding fragment thereof according to any one of claims 1 to 5 or a bispecific binding protein according to any one of claims 10 to 15; and a drug covalently linked to the antibody or antigen-binding fragment thereof or the bispecific binding protein, Preferably, the drug is selected from chemotherapeutic agents, radiotherapeutic agents, immunosuppressants and cytotoxic drugs.

21. A pharmaceutical composition comprising: an antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, a bispecific binding protein according to any one of claims 10 to 15, or an antibody-drug conjugate according to claim 20; and a pharmaceutically acceptable carrier, Preferably, the pharmaceutical composition further comprises a therapeutic agent selected from chemotherapeutic agents, radiotherapeutic agents, immunosuppressive agents and cytotoxic drugs.

22. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, the bispecific binding protein according to any one of claims 10 to 15, the isolated nucleic acid according to claim 17, the antibody-drug conjugate according to claim 20 or the pharmaceutical composition according to claim 21 in the preparation of a medicament for preventing, treating and / or diagnosing immune diseases, acute and chronic inflammatory diseases, and tumor diseases.

23. The use according to claim 22, wherein: The tumor is one or more of breast cancer, renal cell carcinoma, melanoma, colon cancer, B-cell lymphoma, melanoma, head and neck cancer, bladder cancer, gastric cancer, ovarian cancer, malignant sarcoma, urothelial carcinoma, liver cancer, esophageal cancer, gastroesophageal junction cancer, nasopharyngeal carcinoma, small cell lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, prostate cancer, glioma, non-small cell lung cancer, acute myeloid leukemia, Hodgkin's lymphoma, cutaneous squamous cell carcinoma, locally advanced and metastatic malignant tumors; The inflammatory disease is one or more of atopic dermatitis or ulcerative colitis; The immune disease is one or more of graft-versus-host disease, rheumatoid arthritis, systemic lupus erythematosus or asthma.

24. A kit comprising one or more kits, wherein the kit comprises the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, the bispecific binding protein according to any one of claims 10 to 15, the antibody-drug conjugate according to claim 20, or the pharmaceutical composition according to claim 21; Preferably, the medicine kit comprises a first medicine box and a second medicine box, wherein: The first kit comprises an antibody or antigen-binding fragment thereof according to any one of claims 1-5, a bispecific binding protein according to any one of claims 10-15, an antibody-drug conjugate according to claim 20, or a pharmaceutical composition according to claim 21, and the second kit comprises a therapeutic agent selected from a chemotherapeutic agent, a radiotherapeutic agent, an immunosuppressant, and a cytotoxic drug.

25. A drug delivery device comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, the bispecific binding protein according to any one of claims 10 to 15, the antibody-drug conjugate according to claim 20, or the pharmaceutical composition according to claim 21, Preferably, the drug delivery device is a pre-filled syringe.

26. A method for preventing, treating and / or diagnosing tumor diseases, acute and chronic inflammatory diseases and / or immune diseases, comprising administering to a subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, the bispecific binding protein according to any one of claims 10 to 15, the antibody drug conjugate according to claim 20, or the pharmaceutical composition according to claim 21.

27. The method of claim 26, wherein the tumor is one or more of breast cancer, renal cell carcinoma, melanoma, colon cancer, and B-cell lymphoma, melanoma, head and neck cancer, bladder cancer, gastric cancer, ovarian cancer, malignant sarcoma, urothelial carcinoma, liver cancer, esophageal cancer, gastroesophageal junction cancer, nasopharyngeal carcinoma, small cell lung cancer, cervical cancer, endometrial cancer, pancreatic cancer, prostate cancer, glioma, non-small cell lung cancer, acute myeloid leukemia, Hodgkin's lymphoma, cutaneous squamous cell carcinoma, locally advanced and metastatic malignancies; The inflammatory disease is one or more of atopic dermatitis or ulcerative colitis; The immune disease is one or more of graft-versus-host disease, rheumatoid arthritis, systemic lupus erythematosus or asthma.

28. A detection kit comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5 or the bispecific binding protein according to any one of claims 10 to 15, Preferably, the detection kit further comprises a detectable marker that can be linked to the antibody or the bispecific binding protein, and optionally a substrate corresponding to the detectable marker and / or instructions for use.

Images