A cell wall protein display system based on clostridium difficile and construction and application thereof

Abstract

The present application firstly provides a cell wall anchor protein truncated Cwp66 which significantly improves the expression efficiency of exogenous proteins while retaining the cell wall anchoring function, resulting in unexpected technical effects. On this basis, the present application provides a cell wall protein display system which, when the bottom strain is non-toxic Clostridium difficile, exhibits excellent expression performance and colonization ability in the intestinal anaerobic environment, significantly better than the prior art. Further, the present application also provides a cell surface display system with non-toxic Clostridium difficile as the bottom strain, a recombinant strain displaying effector proteins on the cell wall surface; and its application in anti-tumor. The engineering strain not only realizes the efficient expression and display of effector proteins on the cell wall surface of Clostridium difficile, but also has excellent expression performance and colonization ability in the intestinal anaerobic environment, and can significantly inhibit the growth of tumors in a mouse model, providing a new idea for the treatment of colorectal cancer, and having important social significance and market value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology and microbiology, and relates to a protein drug targeting display vector, in particular to a non-toxic Clostridium difficile as a protein drug display vector and its application in the treatment of colorectal cancer. BACKGROUND

[0002] With the development of scientific research, more and more evidence shows that bacteria can selectively colonize in the core of tumor and grow preferentially in hypoxic and necrotic tumor microenvironments (TMEs). Therefore, synthetic biology tools are used to modify bacteria to be used as a new tumor-specific delivery system. Among them, by targeted modification, microorganisms that can target colonization in lesions are used as protein drug delivery carriers, which is a feasible treatment path. If the engineered bacteria are used as intratumoral drug delivery "biological factories" to continuously produce effective protein drugs, tumor regression and reduced systemic side effects can be achieved. However, how to reduce the virulence of engineered bacteria and how to achieve efficient expression and display of protein drugs are technical problems to be solved in the aforementioned treatment strategy.

[0003] It is well known to those skilled in the art that a bacterial protein display system is a method of using bacteria as a host to express and anchor foreign proteins or polypeptides on the surface of bacteria. Cell surface display of proteins or peptides with specific functions has the following advantages: (1) molecules displayed on the surface of bacteria are freely accessible and directly assembled with target molecules; (2) the aforementioned molecules are more stable than free molecules after being connected to the cell wall matrix; (3) there is no need to prepare or purify the displayed proteins in advance. Based on these advantages, since the mid-1980s, scientists have proposed a phage display system, and a large number of yeast, gram-positive bacteria and gram-negative bacteria display systems have been reported. At present, these systems have been used in biotechnology and industrial applications, and have made great progress in whole-cell biocatalysis, live vaccine development, biosorbent and biosensor development, epitope mapping, antigen delivery, inhibitor design and protein / peptide library screening.

[0004] Clostridioides difficile (C. difficile) is a strict anaerobic, spore-forming, gram-positive bacterium, which is the main pathogen of antibiotic-associated diarrhea. After patients take broad-spectrum antibiotics, the death of antibiotic-sensitive bacteria causes the imbalance of intestinal flora, and C. difficile takes the opportunity to proliferate and secrete toxins, thereby causing C. difficile infection (CDI). CDI often occurs in children and the elderly with relatively low immunity, and the symptoms include abdominal pain, diarrhea, pseudomembranous colitis. The C. difficile toxin gene is encoded by a 19.6 kb pathogenicity locus (PaLoc) gene locus, and determines whether C. difficile has the ability to produce toxins and cause diseases. In the previous research of the inventor's team, the CRISPR (Clustered regularly interspaced short palindromic repeats)-Cpf1 system was used to knock out the full-length of the PaLoc gene locus, and a non-toxic C. difficile strain ΔPaLoc was constructed; the non-toxic C. difficile does not have the pathogenic ability in hamster animal models.

[0005] Although the aforementioned research has disclosed non-toxic C. difficile and reduced its virulence as an engineering bacterium, how to achieve efficient expression and display of protein drugs is still a technical problem to be solved. Currently, there is no related report on using C. difficile as a protein drug display vector. SUMMARY

[0006] To solve the technical problem of efficient expression and display of protein drugs in the prior art, the present application innovatively provides an engineering strain using non-toxic C. difficile as a protein drug display vector. The engineering strain expresses a signal peptide+Cwp66 truncated transmembrane region+effector protein fusion protein through a pMTL82151 plasmid, realizes efficient expression and display of the effector protein on the surface of C. difficile, and produces unexpected technical effects. Moreover, the engineering strain can significantly inhibit the growth of tumors in a mouse model, providing a new idea for the treatment of colorectal cancer and having important practical application value.

[0007] Technical scheme of the present application:

[0008] A cell wall anchor protein truncated Cwp66 for efficiently expressing exogenous proteins, the amino acid sequence of the anchor protein truncated Cwp66 comprises the amino acid sequence as shown in SEQ ID NO: 10. The present application initiatively adopts the truncated Cwp66 protein as a display cell wall anchor protein, which fills the gap in the prior art. In addition, although the Cwp66 protein is a cell wall protein specific to Clostridium difficile, it has excellent cell wall anchoring function, but the inventors unexpectedly found that only by adopting the truncation modification described in the present application, the expression efficiency of exogenous proteins can be significantly improved under the premise of retaining its cell wall anchoring function, thus unexpected technical effects are produced.

[0009] Preferably, the amino acid sequence of the anchor protein is selected from (1), (2) or (3) as follows:

[0010] (1) the amino acid sequence as shown in SEQ ID NO: 1;

[0011] (2) the amino acid sequence as shown in SEQ ID NO: 2;

[0012] (3) the amino acid sequence as shown in SEQ ID NO: 1 or 2 after substitution, deletion or addition of one or several amino acids and capable of anchoring cell wall and efficiently expressing exogenous proteins.

[0013] The nucleotide sequence encoding the anchor protein truncated Cwp66 as described above, the nucleotide sequence is selected from (1), (2) or (3) as follows:

[0014] (1) the nucleotide sequence as shown in SEQ ID NO: 7;

[0015] (2) the nucleotide sequence as shown in SEQ ID NO: 8;

[0016] (3) the nucleotide sequence different from the nucleotide sequence as shown in SEQ ID NO: 7 or 8, but encoding the amino acid sequence as shown in SEQ ID NO: 1 or 2.

[0017] The cell wall protein display system based on the anchor protein as described above, the display system uses non-toxic Clostridium difficile or Escherichia coli as a chassis strain, and introduces plasmid to express signal peptide SPYY66 and anchor protein truncated Cwp66. Among them, the non-toxic Clostridium difficile is Clostridium difficile with PaLoc gene and cwp66 gene knocked out. The plasmid expressing signal peptide SPYY66 has the amino acid sequence as shown in SEQ ID NO: 9. By knocking out the PaLoc gene, the pathogenicity of the strain is significantly reduced, and its safety has been better than that of Escherichia coli in hamster models sensitive to Clostridium difficile.

[0018] In addition, the inventors unexpectedly found that when the chassis strain is avirulent Clostridium difficile, the display system exhibits excellent expression performance and colonization ability in the intestinal anaerobic environment, which is significantly superior to the engineered bacteria in the prior art as protein drug delivery carriers. Therefore, the display system described in the present application not only enables efficient expression of effector proteins, but also makes significant progress in stability and functionality, providing a new idea for the development of drug delivery systems.

[0019] The avirulent Clostridium difficile engineering strain is a recombinant strain in which an effector protein is displayed on the cell wall surface by using the cell surface display system with the avirulent Clostridium difficile as the chassis strain as described above. The effector protein is αPD-L1, IL-18 or other oncolytic proteins. The αPD-L1 and IL-18 displayed on the membrane surface of the Clostridium difficile engineering strain obtained by the present application have a significant oncolytic effect. In an animal model, compared with the ∆Paloc∆cwp66 (avirulent Clostridium difficile) control group, the subcutaneous tumor volume of mice in the ∆Paloc∆cwp66_αPD-L1 experimental group (engineering strain displaying αPD-L1 on the surface) was reduced by 72%, and the subcutaneous tumor volume of mice in the ∆Paloc∆cwp66_IL-18 experimental group (engineering strain displaying IL-18 on the surface) was reduced by 53%. Compared with the PBS control group, the subcutaneous tumor volume of mice in the ∆Paloc∆cwp66_αPD-L1 experimental group was reduced by 84%, and the subcutaneous tumor volume of mice in the ∆Paloc∆cwp66_IL-18 experimental group was reduced by 73%. This fully demonstrates that the avirulent Clostridium difficile engineering strain described in the present application provides a feasible new method for the treatment of colorectal cancer, and has important practical application value and social significance.

[0020] The application of the avirulent Clostridium difficile engineering strain as described above in anti-tumor. The engineering strain not only realizes the efficient expression and display of effector proteins on the cell wall surface of Clostridium difficile, but also has excellent expression performance and colonization ability in the intestinal anaerobic environment, and realizes the precise release of drugs. Under this premise, the oncolytic efficacy of the effector protein itself is fully exerted, so that the engineering strain can significantly inhibit the growth of tumors in a mouse model, providing a new idea for the treatment of colorectal cancer.

[0021] The construction method of the avirulent Clostridium difficile engineering strain as described above comprises the following steps:

[0022] (1) Knock out the virulence island (PaLoc) and cell wall protein cwp66 gene of Clostridium difficile to construct effector protein cell wall display chassis cells. By knocking out the PaLoc locus gene, a non-virulence mutant strain ∆PaLoc was obtained. On this basis, the Cell Wall protein 66 (cwp66) gene was further knocked out to provide more sites for protein display and obtain chassis cells.

[0023] (2) Introduce the promoter, membrane localization signal peptide, anchoring protein truncated Cwp66 and effector protein fusion fragment into the chassis cells described in step (1), and display the effector protein on the cell wall surface of non-toxic Clostridium difficile to obtain a non-toxic Clostridium difficile engineered strain for anti-tumor purposes.

[0024] The beneficial effects of this invention are:

[0025] (1) This application discloses for the first time a truncated Cwp66 protein as a cell wall anchoring protein, filling a gap in the prior art. The anchoring protein significantly improves the expression efficiency of exogenous proteins while retaining its cell wall anchoring function, producing unexpected technical effects.

[0026] (2) This application also provides a cell wall protein display system based on the aforementioned anchoring protein. When the display system uses non-toxic Clostridium difficile as the chassis strain, it not only achieves efficient expression of effector proteins, but also exhibits excellent expression performance and colonization ability in the anaerobic environment of the intestine, thus solving the technical problem of efficient expression and display of protein drugs in the prior art.

[0027] (3) This application also provides an engineered strain based on the aforementioned display system. The engineered strain not only fully utilizes the oncolytic effect of the effector protein itself, but also unexpectedly discovers that the strain itself can inhibit tumor growth (tumor volume is reduced by up to 73%), providing a new approach for the treatment of colorectal cancer and has broad application prospects. Attached Figure Description

[0028] Appendix Figure 1 This is a schematic diagram of the CRISPR-Cpf1 gene editing principle described in Example 1 of the present invention.

[0029] Appendix Figure 2 This is a schematic diagram of the chassis cells for constructing the ∆PaLoc∆cwp66 engineered strain as described in Example 1 of the present invention. Wherein: (A) Schematic diagram of the construction of the ∆PaLoc∆cwp66 engineered chassis cells; (B) Gel electrophoresis analysis of the ∆Paloc mutant strain; (C) Sequence alignment and sequencing peak diagram of WT and the ∆PaLoc mutant strain; (D) Gel electrophoresis analysis of the ∆cwp66 mutant strain; (E) Sequence alignment and sequencing peak diagram of WT and the ∆Paloc∆cwp66 mutant strain.

[0030] Figure 7 Figure 3 Figure 7

[0031] Figure 7 Figure 4 Figure 7 Figure 7

[0032] Figure 7 Figure 5 Figure 7 Figure 7

[0033] Figure 7 Figure 6 Figure 7 Figure 7

[0034] Figure 7 Figure 7 Figure 7 (A) pMTL82151_pta_GFP in BL21(DE3) expression; (B) flow cytometry detection of GFP protein display results; (C) Western blot analysis of GFP expression in E. coli BL21(DE3).

[0035] Appendix Figure 8 This invention relates to the treatment of colorectal cancer with engineered bacteria ∆PaLoc∆cwp66::αPD-L1 described in Example 6 and ∆PaLoc∆cwp66::IL18 described in Example 8. Specifically: (A) Tumor volume in tumor-bearing mice treated with engineered bacteria ∆PaLoc∆cwp66::αPD-L1 and ∆PaLoc∆cwp66::IL18; (B) Bar chart of tumor weight in mice under different treatment groups; (C) Graph showing the change in tumor volume over time in mice under different treatment groups. Detailed Implementation

[0036] The present invention will be further described below with reference to the embodiments.

[0037] Example 1: Construction of a cell wall protein display system based on truncated Cwp66 anchored protein

[0038] (1) Construction of effector protein cell wall display chassis cells

[0039] CRISPR-Cpf1 is a bacterial immune system based on nucleases. A schematic diagram of its gene-editing principle is attached. Figure 1 As shown. Specifically: (A) First, plasmids containing iLacP::Cpf1, sRNAP::crRNA, and Up-arm::Down-arm are transferred into cells, and an active Cpf1-crRNA RNP complex is formed after lactose induction. As the RNP complex matures, it recognizes specific DNA targets and induces DNA double-strand breaks in a misaligned manner. The edited cells undergo homologous recombination between the Up-arm::Down-arm region and the cellular genome to obtain the target mutant strain. (B) The PAM sequence is represented by letters ("TTTN", N = A / T / G / C). The misaligned cleavage site of the Cpf1 / crRNA RNP complex is shown as the scissors in the figure, along with the detailed nucleotide composition and secondary structure of the pre-crRNA.

[0040] In previous work, the inventors developed a CRISPR-Cpf1-based gene editing toolkit for genome editing of *Clostridioides difficile*. This embodiment uses CRISPR-Cpf1 gene editing technology to knock out the genes for the virulence island (PaLoc) and cell wall protein cwp66 in *Clostridioides difficile*, constructing a ΔPaLocΔcwp66 effector protein cell wall display chassis cell (see details). Figure 2 ).

[0041] in Figure 2A shows two steps of chassis cell construction using pWH53 vector. First, through BHIS-Tm medium screening, positive transformants carrying cwp66 gene targeting vector are screened on the basis of C. difficile ΔPaLoc mutant strain; then, through BHIS-Tm-lactose (BHISL) medium screening again, ΔPaLoc Δcwp66 engineering chassis cell is obtained.

[0042] Figure 2 B is gel electrophoresis analysis of ΔPaLoc knockout mutant strain. Among them, lane M is DNA molecular weight marker, lanes 1-24 are ΔPaLoc mutant strain detection. From Figure 2 B, it can be seen that PaLoc gene is successfully knocked out, and ΔPaLoc chassis cell is obtained, and non-toxic C. difficile is successfully constructed.

[0043] Figure 2 C is sequence alignment and sequencing peak chart of WT and ΔPaLoc mutant strain; from Figure 2 C, it can be seen that PaLoc virulence island is completely knocked out.

[0044] Figure 2 D is gel electrophoresis analysis of WT and ΔPaLoc Δcwp66 knockout mutant strain. Among them, lane M is DNA molecular weight marker, lane 1 is WT, lanes 2-24 are Δcwp66 mutant strain detection. From Figure 2 D, it can be seen that cwp66 gene is successfully knocked out in ΔPaLoc chassis cell, and ΔPaLoc Δcwp66 chassis cell is obtained.

[0045] Figure 2 E is sequence alignment and sequencing peak chart of WT and Δcwp66 mutant strain. From Figure 3 D, it can be seen that cwp66 gene is knocked out, and ΔPaLoc Δcwp66 chassis cell is successfully constructed.

[0046] (2) Identification of ΔPaLoc Δcwp66 chassis cell

[0047] This example uses SDS-PAGE to analyze the expression of Cwp66 protein in C. difficile, as shown in Figure 3 A. From Figure 3 A, it can be seen that Figure 3A shows three genotypes: CD630 (WT), ΔPaLocΔcwp66 and Δcwp66. Among them, Cwp66 protein can be detected in CD630 (marked with a dashed box), while no protein is detected in ΔPaLocΔcwp66 and Δcwp66, indicating that Cwp66 is successfully knocked out in these genotypes. The left is a 10-180 kDa pre-stained protein marker. Western blot quantitatively analyzes Cwp66 protein, and the expression of Cwp66 protein is detected by anti-Cwp66 antibody, as shown in Figure 3 B. Figure 4 B, it can be seen that the histogram shows that Cwp66 protein is normally expressed in CD630, and not expressed in ΔPaLocΔcwp66 and Δcwp66. This fully demonstrates that Cwp66 protein is no longer expressed in ΔPaLocΔcwp66 chassis cells, and the chassis cell construction is successful.

[0048] (3) Screen the promoter expressing the membrane localization signal peptide + Cwp66 protein transmembrane fragment, and introduce it into the chassis cell obtained in step (1) to obtain a cell wall protein display system.

[0049] First, β-galactosidase (lacZ) was used as an indicator gene, and different promoters with different strengths were selected to drive the expression of lacZ gene according to the previous spore-forming Clostridium transcriptome data. The reason for choosing Clostridium sporogenes is that it is relatively close to Clostridium difficile, and the promoter can be used universally; secondly, to avoid the homologous recombination caused by using the Clostridium difficile itself promoter, the inverted expression plasmid is unstable. According to the method, the expression of lacZ gene can cut X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) to produce blue substrate, and the depth of blue is proportional to the expression of lacZ gene. The method is used to screen the promoter standby (see Appendix Figure 4 ).

[0050] Figure 4 A is to screen the effector expression promoter with gusA as the reporter gene. Among them, the control group (Control), Pta (pyruvate, phosphodiesterase promoter), Ptb (phosphate transporter promoter), PrstA (peptide transport system A promoter) and abrBP (hypothetical protein binding partner promoter). From Figure 4 A, it can be seen that different promoters have different strengths for genes, and the strengths from strong to weak are Pta>Ptb>PrstA>abrBP. Figure 4 B is the fluorescence value after adding the reaction substrate 4-MUG and the gusA reporter gene reaction; specifically: at 0 min, 15 min, 30 min, the fluorescence value of the mixed reaction at the excitation wavelength 365 nm and the emission wavelength 455 nm is detected. From Figure 4BIt can be seen that different promoters have different starting intensities for genes, and the starting intensity from strong to weak is Pta>Ptb>PrstA>abrBP, which is consistent with Figure 4 AThe results are consistent. Figure 4 CFluorescence photos of GFP expression by Pta promoter. From left to right, they are GFP expression by pMTL82151_pta, pMTL82151_ptb, pMTL82151_prstA and pMTL82151_abrBP, respectively. Figure 5 CIt can be seen that Pta promoter is the promoter with the highest starting efficiency. Therefore, the final screening adopts the determined promoter as Pta promoter.

[0051] The plasmid expressing signal peptide SPYY66 is the wild-type signal peptide sequence of Cpw66 gene, and the plasmid expressing signal peptide SPYY66 has an amino acid sequence as shown in SEQ ID NO: 9.

[0052] Screening of truncated Cwp66 anchor protein: Through the NovoPro protein transmembrane region prediction website, it is predicted that the sequence length of the transmembrane region of the Cwp66 protein is 1-610 bp. Based on this prediction result, the inventors then designed 6 transmembrane region screening of Cwp66 anchor protein Cwp66 for the sequence of 1-1833 bp of cwp66. The amino acid sequences of the transmembrane domains of Cwp66 with 6 different truncated lengths are as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6:

[0053] Finally, the inventors verified by experiments that (1) the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 can correctly display the GFP protein on the cell wall of the non-toxic Clostridium difficile; (2) the amino acid sequences shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 cannot correctly display the GFP protein on the cell wall of the non-toxic Clostridium difficile. This fully shows that even after design, not all truncated lengths of the transmembrane domain of Cwp66 have the function of anchor protein Figure 5 F). Thus, the truncated Cwp66 screened by the present application has non-obviousness in the function of anchor protein, and achieves an unpredictable technical effect. Figure 5 BThis shows two different truncated lengths of Cwp66 transmembrane domain schemes, as follows:

[0054] Scheme 1: Cwp66 transmembrane domain length is 666 bp (pMTL82151_pta_cwp66_1);

[0055] Scheme 2: Cwp66 transmembrane domain length is 1545 bp (pMTL82151_pta_cwp66_2).

[0056] In addition, the anchor protein truncated Cwp66 used in this embodiment has the following advantages compared with the anchor proteins in the prior art: (1) The truncated Cwp66 protein has natural affinity with the cell wall of Clostridium difficile, ensuring the stability of anchoring; (2) The truncated Cwp66 protein reduces steric hindrance, which is conducive to the correct folding and functional exertion of the foreign protein.

[0057] Example 2: Displaying GFP protein in the ∆PaLoc∆cwp66 non-toxic Clostridium difficile chassis cell

[0058] Figure 1 shows the schematic diagram of the Clostridium difficile engineering strain A. Figure 5 Figure 2 shows the schematic diagram of displaying GFP in the ∆PaLoc∆cwp66 engineering bacteria chassis cell constructed in Example 1. In the figure, Figure 5 A is the schematic diagram of the Clostridioides difficile engineering strain. The strain is constructed by Figure 5 As shown in A, the engineering strain knocks out the ∆PaLoc virulence gene island and the cwp66 gene, and expresses the cwp66 gene membrane localization signal + truncated Cwp66 transmembrane domain + effector fusion protein through an exogenous plasmid. The specific operation in this embodiment is as follows:

[0059] (1) Construct pMTL82151_pta_cwp66_1 and pMTL82151_pta_cwp66_2 basic plasmids to amplify the pta promoter fragment from Clostridium bifermentans 8052 strain genome using primer pair HW1637 / HW1638.

[0060] Use Clostridium difficile CD630 genome as template, and use primer pairs HW546 / HW1323 and HW546 / HW1319 to amplify two different long and short transmembrane region fragments of cwp66_1 (1-666 bp) and cwp66_2 (1-1545 bp) of the cwp66 gene. An AvrII restriction site is designed at the end of the transmembrane region to facilitate the expression of the displayed protein, ensuring that the translation of the displayed protein is in the same open reading frame.

[0061] Using the method of homologous recombination, the amplified pta promoter fragment and the two different long and short transmembrane region fragments cwp66_1 (1-666 bp) and cwp66_2 (1-1545 bp) are connected after overlap extension and linearization of the restriction enzyme BamH I enzyme, and then transformed into competent cells, and finally the pMTL82151_pta_cwp66_1 and pMTL82151_pta_cwp66_2 plasmids are screened.

[0062] The relevant primer sequences are as follows:

[0063] HW1637: gagctcggtacccggggatccTATTCAGAACATTAAAAGAATGGTGAAT

[0064] HW1638: catAATCTATTTATCTCCTCTCTATATCCTATCTCTA

[0065] HW546: AATTTCACAGGAGGGCTGAAatgaaaatatcaaaaaagatagtgtctttg

[0066] HW1323: GACGCGTGACGTCGACTCTAGAGCCTAGGTCTTTCTACAGAATTAG

[0067] HW1319: gacgcgtgacgtcgactctagagCctaggatttaagcctctagc

[0068] (2) Construction of pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids

[0069] Figure 5 C is the pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmid, which fuses the gfp reporter gene at the C-terminal of the membrane localization signal peptide + Cwp66 protein transmembrane fragment to test the effector protein display system.

[0070] The specific construction process is as follows: using pWH136 as a template, the sequence fragments of GFP are amplified by primer pairs HW1485 / HW1486 and HW1660 / HW1661, respectively, and are ligated to the linearized pMTL82151_pta_cwp66_1 and pMTL82151_pta_cwp66_2 vectors digested by restriction enzyme Avr II, and then transformed into competent cells, and finally the pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids are screened. Figure 5 D is the Western blot analysis result, which shows that the Clostridioides difficile engineering strain successfully expresses the recombinant protein carrying GFP.

[0071] The relevant primer sequences are as follows:

[0072] HW1485: aattctgtagaaagacctagg ATGGGATCCATGTCGAAGGG

[0073] HW1486: acgtcgactctagagcctagg AAACAGCTATGACCGCGGC

[0074] HW1660: gctagaggcttaaatcctagg ATGGGATCCATGTCGAAGGG

[0075] HW1661: acgtcgactctagagcctagg AGGAAACAGCTATGACCGCG

[0076] (3) Detection of the effect of GFP displayed by the ∆Paloc∆cwp66 non-toxic Clostridium difficile engineering strain chassis cell

[0077] First, pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids were transformed into E. coli CA434, and after obtaining the transformants, they were transferred to LB liquid medium for culture. After the strain grew, it was mixed with Clostridium difficile bacterial liquid and spotted on BHIS solid plates for conjugation transformation. After 18 hours, the bacteria were scraped off and plated on BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol for selection of transformants. Fluorescence microscopy and flow cytometry were used to detect the expression of green fluorescence on the surface of the ∆Paloc∆cwp66 non-toxic Clostridium difficile engineering strain chassis cell. Figure 5 E is the result of fluorescence microscopy observation. It can be seen from Figure 6 E that the pMTL82151_pta_cwp66 group has obvious fluorescence signal (highlighted part), which indicates that the GFP green fluorescent protein is correctly expressed in the engineering strain. The flow cytometry results (F) suggest that the GFP green fluorescent protein is successfully displayed on the surface of the ∆Paloc∆cwp66 non-toxic engineering strain chassis cell wall. Figure 6 F.

[0078] Example 3: Display of αPD-L1_His protein by the ∆Paloc∆cwp66 non-toxic Clostridium difficile engineering strain

[0079] (1) Construction of pMTL82151_pta_cwp66_αPD-L1_His plasmid

[0080] The sequence fragment of aPD-L1_His was amplified by primer pair HW1854 / HW1855 using pSRR3 as template, and was ligated to the linearized pMTL82151_pta_cwp66_1 digested by restriction enzyme Avr II, and then transformed into competent cells. Finally, the pMTL82151_pta_cwp66_aPD-L1_His plasmid was screened, and the schematic diagram of the structure is shown in Figure 6 A. As shown in Figure 6 A, the plasmid contains TraJ, pBP1, catP and RepA genes, and a 1-666 bp fragment of cwp66 gene. The cwp66 gene is fused with PD-L1 and His tag. The pMTL82151_pta_cwp66_aPD-L1_His plasmid with successful ligation was detected by detection primer WH103 / HW1181, and the agarose gel electrophoresis band size was 1988 bp.

[0081] The relevant primer sequences are as follows:

[0082] HW1854: aattctgtagaaagacctaggATGGCACAAGTACAATTAGTAGAAACTG

[0083] HW1855: acgtcgactctagagcctaggTCAGTGGTGGTGGTGGTGGT

[0084] WH103: gctggcgaagatcgaagaga

[0085] HW1181: ggcctcttcgctattacgcc

[0086] (2) Effect detection of aPD-L1_His protein displayed in the ΔPalocΔcwp66 non-toxic engineering strain chassis cell

[0087] The pMTL82151_pta_cwp66_aPD-L1_His plasmid was transformed into E. coli CA434, and the transformant was transferred to LB liquid medium for culture. After the strain grew, it was mixed with Clostridium difficile bacterial liquid and spotted on BHIS solid plate for conjugation transformation. After 18 hours, the bacterial cells were scraped and spread on BHIS medium containing cefoxitin, D-cycloserine and thiamphenicol to screen the transformant. Western Blot was used to detect protein expression Figure 6 B). Figure 6 B shows the expression of cwp66_PD-L1_His recombinant protein in C. difficile strain.Figure 6 It can be seen that the αPD-L1_His protein is successfully expressed in the engineering strain, and the protein band size is 39 kDa.

[0088] Example 4: Display of αPD-L1_GFP protein by the ΔPalocΔcwp66 non-toxic engineering strain

[0089] (1) Construction of pMTL82151_pta_cwp66_αPD-L1_GFP plasmid

[0090] The sequence fragment of αPD-L1 was amplified by primer pair HW1854 / HW1856 using pSRR3 as a template. The sequence fragment of GFP was amplified by primer pair HW1857 / HW1486 using pWH136 as a template. The amplified αPD-L1 and GFP sequence fragments were subjected to overlap extension and then ligated to the linearized pMTL82151_pta_cwp66_1 vector digested by restriction enzyme Avr II, and transformed into competent cells, to finally screen the pMTL82151_pta_cwp66_αPD-L1_GFP plasmid. The agarose gel electrophoresis band size of the pMTL82151_pta_cwp66_αPD-L1_GFP plasmid was 2777 bp.

[0091] The relevant primer sequences are as follows:

[0092] HW1854: aattctgtagaaagacctaggATGGCACAAGTACAATTAGTAGAAACTG

[0093] HW1856: atggatcccatTCCTCCAGTTTCAGGTAATCCTCC

[0094] HW1857: actggaggaATGGGATCCATGTCGAAGGG

[0095] HW1486: acgtcgactctagagcctaggAAACAGCTATGACCGCGGC

[0096] WH103: gctggcgaagatcgaagaga

[0097] HW1181: ggcctcttcgctattacgcc

[0098] (2) Effect detection of display of αPD-L1_GFP protein in the ΔPalocΔcwp66 non-toxic engineering strain chassis cell

[0099] pMTL82151_pta_cwp66_1 plasmid was transformed into E. coli CA434, and the transformant was transferred to LB liquid medium for culture. After the strain grew, it was mixed with C. difficile bacterial liquid and then spotted onto a BHIS solid plate for conjugation transformation. After 18 hours, the bacterial cells were scraped off and plated on BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol for screening of the transformant. Figure 6 B) shows that the aPD-L1_GFP protein was successfully expressed in the engineered strain, and the protein band size was 65 kDa.

[0100] Example 5: aPD-L1_GFP protein displayed by aPaloc aCwp66 avirulent engineered strain

[0101] The gene sequence of IL18 was obtained by searching the NCBI database, and the protein codon sequence of IL18 was optimized according to the codon usage bias of C. difficile genome using the online tool of New England Biolabs. The optimized sequence is shown in SEQ ID NO: 11. The optimized sequence was ligated to the linearized pMTL82151_pta_cwp66_1 vector digested with restriction enzyme Avr II, and was sent to Nanjing Kings River Biotech Co., Ltd. for synthesis to obtain the pMTL82151_pta_cwp66_IL18 plasmid. The agarose gel electrophoresis band size of the pMTL82151_pta_cwp66_IL18 plasmid was detected by primers WH103 / HW1181, and was 2177 bp.

[0102] pMTL82151_pta_cwp66_IL18 plasmid was transformed into E. coli CA434, and the transformant was transferred to LB liquid medium for culture. After the strain grew, it was mixed with C. difficile bacterial liquid and then spotted onto a BHIS solid plate for conjugation transformation. After 18 hours, the bacterial cells were scraped off and plated on BHIS medium containing cefoxitin, D-cycloserine, and thiamphenicol for screening of the transformant. Figure 6 C is a schematic diagram of the recombinant plasmid pMTL82151_pta_cwp66_IL18. It contains the TraJ, pBP1, catP, and RepA genes, as well as a 1-666 bp fragment of the cwp66 gene and the IL18 gene. Figure 7 C, it can be seen that the plasmid contains the TraJ, pBP1, catP, and RepA genes, as well as a 1-666 bp fragment of the cwp66 gene and the IL18 gene. Figure 7 D is the Western blot analysis result, which shows the expression of the cwp66_IL18 recombinant protein in the C. difficile strain; from Figure 7As shown in D, the IL18_GFP protein was successfully expressed in the engineered strain, and the protein band was approximately 70 kDa in size.

[0103] Example 6: The non-toxic engineered strain ∆PaLoc∆cwp66, demonstrating αPD-L1 protein, is used to treat colorectal cancer.

[0104] (1) Colorectal cancer cell culture:

[0105] After removing the cryopreserved CT26 cells from the -80℃ freezer, quickly place them in a preheated 37℃ water bath. Shake the cryovials continuously until thawed. Add 2 mL of complete culture medium, centrifuge at 1000 rpm for 3 minutes, and discard the supernatant. Gently resuspend the cells in 5 mL of complete culture medium, transfer to a cell culture flask, and gently shake the flask to disperse the cells. Label the cells and incubate in a 37℃ incubator containing 5% CO2. Change the medium the next day and observe cell morphology.

[0106] (2) Constructing a mouse model of colorectal cancer:

[0107] Female Balb / C mice aged 6-8 weeks, weighing 18-20 g, were purchased from Beijing Sibeifu Biotechnology Co., Ltd. Before the experiment, the mice were acclimatized for one week. They were housed in a specific pathogen-free environment with equal day and night lengths, at a room temperature of 23℃ ± 2℃, with 5 mice per ventilated cage, and free access to food and water. CT26 cells in good logarithmic growth phase (cell density reaching 80%-90%) were changed in medium one day in advance. The following day, a CT26 cell suspension was prepared using PBS, and its concentration was adjusted to 5×10⁻⁶. 5 / mL. Hair was removed from the middle and posterior right axilla of mice with depilatory cream, and the skin at the injection site was wiped with 75% alcohol. 200 μL of cell suspension was injected subcutaneously into each mouse to construct a CT26 colorectal cancer-bearing mouse model.

[0108] (3) The non-toxic engineered strain ∆PaLoc∆cwp66, which displays αPD-L1 protein, is used to treat colorectal cancer:

[0109] Mice that had been acclimatized for one week were randomly divided into four groups of five mice each: a PBS control group (blank control), a ∆PaLoc∆cwp66 group (wild-type strain), and a ∆PaLoc∆cwp66_αPD-L1 intervention group (engineered strain). When the mouse tumor volume reached 100 mm... 3 After lateral retraction, inject 100 μL of 5×10 solution into the tail vein using a 30 G needle. 8CFU-corresponding wild-type or engineered strains (bacterial cells suspended in 100 μL PBS). Two tail vein injections were administered throughout the experiment to ensure successful administration. Mice were euthanized when the tumor diameter exceeded 2 cm. During treatment, the activity level of mice in each group was observed daily, and the survival time was recorded to plot survival curves. Mouse weight and tumor volume were recorded every three days. Tumor volume was calculated using the formula: Tumor volume (mm²) 3 = 0.5 × length × width 2 .

[0110] Example 7: Using Escherichia coli BL21(DE3) as a display system for chassis cells

[0111] In the fields of biotechnology and molecular biology, the BL21(DE3) strain, as a commonly used expression system, has become a highly efficient tool for protein expression due to its high efficiency, flexibility, and ease of operation. The inventors used *E. coli* BL21(DE3) as the chassis cell to verify the effectiveness of the constructed display system. The specific operation is as follows:

[0112] First, the successfully constructed pMTL82151_pta_cwp66_1_GFP and pMTL82151_pta_cwp66_2_GFP plasmids were transformed into E. coli BL21(DE3). Green fluorescence signals were observed in the pMTL82151_pta_cwp66 group under a fluorescence microscope, indicating that the GFP green fluorescent protein was correctly expressed in the engineered strain. Figure 8 A). Similarly, the results of Western Blot experiments ( Figure 8 C) and flow cytometry experimental results ( Figure 8 (B) This also indicates that GFP (green fluorescent protein) was successfully displayed on the cell wall surface of the chassis of the non-toxic engineered strain ∆Paloc∆cwp66. This demonstrates that the effectiveness of the constructed display system was successfully verified using Escherichia coli BL21(DE3) as the chassis cell. It also shows that the anchoring protein truncated to Cwp66 described in this application is applicable not only to Clostridium difficile but also to Escherichia coli, indicating broad application prospects and considerable economic benefits.

[0113] Example 8: The non-toxic engineered strain ∆PaLoc∆cwp66, demonstrating IL-18 protein, is used to treat colorectal cancer.

[0114] (1) Culture of colorectal cancer cells

[0115] After the frozen CT26 cells were taken out from -80℃ refrigerator, they were quickly put into a preheated 37℃ constant temperature water bath, and the frozen tube was shaken without stopping until the liquid was dissolved. Then 2 mL complete culture solution was added, and centrifuged at 1000 rpm / min for 3 min. The supernatant was discarded. Then 5 mL complete culture medium was used to gently resuspend the cells, which were then transferred to a cell culture bottle. The cell culture bottle was shaken up and down to disperse the cells. The cell culture bottle was labeled and placed in a 37℃ constant temperature incubator with 5% CO2.

[0116] (2) Construction of colorectal cancer tumor-bearing mouse model

[0117] 6-8 weeks old female Balb / C mice weighing 18-20 g were selected from Beijing Sibei Biological Technology Co., Ltd. Before the experiment, the mice were adaptively fed for one week. The feeding level was specific pathogen free level, the day and night time was equal, the room temperature was 23℃±2℃, there were 5 mice in each ventilated cage, and food and water were freely available. The CT26 cells in logarithmic growth phase with good growth state (cell density reached 80%-90%) were changed one day in advance, and the next day PBS was used to prepare CT26 cell suspension, and the concentration was adjusted to 5×10 5 / mL. The mouse right axillary middle and back hair was removed with depilatory cream, the injection site skin was wiped with 75% alcohol, and each mouse was subcutaneously injected with 200 μL cell suspension to construct a CT26 colorectal cancer tumor-bearing mouse model.

[0118] (3) Display of IL18 protein in non-toxic engineering strain of ΔPaLocΔcwp66 for treatment of colorectal cancer

[0119] After the mice were adaptively fed for one week, they were randomly divided into 7 groups, 5 mice in each group, namely PBS control group (blank control), ΔPaLocΔcwp66 group (wild type strain), ΔPaLocΔcwp66_IL18 intervention group (engineering strain). When the tumor volume of the mice grew to 100 mm 3 left and right, 100 μL of 5×10 8 CFU corresponding to wild type strain or engineering strain (bacterial suspension in 100 μL PBS) was injected into the tail vein with a 30 G needle. The experiment was performed twice by tail vein injection to ensure the success rate of drug administration. When the tumor diameter exceeded 2 cm, the mice were sacrificed. During the treatment, the activity of the mice in each group was observed every day, the survival days of the mice were recorded, and the survival curve was drawn. The body weight and tumor volume of the mice were recorded every three days, and the tumor volume calculation formula was: tumor volume (mm3) = 0.5 × length × width 2 .

[0120] Appendix Figure 8 The results of treating colorectal cancer with engineered bacteria ∆PaLoc∆cwp66::αPD-L1 (displaying αPD-L1 protein) as described in Example 6 and ∆PaLoc∆cwp66::IL18 (displaying IL-18 protein) as described in Example 8 are presented. Figure 8 A shows the tumor volume of tumor-bearing mice after treatment with two engineered bacteria, ∆PaLoc∆cwp66::αPD-L1 and ∆PaLoc∆cwp66::IL18. Figure 8 A indicates that: (1) Compared with the PBS control group, the tumor volume of the ∆PaLoc∆cwp66 group (non-toxic chassis cells) showed a slight decreasing trend; this indicates that the non-toxic Clostridium difficile chassis cells themselves also have a tumor-suppressive effect, which is the first discovery in this application. (2) After the cell wall proteins of Clostridium difficile showed αPD-L1 and IL-18 proteins, the tumor volume of tumor-bearing mice was further significantly reduced based on the non-toxic engineered bacterial chassis cell group. This indicates that the ∆PaLoc∆cwp66 non-toxic engineered strains showing αPD-L1 or IL-18 proteins all exhibited good tumor-suppressive effects.

[0121] Figure 8 B is a bar chart showing the tumor weight of mice in different treatment groups. Figure 8 B indicates that: (1) compared with the PBS control group, the tumor weight in the ΔPaLocΔcwp66 group (non-toxic) did not change significantly; (2) compared with the PBS and ΔPaLocΔcwp66 groups, the tumor weight in the ΔPaLocΔcwp66_PD-L1 and ΔPaLocΔcwp66_IL18 treatment groups was significantly reduced. This suggests that using the Clostridium difficile cell wall protein display system to display antitumor proteins can achieve good antitumor effects, compared with... ​ The result is consistent with A.

[0122] ​ C shows the change in tumor volume over time in mice from different treatment groups. ​ C indicates that: (1) Compared with the PBS control group, the tumor volume of mice in the ∆PaLoc∆cwp66 group (wild-type strain) increased over time, but its growth rate was lower than that of the PBS control group; (2) Compared with the PBS and ΔPaLoCΔcwp66 groups, the tumor volume of the ΔPaLocΔcwp66_PD-L1 and ΔPaLocΔcwp66_IL18 treatment groups was significantly reduced, where *** indicates p<0.001 and **** indicates p<0.0001. This shows that using the Clostridium difficile cell wall protein display system to display anti-tumor proteins can achieve good anti-tumor effects.

[0123] In summary, (1) the present application discloses, for the first time, a truncated Cwp66 protein as a display cell wall anchor protein, which significantly improves the expression efficiency of exogenous proteins and produces unexpected technical effects. (2) Based on the aforementioned cell wall protein display system with the non-toxic Clostridium difficile as a chassis strain, the technical problems of high-efficiency expression and display of protein drugs in the prior art are solved. (3) Based on the aforementioned engineering strain of the display system, the engineering strain not only fully exerts the oncolytic effect of the effector protein itself, but also unexpectedly finds that the strain inhibits the growth of tumors (the maximum reduction of tumor volume is 73%), which provides a new idea for the treatment of colorectal cancer and has a wide application prospect.

Claims

1. A truncated Cwp66 cell wall anchoring protein for efficient expression of exogenous proteins, characterized in that: The amino acid sequence of the truncated Cwp66 anchoring protein is shown in SEQ ID NO:1 or SEQ ID NO:

2.

2. The cell wall protein display system based on the anchored protein of claim 1, characterized in that: The demonstration system uses non-toxic Clostridium difficile or Escherichia coli as the chassis strain, and introduces a plasmid to express the signal peptide SPYY66 and the anchoring protein truncated Cwp66; the amino acid sequence of the plasmid expressing the signal peptide SPYY66 is shown in SEQ ID NO:9; the non-toxic Clostridium difficile is a knockout strain. PaLoc Genes and cwp66 Clostridium difficile, a gene-dependent bacterium.

3. A non-toxic Clostridium difficile engineered strain, characterized by: The engineered strain is a recombinant strain that displays effector proteins on the cell wall surface using the cell surface display system of the non-toxic Clostridium difficile as a chassis strain as described in claim 2.

4. The engineered strain according to claim 3, characterized in that: The effector protein is αPD-L1, IL-18, or other proteins that can dissolve tumors.

5. The use of the non-toxic Clostridium difficile engineered strain as described in claim 3 in the preparation of anti-colorectal cancer drugs.

6. The method for constructing a non-toxic Clostridium difficile engineered strain as described in claim 3, comprising the following steps: (1) knocking out the Clostridium difficile virulence island (PaLoc) and cell wall proteins. cwp66 (1) Gene, construct effector protein cell wall display chassis cells; (2) Introduce promoter, membrane localization signal peptide, anchoring protein truncated Cwp66 and effector protein fusion fragment into chassis cells described in step (1), display effector protein on the surface of non-toxic Clostridium difficile cell wall, and obtain non-toxic Clostridium difficile engineered strain for anti-tumor.

Images