Preparation method and application of self-enhanced SA-mIL-21 NK cell

Abstract

The invention discloses a preparation method and an application of a self-enhanced SA-mIL-21 NK (natural killer) cell. The preparation method comprises the following steps: constructing a membrane rivet mIL-21 CircRNA, electrically transfecting the membrane rivet mIL-21 CircRNA to a PBMC cell to prepare an mIL-21 PBMC cell, co-culturing the PBMC cell and the mIL-21 PBMC cell to obtain an activated NK cell, electrically transfecting the mIL-21 CircRNA to the activated NK cell to amplify the NK cell, and finally introducing the mIL-21 CircRNA into the amplified NK cell through electrotransfection to prepare the self-enhanced SA-mIL-21 NK cell. After the self-enhanced SA-mIL-21 NK cell is transfused back into a body, the NK cell continuously expresses mIL-21, proliferation of the NK cell in the body can be promoted, self-activation of the NK cell in the body is achieved, and then the NK cell is promoted to infiltrate a tumor site; the NK cells at the tumor site are further self-activated, so that the anti-tumor effect of the NK cells is improved. A new strategy is provided for preparation of NK cells and comprehensive treatment of solid tumors.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to the preparation and application of self-enhanced SA-mIL-21 NK cells. Background Art

[0002] Malignant tumors have become one of the major public health issues that seriously threaten health, and the incidence and mortality of malignant tumors are both on a continuous rise, and the prevention and control situation is severe. Despite the continuous progress in clinical tumor treatment methods such as surgical treatment, radiotherapy, chemotherapy, and targeted therapy, it is still impossible to effectively inhibit the recurrence and metastasis of tumors, resulting in poor prognosis, low quality of life, and high mortality for patients. In recent years, tumor immunotherapy has become a frontier hotspot in the current field of tumor treatment. It activates the body's immune system to achieve recognition and elimination of tumor cells. It has the advantages of small toxic side effects, strong specificity, long-lasting effectiveness, and the ability to produce immune memory. It provides a new direction for tumor treatment and has been clinically applied to the treatment of a variety of malignant tumors.

[0003] Adoptive immunotherapy based on NK cells is an immune cell therapy strategy that directly recognizes and attacks tumor cells without relying on pre-sensitization with antigens. NK cells have good tumor cell-killing properties and induce tumor cell apoptosis or necrosis by secreting cytokines such as TNF-α, IFN-γ, granzymes, and perforins. Currently, domestic and foreign studies have shown that NK cells combined with interleukin-2 (rhIL-2) have a good therapeutic effect on patients with acute leukemia, but are insensitive to solid tumors such as liver cancer and colorectal cancer, and the therapeutic effect is poor. The main reasons are: 1. The physical barrier formed by the dense extracellular matrix produced by fibroblasts outside the solid tumor makes it difficult for immune cells to infiltrate effectively; 2. The immunosuppressive microenvironment of the solid tumor makes it difficult for the infiltrating NK cells to play a killing role.

[0004] In order to ensure the function of NK cells and further improve the effectiveness of NK cell therapy, NK cells are modified to encourage them to express relevant cytokines, continuously stimulate NK cell proliferation and promote NK cell activity. Circular RNA (CircRNA) is a type of covalently closed circular RNA molecule that can initiate translation under specific conditions to produce functional proteins or peptides, and has the advantages of strong stability and long intracellular expression time. At the same time, using it as a tool for NK cell modification has many advantages: 1. CircRNA is electrotransfected into NK cells with high efficiency and low cytotoxicity, which can effectively ensure NK cell activity; 2. CircRNA exists in cells for a relatively long time and can be expressed in NK cells continuously; 3. CircRNA will not randomly insert into the genome to change the genetic information of cells, and has high safety.

[0005] IL-21 can induce the maturation of NK cells, enhance their cytotoxicity, and promote the anti-tumor activity of NK cells. Some preclinical and clinical studies have shown that IL-21 relies on stimulating NK cells to upregulate cytokines such as interferon and granzyme B to exert its anti-tumor effect. High-dose IL-21 anti-tumor therapy in vivo may cause abnormal liver and kidney function in patients, and even cause allergic reactions, and its systemic administration faces challenges. Therefore, the establishment of IL-21 membrane fusion protein to prolong the half-life of IL-21 and reduce the risk of cytokine accumulation and toxicity is a method to ensure the safety and effectiveness of IL-21 in adoptive NK cell therapy. At present, there are mature membrane IL21-K562 feeder cells for activating and expanding NK cells in PBMC (such as Hangzhou Zhongying), but the K562 cell line used is a leukemia tumor cell line. The NK cells obtained by the expansion culture of membrane IL21-K562 feeder cells need to undergo extremely strict quality inspection to eliminate their potential tumorigenicity risks; in addition, membrane IL21-K562 feeder cells are only suitable for the activation culture of NK cells in vitro, and lack the ability to continuously activate NK cells in vivo.

[0006] The main strategy for NK cell modification is to use viral systems to construct CAR NK cells, improve the targeting ability of NK cells, and enhance their tumor infiltration ability. However, CAR NK cell technology has high barriers to entry, is expensive, has potential side effects, and is difficult to apply clinically. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a preparation and application of self-enhanced SA-mIL-21 NK cells.

[0008] The technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a method for preparing self-enhanced SA-mIL-21 NK cells, comprising the following steps: S1: Prepare a CircRNA gene expressing mIL-21 membrane protein, denoted as mIL-21CircRNA; isolate autologous plasma and PBMC cells from peripheral blood of normal healthy subjects; S2: transfecting mIL-21CircRNA into PBMC cells to obtain mIL-21PBMC cells; co-culturing mIL-21PBMC cells and PBMC cells in NK cell activation medium, and the cells collected after the culture is completed are activated NK cells; S3: Transfecting mIL-21CircRNA into activated NK cells to obtain mIL-21 NK cells; co-culturing mIL-21 NK cells and activated NK cells in NK cell expansion medium, and the cells collected after the culture is completed are the expanded NK cells; S4: Transfection of mIL-21CircRNA into expanded NK cells obtained from enhanced SA-mIL-21 NK cells.

[0009] Furthermore, in the above step S1, the nucleotide sequence of mIL-21CircRNA is as shown in SEQ ID NO.1.

[0010] Furthermore, in the above step S2, the transfection method is electroporation, and the working concentration of mIL-21CircRNA during transfection is 0.1-1 μg / 10 6 cells, voltage 100-300V, pulse width 0.5-20ms. Preferably, the working concentration of mIL-21CircRNA during transfection is 1μg / 10 6 cells, voltage 250V, pulse width 20ms.

[0011] Furthermore, in the above step S2, the NK cell activation medium is a KBM581 medium containing 100-1500 IU / mL interleukin-2, 1 vol%-5 vol% inactivated autologous plasma and 50-100 U / mL gentamicin. Preferably, the NK cell activation medium is a KBM581 medium containing 1000 IU / mL interleukin-2, 2 vol% inactivated autologous plasma and 80 U / mL gentamicin.

[0012] Furthermore, in the above step S2, mIL-21PBMC cells and PBMC cells are co-cultured in NK cell activation medium at a ratio of 2 to 5:1 for 7 days, and the cell density in the medium for the first 3 days is 0.5 to 4.0×10 6 The cell density in the culture medium was 0.3-1.5×10 6 Preferably, mIL-21PBMC cells and PBMC cells are co-cultured in NK cell activation medium at a ratio of 5:1 for 7 days, and the cell density in the medium for the first 3 days is 2.0×10 6 The cell density in the culture medium was 1.0×10 6 Pieces / mL.

[0013] Furthermore, in the above step S3, the transfection method is electroporation, and the working concentration of mIL-21CircRNA during transfection is 0.1-1 μg / 10 6 cells, voltage 100-300V, pulse width 0.5-20ms. Preferably, the working concentration of mIL-21CircRNA during transfection is 0.5μg / 10 6 cells, voltage 300V, pulse width 20ms.

[0014] Furthermore, in the above step S3, the NK cell expansion medium is a KBM581 medium containing 200-1500 IU / mL interleukin-2, 0.5 vol%-5 vol% inactivated autologous plasma and 50-100 U / mL gentamicin. Preferably, the NK cell expansion medium is a KBM581 medium containing 1000 IU / mL interleukin-2, 0.5 vol% inactivated autologous plasma and 80 U / mL gentamicin.

[0015] Furthermore, in the above step S3, the mIL-21 NK cells and the activated NK cells are co-cultured in the NK cell expansion medium at a ratio of 3 to 10:1 for 13 to 15 days, and the cell density in the medium is 0.3 to 1.5×10 6 Preferably, mIL-21 NK cells and activated NK cells are co-cultured in NK cell expansion medium at a ratio of 7:1 for 15 days, and the cell density in the medium is 1.0×10 6 Pieces / ml.

[0016] Furthermore, in the above step S4, the transfection method is electroporation, and the working concentration of mIL-21CircRNA during transfection is 0.1-1 μg / 10 6 cells, voltage 100-300V, pulse width 0.5-20ms. Preferably, the working concentration of mIL-21CircRNA during transfection is 0.2μg / 10 6 cells, voltage 300V, pulse width 20ms.

[0017] The second aspect of the present invention provides a self-enhanced SA-mIL-21 NK cell, which is prepared by the above-mentioned preparation method.

[0018] The third aspect of the present invention provides the use of the self-enhanced SA-mIL-21 NK cells in the preparation of tumor therapeutic drugs.

[0019] Furthermore, the above-mentioned tumor treatment drug is an adoptive immunotherapy drug for liver cancer.

[0020] The significant advantages of the present invention are: The present invention prepares mIL-21CircRNA in vitro, and electrotransfers the mIL-21CircRNA into PBMC cells and activated NK cells to prepare self-enhanced SA-mIL-21 NK cells. Self-enhanced SA-mIL-21 NK cells can continuously promote the proliferation, differentiation and maturation of NK cells in vivo, enhance the cytotoxicity of NK cells and the ability to secrete cytokines; at the same time, self-enhanced SA-mIL-21 NK cells can activate NK cells and T cells at the tumor site, thereby improving the body's anti-tumor effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 :The preparation and application principle diagram of self-enhanced SA-mIL-21 NK cells.

[0022] Figure 2 : WB images of mIL-21PBMC cells and mIL-21 NK cells expressing mIL-21.

[0023] Figure 3 : Phenotypic identification diagram of self-enhanced SA-mIL-21 NK cells (A) and cell proliferation curve (B).

[0024] Figure 4 : Flow cytometry analysis of self-enhanced SA-mIL-21 NK cells killing liver cancer cells (A) and changes in cytokine secretion (B).

[0025] Figure 5 :The effect of self-enhanced SA-mIL-21 NK cells self-activating NK cells in tumor sites. DETAILED DESCRIPTION

[0026] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0027] The instruments, reagents, materials, etc. involved in the following examples, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art. The KBM581 culture medium involved in the following examples comes from CORNING, product number 88-581-CM.

[0028] Embodiment 1: A method for preparing self-enhanced SA-mIL-21 NK cells is carried out according to the following steps: S1: The IL-21 gene sequence and the CD28 transmembrane region gene sequence were constructed on the pUC57 plasmid. After single digestion with Hind III, reverse transcription was performed to obtain mIL-21 CircRNA. The nucleotide sequence of mIL-21 CircRNA is: 5’-ATGGCCCTGCCAGTGACCGCCCTGCTGCTGCCTCTGGCCCTGCTGCTGCACGCCGCTAGGCCCTACCCCTACGACGTGCCTGATTATGCCTACCCCTACGACGTGCCTGATTACGCCCATAAGTCCTCTAGCCAGGGCCAGGATAGACACATGATCCGCATGCGGCAGCTGATTGATATCGTTGACCAACTGAAGAACTACGTGAATGATCTGGTGCCTGAGTTCCTGCCTGCACCCGAGGACGTGGAGACTAACTGCGAGTGGTCCGCCTTCAGCTGCTTTCAGAAGGCCCAGCTGAAGAGCGCCAATACCGGAAACAACGAGAGAATCATCAATGTGAGTATTAAGAAGCTGAAGAGGAAACCACCTAGCACCAATGCCGGACGCAGACAGAAGCACAGACTGACCTGCCCCAGCTGTGACAGCTATGAGAAGAAGCCTCCCAAAGAGTTCCTGGAGCGGTTTAAATCCCTGCTCCAGAAGATGATCCACCAGCACCTGTCTTCCAGAACACACGGCTCTGAGGACAGCAAGCCAACCACCACCCCCGCTCCTAGACCCCCAACCCCTGCCCCTACCATCGCCTCTCAGCCCCTGTCCCTGAGGCCAGAAGCCTGCCGGCCAGCCGCCGGCGGCGCCGTGCACACCCGCGGCCTCGACTTTGCTTGCGACATCTACATCTGGGCCCCCCTGGCCGGGACCTGCG GCGTGCTCCTGCTGAGCCTGGTGATCACACTGTACTGCAGGTCTAAGCGGAGCAGACTGCTGCACTCCGATTACATGAATATGACCCCCCGCAGACCCGGGCCCACAAGAAAACACTACCAGCCTTATGCCCCACCAAGAGACTTTGCTGCCTACAGGTCCTAGTGA-3’。60 mL of peripheral blood was collected from healthy subjects, and autologous plasma was separated. Mononuclear cells were separated using Ficoll lymphocyte separation solution.

[0029] S2: The isolated PBMC cells were divided into two parts: one of the PBMC cells was incubated with mIL-21CircRNA at a rate of 1 μg mIL-21CircRNA / 10 6 The ratio of 10 cells was 2.0×10 cells, and the mIL-21CircRNA was transfected into the PBMC cells by electroporation (250V, 20ms) to obtain mIL-21PBMC cells; the other PBMC cells were not transfected with mIL-21CircRNA. The mIL-21PBMC cells and the PBMC cells not transfected with mIL-21CircRNA were mixed in NK cell activation medium, and the cell density in the medium was 2.0×10 6 The number ratio of mIL-21PBMC cells to PBMC cells not transfected with mIL-21CircRNA was 5:1, and the cells were cultured at 37°C and 5% carbon dioxide for 3 days. The cell pellets were centrifuged and resuspended in NK cell activation medium to a cell density of 1.0×10 6 / mL, and continue to culture for 4 days at 37°C and 5% carbon dioxide. During this period, fresh NK cell activation medium is added every day to replenish the fluid to control the cell density in the culture medium. The cells collected after the culture is completed are activated NK cells. Among them, the NK cell activation medium is KBM581 medium containing 1000IU / mL interleukin-2, 2vol% inactivated autologous plasma and 80U / mL gentamicin.

[0030] S3: The collected activated NK cells were divided into two parts: one part of the activated NK cells was incubated with mIL-21CircRNA at 0.5 μg mIL-21CircRNA / 10 6 The ratio of 1.0×10 cells was mixed, and the activated NK cells were transfected with mIL-21CircRNA by electroporation (300V, 20ms) to obtain mIL-21 NK cells; the other activated NK cells were not transfected with mIL-21CircRNA. The mIL-21 NK cells and the activated NK cells not transfected with mIL-21CircRNA were mixed in NK cell expansion medium, and the cell density in the medium was 1.0×10 6The number ratio of activated NK cells to mIL-21 NK cells and untransfected mIL-21CircRNA was 7:1, and they were cultured at 37°C and 5% carbon dioxide for 15 days. During this period, fresh NK cell expansion medium was added every day to replenish the fluid to control the cell density in the culture medium. The cells collected after the culture was the expanded NK cells. Among them, the NK cell expansion medium was KBM581 medium containing 1000IU / mL interleukin-2, 0.5vol% inactivated autologous plasma and 80U / mL gentamicin.

[0031] S4: The collected amplified NK cells were incubated with mIL-21CircRNA at a rate of 0.2 μg mIL-21CircRNA / 10 6 The ratio of 1:1 was 1:1 and 1:1 cells were mixed, and the mIL-21circRNA was transfected into the amplified NK cells by electroporation (300V, 20ms) to obtain enhanced SA-mIL-21 NK cells.

[0032] The preparation and application principle diagram of the self-enhanced SA-mIL-21 NK cells of the present invention can be found in Figure 1 .

[0033] Take 5.0×10 6 NK cells (prepared by mIL-21 K562 feeder cell method), mIL-21 PBMC cells, and mIL-21 NK cells were used to detect the expression of mIL-21 protein. Figure 2 It can be seen that both mIL-21PBMC cells and mIL-21 NK cells express mIL-21.

[0034] The expanded NK cells were detected by flow cytometry and the NK proliferation times were calculated. Figure 3 It can be seen that the NK cell phenotype CD3- / CD56+ positive ratio exceeded 95%, and the NK proliferation multiple reached 135 times.

[0035] HepG2 cells were taken at a rate of 2×10 5 100 cells / well were plated in a 24-well plate; self-enhanced SA-mIL-21 NK cells were added at an E / T ratio of 1:1 and co-cultured at 37°C and 5% carbon dioxide for 24 hours; residual tumor cells were collected and the difference in tumor cell survival was detected by Annexin V / PI double staining, and the cell supernatant was collected and the difference in cytokine secretion was detected by Elisa method. Figure 4It can be seen that compared with NK cells (prepared by the mIL21 K562 feeder cell method), the efficiency of self-enhanced SA-mIL-21 NK cells in killing tumor cells is significantly improved, and the proportion of apoptosis (early apoptosis, late apoptosis) and necrosis is as high as 61.9%; compared with NK cells (prepared by the mIL21 K562 feeder cell method), the secretion level of cytokines (IFN-γ, TNF-α, IL-2 and IL-12P70) of self-enhanced SA-mIL-21 NK cells is also significantly improved.

[0036] Self-enhanced SA-mIL-21 NK cells were used for adoptive immunotherapy of liver cancer. 5×10 6 HepG2 cells were inoculated subcutaneously in mice and grown to 100 mm 3 When the tumor size was 5×10 6 The cells were adoptively infused into mice via the tail vein, and the mice were killed by cervical dislocation 48 hours later. The main organs and tumor tissues of the mice were collected, and the infiltration of self-enhanced SA-mIL-21 NK cells in tumor tissues was observed using near-infrared fluorescence. Figure 5 It can be seen that self-enhanced SA-mIL-21 NK cells can be self-activated in tumor tissues, enhancing the infiltration effect of self-enhanced SA-mIL-21 NK cells in tumor tissues.

[0037] The above embodiments are only used to help understand the method of the present invention and its core concept. It should be noted that, for those skilled in the art, without departing from the principles of the present invention, several improvements and modifications may be made to the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

Claims

1. A method for preparing self-enhanced SA-mIL-21 NK cells, characterized in that: The following steps are involved: S1: Prepare CircRNA gene expressing mIL-21 membrane protein, denoted as mIL-21 CircRNA; isolate autologous plasma and PBMC cells from peripheral blood of normal healthy subjects; S2: mIL-21 CircRNA was transfected into PBMC cells to obtain mIL-21 PBMC cells; mIL-21 PBMC cells and PBMC cells were co-cultured in NK cell activation medium, and the cells collected after the culture was completed were activated NK cells; S3: Transfecting mIL-21 CircRNA into activated NK cells to obtain mIL-21 NK cells; co-culturing mIL-21 NK cells and activated NK cells in NK cell expansion medium, and the cells collected after the culture is completed are the expanded NK cells; S4: Transfection of mIL-21 CircRNA into expanded NK cells obtained from enhanced SA-mIL-21 NK cells.

2. The preparation method according to claim 1, characterized in that: The nucleotide sequence of mIL-21 CircRNA is shown as SEQ ID NO.

1.

3. The preparation method according to claim 1, characterized in that: The NK cell activation medium is KBM581 medium containing 100~1500IU / mL interleukin-2, 1vol%~5vol% inactivated autologous plasma and 50~100U / mL gentamicin.

4. The preparation method according to claim 1, characterized in that: mIL-21 PBMC cells and PBMC cells were co-cultured in NK cell activation medium at a ratio of 2-5:1 for 7 days. The cell density in the medium was 0.5-4.0×10 in the first 3 days. 6 The cell density in the culture medium was 0.3-1.5×10 6 Pieces / mL.

5. The preparation method according to claim 1, characterized in that: The NK cell expansion medium is KBM581 medium containing 200~1500IU / mL interleukin-2, 0.5vol%~5vol% inactivated autologous plasma and 50~100U / mL gentamicin.

6. The preparation method according to claim 1, characterized in that: mIL-21 NK cells and activated NK cells were co-cultured in NK cell expansion medium at a ratio of 3-10:1 for 13-15 days. The cell density in the medium was 0.3-1.5×10 6 Pieces / mL.

7. The preparation method according to claim 1, characterized in that: The transfection method was electroporation, and the working concentration of mIL-21 CircRNA during transfection was 0.1~1μg / 10 6 cells.

8. A self-enhanced SA-mIL-21 NK cell, characterized in that: Prepared by the preparation method according to any one of claims 1 to 7.

9. Use of the self-enhanced SA-mIL-21 NK cells according to claim 8 in the preparation of tumor therapeutic drugs.

10. The use according to claim 9, characterized in that: The tumor treatment drug is an adoptive immunotherapy drug for liver cancer.

Images