Rubber tree HbACS2 gene and application thereof

Abstract

The HbACS2 gene of the rubber tree is cloned from the rubber tree for the first time, and is shown as SEQ ID NO: 1. Researches show that the protein coded by the gene is a functional protein and can catalyze acetic acid and coenzyme A to generate acetyl coenzyme A under the energy supply of ATP (Adenosine Triphosphate). The HbACS2 gene can improve the tolerance of the strain to various stresses, for example, when the HbACS2 gene is transformed into escherichia coli, the resistance of the escherichia coli to sodium chloride, heavy metal ions such as copper and zinc, acetic acid and the like can be improved. The HbACS2 gene can also promote plant growth and improve the tolerance of the plant to various stresses, for example, when the HbACS2 gene is transformed into arabidopsis thaliana, the stem length, fresh weight, pod number, pod length and the like of the arabidopsis thaliana can be increased, the resistance of the arabidopsis thaliana to mannitol, an alkaline environment and the like can be improved, and in the mannitol or alkaline environment, the yield of the plant is increased. The plant leaf number, the main root length, the lateral root number, the whole plant fresh weight and the like are increased.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a rubber tree HbACS2 gene and application thereof. Background Art

[0002] Different tissues or cells of plants or specific plants will encounter hypoxia / anaerobic or other stresses in different habitats, which will stimulate the intensity of anaerobic respiration metabolism, such as the root cells of plants, the internal cells of tree stems, etc. This patent focuses on analyzing the role of anaerobic respiration metabolism initiated by plants in response to stress and better survival. Existing literature shows that anaerobic respiration metabolism can replenish energy for cells in a timely manner and increase the ability of plants to resist stress. However, the accumulation of acetaldehyde / acetic acid, the intermediate products produced by anaerobic respiration metabolism, will cause damage to cells and also lead to carbon source loss. Plant cells that have evolved for hundreds of millions of years have evolved a clever solution: either excrete ethanol or oxidize ethanol to acetic acid. The latter activates acetic acid into the key hub substance acetyl-CoA under the action of acetyl-CoA synthetase. Acetyl-CoA synthetase (ACS) is a key enzyme that catalyzes the activation and utilization of acetic acid. Under the action of this enzyme, anaerobic respiration is promoted in a direction that is conducive to energy production and the synthesis of other metabolites and even secondary metabolites. Therefore, anaerobic respiration is an indispensable respiratory metabolism mode for plants. There have been some studies on Arabidopsis, rice, poplar, cotton and other plants, but the function of ACS in rubber trees remains to be studied. The HbACS2 of the present invention belongs to the short-chain acetyl-CoA ligase family. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a rubber tree HbACS2 gene and application thereof.

[0004] The first aspect of the present invention is to provide a rubber tree HbACS2 gene, whose nucleotide sequence is shown in SEQ ID NO:1.

[0005] The second aspect of the present invention is to provide a protein encoded by the rubber tree HbACS2 gene according to the first aspect of the present invention.

[0006] The third aspect of the present invention is to provide a recombinant vector containing the rubber tree HbACS2 gene coding region described in the first aspect of the present invention.

[0007] Wherein, the original vector of the recombinant vector can adopt the vector commonly used in the field of gene recombination, such as virus, plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector adopts pET32a, pMAL-c5E, pCAMBIA1301, pET43.1a+MysB, etc., but it should be understood that the present invention can also adopt other plasmids, or viruses, etc.

[0008] The fourth aspect of the present invention is to provide a host bacteria or expression cassette containing the rubber tree HbACS2 gene coding region described in the first aspect of the present invention.

[0009] The fifth aspect of the present invention is to provide the use of the rubber tree HbACS2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria or expression cassette as described in the fourth aspect of the present invention in improving the resistance of Escherichia coli to acetic acid stress, and / or resistance to heavy metal copper stress, and / or resistance to heavy metal zinc stress, and / or resistance to sodium chloride.

[0010] The sixth aspect of the present invention is to provide the use of the rubber tree HbACS2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria or expression cassette as described in the fourth aspect of the present invention in improving plant resistance to mannitol stress and / or alkali stress.

[0011] The seventh aspect of the present invention is to provide the use of the rubber tree HbACS2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria or expression box as described in the fourth aspect of the present invention in increasing the number of plant leaves, and / or increasing the length of the main root, and / or increasing the number of lateral roots, and / or increasing the fresh weight of the whole plant under mannitol stress and / or alkali stress.

[0012] The eighth aspect of the present invention is to provide the use of the rubber tree HbACS2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria or expression box as described in the fourth aspect of the present invention in increasing plant stem length, and / or increasing plant fresh weight, and / or increasing plant fruit pod number, and / or increasing fruit pod length.

[0013] Wherein, the plant is preferably Arabidopsis thaliana.

[0014] The ninth aspect of the present invention is to provide an HbACS2-specific antibody, the amino acid sequence of the antigen epitope oligopeptide of which is AAREALAVQISPVVFD.

[0015] The present invention clones and obtains the rubber tree HbACS2 gene from the rubber tree for the first time. Studies have shown that the protein encoded by the gene is a functional protein that can catalyze acetic acid and coenzyme A to generate acetyl-CoA under ATP energy supply. The HbACS2 gene can improve the tolerance of the strain to various stresses, such as transforming the HbACS2 gene into Escherichia coli, which can improve its resistance to sodium chloride, heavy metal ions copper and zinc, acetic acid, etc. The HbACS2 gene can also promote plant growth and improve the tolerance of plants to various stresses, such as transforming the HbACS2 gene into Arabidopsis thaliana, which can increase the stem length, fresh weight, fruit pod number, fruit pod length, etc. of Arabidopsis thaliana, and can also improve the resistance of Arabidopsis thaliana to mannitol and alkaline environments, etc., and increase the number of plant leaves, taproot length, lateral root number, whole plant fresh weight, etc. under mannitol or alkaline environments. The present invention provides new candidate genes for research on improving strain stress resistance, promoting plant growth, and improving plant adaptability, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the tissue expression characteristic of HbACS2.

[0017] Figure 2 The expression characteristics of HbACS2 in different colloid-producing strains.

[0018] Figure 3 It is a modified prokaryotic protein expression vector.

[0019] Figure 4 The enzymatic curves of HbACS2 substrates acetate (upper figure) and CoA (lower figure).

[0020] Figure 5 The results of sodium chloride stress experiment (upper figure) and acetic acid stress experiment (lower figure) of Escherichia coli transformed with HbACS2 gene.

[0021] Figure 6 The results of copper chloride (upper figure) and zinc chloride (lower figure) stress experiments on Escherichia coli transformed with the HbACS2 gene.

[0022] Figure 7 Verification of Arabidopsis transgenic plants overexpressing HbACS2.

[0023] Figure 8 The results of ACS enzyme activity detection in Arabidopsis plants overexpressing HbACS2.

[0024] Fig. 9Results of the mannitol stress experiment on Arabidopsis thaliana seedlings overexpressing HbACS2. (A) shows the growth of control and transgenic plants on 1 / 2 MS medium; (B) shows the growth of control and transgenic plants on 1 / 2 MS + 100 mM mannitol medium.

[0025] Fig.10 Results of the experiment on the growth of Arabidopsis thaliana seedlings overexpressing HbACS2 on pH 8.0 medium. (A) shows the growth of control and transgenic plants on the control medium; (B) shows the growth of control and transgenic plants on the alkaline stress medium.

[0026] Fig.11 Characterization of Arabidopsis thaliana overexpressing HbACS2.

[0027] Fig.12 Arabidopsis thaliana plants overexpressing HbACS2. Detailed implementation mode

[0028] The present invention will be further described below with reference to the accompanying drawings and specific examples for better understanding. For those not specified in the examples in terms of specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments not specified for the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0029] Example 1: Cloning of the HbACS2 gene from Hevea brasiliensis

[0030] Using the latex cDNA of Hevea brasiliensis as a template and HbACS2F “ACCGACGACGACGACAAGATGAAGGTGGCGAGTTCACTATC” and HbACS2R “GCAGCCGGATCTCAGTGGTCAGCGATCAGCAAGTTCTATAAG” as primers, PCR amplification was carried out. PCR amplification reaction system: 50 μL reaction system, PCR amplification program: using 2ⅹPrimestar HS DNA polymerase high-fidelity enzyme reaction premix 25 μL, forward and reverse primers each 1 μL with a final concentration of 0.4 mM, cDNA 2 μL, supplemented with sterilized water ddH 2 O to 50 μL. The amplification program was: pre-denaturation at 95 °C for 3 minutes, denaturation at 98 °C for 10 seconds, annealing at 58 °C for 15 seconds, extension at 72 °C for 2 minutes, 28 cycles, fill-in at 72 °C for 5 minutes, and store at 12 °C. After the amplified product was recovered, it was sequenced to obtain an ACS gene named HbACS2, and its full-length CDS sequence is shown in SEQ ID No: 1 (excluding primer sequences).

[0031] Example 2 Expression characteristics of the HbACS gene

[0032] 1. Tissue expression characteristics of HbACS2

[0033] Based on the library information constructed from the cDNA obtained by randomly reverse-transcribing the total RNA of flowers, young stems, latex, bark, and leaves of the rubber tree clone Reyan 7-33-97, the expression levels of the HbACS2 gene in each tissue were analyzed. The expression level was measured in Reads Per Kilobase per Million mapped reads (RPKM), which represents the number of reads per kilobase length of a gene among every million reads, and plotted. The results are as Figure 1 shown. Tissue expression analysis revealed obvious specific expression of HbACS2. HbACS2 was expressed in all tissues of the rubber tree, and was highly expressed in the bark and leaves.

[0034] 2. Expression characteristics of HbACS2 in different latex-yielding clones

[0035] To explore the function of HbACS2, we examined the expression of HbACS2 in two clones, PR107 and Reyan 8-79, which represent different rubber yields. Using the cDNA obtained by randomly reverse-transcribing the total RNA of latex from the two clones as templates, real-time fluorescence quantitative PCR was performed with specific primers for the HbACS2 gene (qHbACS2f: 5'-CTCCGCCTCTCGTCTTTG-3'; qHbACS2r: 5'-CTCGGACACAACCGATTC-3'). The reaction system was as follows: a total volume of 20 μL, including 10 μL of TB Green Premix Ex Taq II FAST qPCR Mix (Takara), 2 μL of primers with a final concentration of 0.3 mM, 2 μL of 10 ng cDNA, and 6 μL of ddH2O, for a total of 20 μL. After an initial denaturation step at 95 °C for 3 min, amplification was carried out for 40 cycles at 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 45 s, followed by fluorescence reading. Finally, after incubation at 72 °C for 5 min, a melting curve was generated from 90 °C to 60 °C. The threshold cycle (CT) was manually adjusted, and the CT value of the housekeeping control gene elF1Ab, which was amplified in parallel on each plate with specific primers (F: 5'-TGGTGTTGGTGTGGTGATAG-3'; R: 5'-TATTCCTGCCCATCTTCCTTG-3'), was subtracted from the CT value of each target gene to generate a normalized CT value (ΔCT). The relative expression level was calculated using the ΔΔCT method. The results showed that the expression level of HbACS2 was higher in the relatively high-yielding clone Reyan 8-79 than in the relatively low-yielding clone PR107 ( Figure 2 ).

[0036] Example 3 HbACS2 protease activity assay

[0037] 1. Prokaryotic expression and purification of HbACS2

[0038] In order to better express and purify HbACS2 protein, we first modified the prokaryotic expression vector. Based on the pET43.1a vector, we constructed the pET43.1a+MysB prokaryotic expression protein vector, in which MysB replaced NusA in pET43.1a.

[0039] A. Construction method of pET43.1a+MysB vector

[0040] 1) The pET43.1a plasmid empty vector was double-digested with Nde I and Spe I to remove the NusA solubility-promoting gene.

[0041] 2) Using the genomic DNA of Escherichia coli DH5α as a template, the primers MysB-NdeF "tCtacatATGACCATGTACGCAACGct" and MysB-Spe-R "GATGactagtCGGACCCTGGAACAGCACCTCCAGacgttcatcccactcatcag" were designed. The reverse primer included the HRV3C protease cleavage site and the terminal protection base. The MysB gene was amplified by PCR, and the HRV3C protease cleavage site was successfully added to its C-terminus. The PCR product was recovered after double digestion with Nde I and Spe I, and then ligated to the pET43.1a vector linearized by Nde I and Spe I with T4 DNAligase (10 μL of the ligation system, including 10×T4 DNAligase buffer 1 μL, linearized pET43.1a vector 20 ng 2 μL, MysB gene fragment 10 ng 3 μL, T4 DNAligase 1 μL, ddH 2 O 3μL),

[0042] 3) Ligation was carried out overnight at 16°C, and the cloned bacteria Top10 was transformed. Colony PCR was performed, and a single colony of the correct size was selected for sequencing to confirm that the pET43.1a+MysB vector was successfully constructed. The nucleotide sequence is shown in SEQ ID No: 3.

[0043] B. Construction method of pET43.1a+MysB+HbACS2 vector

[0044] 1) The method and process are the same as above, based on the vector pET43.1a+MysB, and the full-length CDS of HbACS2 together with the following protease cleavage sites and six histidine His tags are constructed into the vector.

[0045] 1) First, use Sac I and Sal I to double-digest the linearized vector pET43.1a+MysB. The digestion system is: 1μl of Sac I enzyme, 1μl of Sal I enzyme, 10μl of 10x Fast Digest Buffer, 1μl of Fast AP, 10μl of 2μg of vector, and the rest is supplemented with ddH2O to 100μl. Mix the system and put it in a 16℃ water bath for 12h. Recover the cut vector and homologously connect it with the target fragment.

[0046] 2) The full-length CDS region of HbASC2 was amplified using homologous primers ACS2-EnthoF: "CGATTGATGACGACGACAAGATGAAGGTGGCGAGTTCAC" and ACS2-43hoR "GAACGCGTATCGATGGTACCTTAGCGATCAGCAAGTTCTATAAG", and the PCR product recovered by gel was recombined in vitro (homologous ligation reaction system, in a sterile PCR centrifuge tube, 2μl of 5×CE II Buffer, 1μl of Exnase II, 1μl of the vector after 50ng restriction enzyme digestion, and 3μl of the target fragment (the added mass is determined according to the length ratio of the vector and the target fragment), and the rest was supplemented with ddH 2 O to 10μl, mix the system and put it into a 37℃ water bath for homology arm ligation, incubate for 40min, transform the ligation product into TOP10 competent cells (mix thoroughly), put it on ice for at least 30min, spread it on agar medium containing ampicillin and culture it for 12h, pick a single plaque for colony PCR detection, send the positive clone for detection, and then extract the plasmid "pET43.1a+pMysB+HbACS2" of the bacteria with correct sequencing. The vector sequence is shown in SEQ ID No:4.

[0047] The schematic diagram of the modified vector fragment is as follows Figure 3 As shown: MysB was used to replace NusA in pET43.1a, and the full-length CDS of HbACS2 together with the following protease cleavage sites were constructed into the vector.

[0048] C. Expression and purification of 6×His-HbACS2 fusion protein

[0049] The plasmid pET43.1a+MysB+HbACS2 was transformed into the expression bacteria BL21(DE3)pLysS, and the pET43.1a+MysB empty vector plasmid was also transformed into the expression bacteria BL21(DE3)pLysS as a control bacteria. Then, using the empty vector strain and the expression strain, 5-10mL of LB liquid culture medium with carbenicillin + chloramphenicol was added, and cultured in a 37℃ incubator at 250rpm and 37℃ for about 16 hours. The next day, the control bacteria and the expression bacteria were transferred to 200ml culture medium at a ratio of 1:50, and cultured for another 2 hours. When the OD 600 When the measured value reached 0.4, the inducer isopropyl-β-D-thiogalactoside (IPTG) was added to the culture solution to a final IPTG concentration of 0.4 mM, and the induction culture was carried out at 160 rpm and 16°C for 20 hours. Then the bacteria were collected (10000rpm for 8 minutes), fully resuspended with (50mM Tris-HCl, pH 8.0+5mM KCl buffer), fully sonicated (the bacterial solution became clear, note that the ultrasonic amplitude should be maximum and the time should be 3 seconds for sonication and 5 seconds for rest, to prevent bubbles, and use ice water to dissipate heat), centrifuged (13000rpm, 25 minutes), the supernatant was collected, and digested with HRV3C overnight in a 4°C refrigerator (HRV3C enzyme 10U / mg bacteria), and then purified using His-tag protein, and the target protein was eluted with 250mM imidazole solution to obtain a single pure fusion protein His-HbACS2, which was dialyzed to remove imidazole and used for HbACS2 protease activity determination.

[0050] 2. HbACS2 protease activity assay

[0051] Principle: According to the following reaction equation, DTNB reacts with coenzyme A to generate a yellow substance. 412 The principle of nm having a specific absorption value is to measure OD by an enzyme-labeled instrument. 412 The consumption of substrate CoA and the ACS enzyme activity were calculated based on the absorbance change of 1:1 nm.

[0052] Reaction equation:

[0053] (1) acetic acid + CoA → (ACS catalyzed) Acetyl-CoA

[0054] (2)CoA-SH+DTNB→TNB+CoA-SS-TNB

[0055] When measuring enzyme activity, the content of coenzyme A remains unchanged while the reaction catalyzed by ACS changes. When the acetate group reacts with CoA to generate acetyl coenzyme A, the amount of remaining CoA is measured and mixed with DTNB colorimetric solution. The reaction product CoA-SS-TNB has a strong absorbance at 412nm, so the absorbance at 412nm is measured using a microplate reader. The amount of CoA participating in the reaction is obtained by subtracting the remaining CoA from the total amount, and the ACS enzyme activity is calculated.

[0056] a) First determine the optimal pH and temperature for HbACS2

[0057] (1) At 37°C, the enzyme activity of HACS2 was compared under 5 different pH gradients, and the optimal reaction pH value was obtained to be 8.2. Then, the enzyme activity of HACS2 was compared under 6 different temperature gradients (26°C, 28°C, 30°C, 35°C, 37°C, 40°C), and the optimal reaction temperature of HACS2 was calculated to be 35°C. The enzyme activity reaction system was: 110μL Tris-HCl buffer, pH=8.0, 10μL 10mM KCL, 10uL 10mM potassium acetate, 10uL 10mM coenzyme A, 10uL 20 mM ATP, 30μL ddH 2 O, 20 μL purified HbACS2 protein, after 1 hour of reaction, take 45 μL of reaction solution for each reaction and mix it with 90 μL of 5% trichloroacetic acid (TCA) to precipitate the protein and terminate the reaction. The solution after the termination of the reaction was placed in a centrifuge at 13000 rpm for 3 minutes to remove the precipitated protein. Then, take 120 μL of supernatant, add it to 680 μL of 0.1 mM DTNB (diluted by 0.5 M potassium phosphate buffer with a pH value of 7.5), and incubate at 30°C for about 10 minutes.

[0058] Take 200 μL three times and put it into three microwells of 96-well ELISA plate for three repeated measurements. Use Thermo Multiskan Go full-wavelength ELISA reader to measure the absorbance of OD412nm, and subtract the absorbance of the sample reaction system from the absorbance of the control (without substrate potassium acetate, other components are the same). According to the amount of substrate CoA consumed and the molar absorption constant ε = 13600M / cm, 1U is defined as the amount of enzyme used for 1μM CoA consumed per minute, and the measured difference is brought into it according to the constant to calculate the ACS enzyme activity. .

[0059] b) At the optimum pH and temperature, the reaction curves of the substrates acetic acid and CoA were measured. In the experiment with acetic acid substrate, acetic acid exists in the form of acetate in the reaction system, so potassium acetate is used in the experiment. During the reaction, the concentration of COA is kept constant. Similarly, when measuring COA, the concentration of acetate is kept constant. The results are shown in Tables 1 and Figure 4 .

[0060] Table 1 shows the final determination results of acetate substrate and CoA substrate. Figure 4 The upper and lower figures are the Michaelis-Menten curves of HbACS2 enzyme for two substrates. The horizontal axis is the concentration of the substrate (from low to high mM), and the vertical axis is the enzyme activity measured at different concentrations.

[0061] Table 1

[0062]

[0063] The Michaelis-Menten equations for the two substrates of HbACS2 are as follows Figure 3 As shown: At the optimum pH 8.2 and the optimal temperature 35°C, the Km of the acetate substrate was determined to be 0.2781 mM and Vmax was 117.3 nmol / min / mg protein ( Figure 4 Similarly, the CoA substrate has a Km = 0.6456 mM and a Vmax = 150.7 nmol / min / mg protein ( Figure 4 This experiment proves that HbACS2 catalyzes acetate and coenzyme A to produce acetyl-CoA, is a functional protein, and is an important enzyme for acetate activation.

[0064] Example 4 Escherichia coli experiment

[0065] Using seamless cloning technology, a pair of homologous primers HbACS2F "ACCGACGACGACGACAAGATGAAGGTGGCGAGTTCACTATC" and HbACS2R "GCAGCCGGATCTCAGTGGTCAGCGATCAGCAAGTTCTATAAG" were designed to construct the full-length CDS sequence of HbACS2 into the pET32a vector, and then the cloned bacteria Top10 were transformed, plated, and colony PCR was performed. Three bacteria with the correct size were selected for sequencing, and the plasmid was extracted from the bacteria with the correct sequence to obtain the pET32a-HbACS2 vector, which was then transformed into the expression bacteria BL21(DE3)pLysS. At the same time, the pET32a empty vector plasmid was also transformed into the expression bacteria BL21(DE3)pLysS. Then, the strain with the pMAL-c5E empty vector was used as the control strain, and the strain with the correct pET32a-HbACS2 vector was used as the expression strain. 5-10 mL of LB liquid culture medium with carbenicillin was added, and cultured in a small amount at 250 rpm in a 37°C incubator for about 16 hours. The next day, the control bacteria was stored in a 4°C refrigerator, and the expression bacteria was transferred to 100 ml of culture medium at a ratio of 1:50 and cultured for another 2 hours. When its OD 600When the measured value reached 0.4, add the inducer isopropyl-β-D-thiogalactoside (IPTG) to the expression strain culture medium to a final concentration of 0.4 mM IPTG, and induce the culture at 160 rpm and 20°C for 10 hours. 600 The measured value was adjusted to be close to 0.4. Then, this culture was used to prepare 300 mM NaCl solution, 10 mM CuCl 2 solution, 1mM acetic acid solution, 10mM ZnCl 2 Solution growth stress experiment.

[0066] That is, add 300mM NaCl solution and 10mM CuCl solution to the culture medium. 2 solution, 1mM acetic acid solution, 10mM ZnCl 2 solution and a final concentration of 10 mM copper chloride solution, and the OD was measured every hour 600 The growth of cells was tracked once, and the results were plotted into growth curves. The control bacteria and the expression bacteria were cultured under the same conditions throughout the whole process. Figure 5 As shown in the upper figure, compared with the control empty-loaded strain, the Escherichia coli carrying the transgenic HbACS2 gene grew better under sodium chloride stress.

[0067] The concentrations of E. coli were diluted 10000, 1000, 100 and 10 times, respectively, and spotted on the control and LB solid medium supplemented with acetic acid (final concentration of 1mM), and their growth was observed. Figure 5 As shown in the figure below, compared with the control empty-load strain, the E. coli carrying the transgenic HbACS2 gene grew better under acetic acid stress.

[0068] The results of the copper chloride stress experiment are as follows Figure 6 As shown in the figure above, compared with the control empty-load strain, the E. coli carrying the transgenic HbACS2 gene grew better under copper chloride stress.

[0069] The results of the zinc chloride stress experiment are as follows Figure 6 As shown in the figure below, compared with the control empty-load strain, the E. coli carrying the transgenic HbACS2 gene grew better under zinc chloride stress.

[0070] Example 5 Transgenic Experiment

[0071] 1. Construction of transgenic plants

[0072] Using seamless cloning technology, a pair of homologous primers ACS2-ATG-1301homo:CACGGGGGACTCTTGACCATGAAGGTGGCGAGTTCACTA and ACS2-TGA-1301homo:CTGGTCACCTGTAATTCACACTCAGCGATCAGCAAGTTCTATA were designed to construct the full-length CDS sequence of HbACS2 into the pCAMBIA1301 vector, and then transformed into the cloned bacteria Top10, plated, and tested by colony PCR. Three bacteria with the correct size were selected for sequencing, and plasmids and empty vector plasmids were extracted from the bacteria with the correct sequencing, and transformed into Agrobacterium LB4401 respectively. Then, the Agrobacterium strain with the empty vector and the correct expression strain were first cultured in a small amount at 250rpm in a 28°C incubator for about 20 hours, and then transferred to 200mL culture medium for large-scale culture. When their OD 600 When the measured value reaches 1.0-1.2, the bacteria are collected at 4000rpm, and the infection solution is prepared according to the Arabidopsis infection method. The collected bacteria are resuspended in the infection solution and infected with Arabidopsis buds in the flowering period. Each bacteria infects at least 8 small pots of Arabidopsis seedlings (4 plants per pot). After treatment, keep them moisturized in the dark for one day, and take them out and culture them normally on the second day. The seeds obtained are T0 generation. Later, these seeds are screened on 1 / 2MS+hygromycin medium, and the seedlings that can grow roots and true leaves are subcultured and harvested for individual seeds until the offspring are not separated and become pure lines.

[0073] After three generations of screening, three independent transgenic lines were obtained, named Ox-ACS-1, Ox-ACS-2 and Ox-ACS-3. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was used to analyze Arabidopsis gene expression. After preparing cDNA, specific primers qHbACS2f (5'-CTCCGCCTCTCGTCTTTG-3'), qHbACS2r (5'-CTCGGACACAACCGATTC-3') and Arabidopsis internal reference gene AtUBC21 were used as references (forward and reverse primers were 5'-CTTAACTGCGACTCAGGGAATCT-3' and 5'-GGCGAGGCGTGTATACATTTGT-3', respectively). The reaction system was: TB Green Premix Ex Taq II FAST qPCR mixed reaction solution (Takara Company) 10μL, 2μL of primers with a final concentration of 0.3mM, 2μL of 10ng of cDNA, 6μL of ddH2O, and a total of 20μL. After an initial denaturation step of 3 min at 95 °C, 40 cycles of amplification at 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 45 s were performed, followed by fluorescence readings. After a final incubation at 72 °C for 5 min, a melting curve from 90 °C to 60 °C was generated. The threshold cycle (CT) was manually adjusted, and the CT value of the housekeeping control amplified in parallel on each plate was subtracted from the CT value of each target gene to generate a normalized CT value (ΔCT). The ΔΔCT method was used to calculate the overexpression fold of transgenic plants. After qRT-PCR analysis, it was found that the three pure lines obtained were overexpressed with HbACS2, with relative expression levels as high as 354 to 618 times ( Figure 7 ) proved to be the correct overexpression strain.

[0074] 2. Enzyme activity and stress resistance of transgenic plants

[0075] The experiments were conducted using transgenic pure lines obtained after three generations of screening.

[0076] ① Enzyme activity

[0077] First, the harvested transgenic pure line seeds were sterilized with 2% plant tissue culture antibacterial agent ((Plant Preservative Mixture, PPM) at room temperature for 10 hours, rinsed with sterile water 5 times, and then planted on 1 / 2MS culture medium. After vernalization in a 4°C refrigerator for 2 days, the seeds were taken out and pre-cultured in a plant incubator. The incubator temperature was 22°C, the light was 12 hours of light, and the dark culture was 12 hours. When the main root length was about 1-1.5cM, it was transplanted into culture soil and placed in a greenhouse for culture. When the Arabidopsis thaliana had 8 true leaves, 1g of the control and transformed strains were taken, and quickly ground with 50mM Tris-HCL, pH8.0 buffer plus a small amount of quartz sand, and centrifuged at low temperature at 12000rpm for 15 minutes to remove impurities and prepare ACS protein crude enzyme solution.

[0078] The enzyme activity assay system and process are as follows:

[0079] (2) Prepare 200 μL of HbACS reaction premix, including 25 μL of 500 mM Tris-HCl (pH 8.0) (final concentration 50 mM), 25 μL of 100 mM MgCl2 (final concentration 10 mM), 25 μL of 100 mM ATP (final concentration 10 mM), 15 μL of 10 mM potassium acetate (final concentration 0.6 mM), and 15 μL of 10 mM coenzyme A (final concentration 0.6 mM). Make up to 200 μL with sterile water. At the same time, set up a control CK without potassium acetate (make up the excess with water). Mix the reaction premix prepared according to the above ingredients thoroughly, centrifuge slightly, and incubate in a 37°C water bath for 3 min. After taking out, add 25 μL of purified acetyl-CoA synthetase in turn to initiate the reaction, mix thoroughly, centrifuge slightly, and incubate in a 37°C water bath for 1 h.

[0080] (3) For each reaction, 45 μL of the reaction solution was mixed with 90 μL of 5% trichloroacetic acid (TCA) to precipitate the protein and terminate the reaction. The terminated solution was centrifuged at 13,000 rpm for 3 min to remove the precipitated protein.

[0081] (4) Then, 120 μL of the supernatant was taken and added to 680 μL of 0.1 mM DTNB (diluted with 0.5 M potassium phosphate buffer, pH 7.5), and incubated at 30°C for about 10 min.

[0082] (5) Take 200 μL three times and place it in three microwells of a 96-well ELISA plate for three replicate measurements. Use a Thermo Multiskan Go full-wavelength ELISA reader to measure the absorbance at OD412nm, and subtract the absorbance of the sample reaction system from the absorbance of the control (without substrate potassium acetate, other components are the same). According to the amount of substrate CoA consumed and the molar absorption constant ε = 13600 M / cm, 1 U is defined as the amount of enzyme used per minute for 1 μM CoA consumed. According to the constant, the measured difference is substituted into it to calculate the ACS enzyme activity ( Figure 8 ). The absorbance of the complete reaction system was subtracted from the absorbance of CK without potassium acetate. Compared with the control (WT), the ACS enzyme activity in the three Arabidopsis plants overexpressing HbACS2, ox-ACS-1, ox-ACS-2, and ox-ACS-3, was higher than that in the control.

[0083] ②Mannitol stress

[0084] First, the harvested transgenic pure line seeds were sterilized with 75% ethanol for 2 minutes, rinsed with sterile water for 3 times, then sterilized with 20-fold diluted bleach (containing 15% effective hypochlorous acid) for 10 minutes, rinsed with sterile water for 5 times, and then sterilized with 2% plant tissue culture antibacterial agent ((Plant Preservative Mixture, PPM) at room temperature for 10 hours. After rinsing with sterile water for 5 times, the seeds were planted on 1 / 2MS culture medium, vernalized in a 4°C refrigerator for 2 days, and then taken out and pre-cultured in a plant incubator. The incubator temperature was 22°C, the light was 12 hours of light, and the dark culture was 12 hours. When the taproot length was about 1-1.5cM, seedlings with the same growth were selected and placed on the control culture medium (normal culture medium) and 1 / 2MS+100mM mannitol stress culture medium (Manitol) in the same incubator for vertical culture. Observed every 2 days, photographed and analyzed every 6 days ( Fig. 9 ). Compared with the control, Arabidopsis seedlings overexpressing HbACS2 (ox-HbACS2) grew better on the medium containing 100 mM mannitol.

[0085] ③Alkali stress

[0086] On March 8, 2024, the harvested seeds were first disinfected with 75% ethanol for 2 minutes, rinsed with sterile water three times, and then disinfected with 20-fold diluted bleach (containing 15% effective hypochlorous acid) for 10 minutes. After rinsing with sterile water five times, they were disinfected with 2% plant tissue culture antimicrobial agent ((Plant Preservative Mixture, PPM)) at room temperature for 10 hours. After rinsing with sterile water five times, the seeds were planted on 1 / 2MS culture medium. After vernalization in a 4°C refrigerator for 2 days, they were taken out and cultured in a plant incubator. The incubator temperature was 22°C, the light intensity was 16 hours of light and 8 hours of darkness. After 3 days of cultivation, seedlings with the same growth were selected and placed on the control medium (normal medium) and the alkaline stress medium with pH 8.0 for vertical culture in the same incubator. The temperature of the culture room was controlled at 22-23°C, and the light intensity was 12 hours of light and 12 hours of darkness. Observation was performed every 2 days, and photos, measurements, statistics and analysis were performed on March 24.

[0087] The results are as follows Fig.10 As shown. Under alkaline stress of pH 8.0, seedlings overexpressing HbACS2 (ox-HbACS2) were more adaptable to growth than the control, as shown by the average number of leaves per plant of the transgenic plants being 8, the main root length being 1.4 cM, the lateral roots being 12, and the whole plant fresh weight being 0.0056 g / plant, while the control had 6 leaves per plant, the main root length being 1.0 cM, the lateral roots being 4, and the whole plant fresh weight being 0.0032 g / plant.

[0088] 3. Phenotype of plants overexpressing HbACS2

[0089] The fourth generation pure Arabidopsis seeds that had been tested by qRT-PCR were selected, and each generation had been screened and verified with hygromycin. On January 14, 2024, the harvested seeds were first disinfected with 75% ethanol for 1 minute, rinsed with sterile water 3 times, and then disinfected with 2% plant tissue culture antibacterial agent ((Plant Preservative Mixture, PPM) at room temperature for a day and night. After rinsing with sterile water 5 times, the seeds were planted on 1 / 2MS culture medium. After vernalization in a 4°C refrigerator for 2 days, they were taken out and cultured in a plant incubator. The incubator temperature was 22°C, the light was 16 hours of light and 8 hours of darkness. After 5 days of cultivation, they were transplanted into small culture pots on January 21, 2024, with 4 plants per pot, and placed in the plant culture room for unified fertilization and watering. The temperature of the culture room was controlled at 22-23°C, and the light was 16 hours of light and 8 hours of darkness. On March 12, 2024, we took pictures, counted, weighed and analyzed the transgenic plants and controls respectively. The results are as follows Figure 11-12 As shown in Table 2 ( Fig.11The stem length of the transgenic plants increased significantly, the fresh weight increased, the number of pods increased significantly, and the pod length also increased significantly, indicating that overexpression of HbACS2 can promote plant growth.

[0090] Table 2

[0091]

[0092] Example 6 HbACS2-specific antibody

[0093] We selected the HbACS2 specific amino acid oligopeptide C-AAREALAVQISPVVFD ("C" represents the oligopeptide at the C-terminus of the protein), after synthesis, coupled with the tag protein expression and purification, and then injected into rabbits (three times) to prepare specific polyclonal antibodies. The antibody was purified and tested for its specificity. Western protein blotting results showed that the antibody could specifically recognize the HbACS2 protein in rubber tree latex under the condition of 1:2000.

[0094] The specific examples of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific examples described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A rubber tree HbACS2 gene, characterized in that Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the rubber tree HbACS2 gene of claim 1.

3. A recombinant vector containing the rubber tree HbACS2 gene coding region according to claim 1.

4. A host bacteria or expression cassette containing the rubber tree HbACS2 gene coding region according to claim 1.

5. Application of the rubber tree HbACS2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector as claimed in claim 3, or the host bacteria or expression cassette as claimed in claim 4 in improving the resistance of Escherichia coli to acetic acid stress, and / or resistance to heavy metal copper stress, and / or resistance to heavy metal zinc stress, and / or resistance to sodium chloride.

6. Use of the rubber tree HbACS2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector as claimed in claim 3, or the host bacteria or expression cassette as claimed in claim 4 in improving plant resistance to mannitol stress and / or alkali stress.

7. Use of the rubber tree HbACS2 gene according to claim 1, or the protein according to claim 2, or the recombinant vector according to claim 3, or the host bacteria or expression cassette according to claim 4 to improve plant growth under mannitol stress and / or alkali stress; or Use of the rubber tree HbACS2 gene according to claim 1, or the protein according to claim 2, or the recombinant vector according to claim 3, or the host bacteria or expression cassette according to claim 4 in increasing the number of plant leaves, and / or increasing the length of the main root, and / or increasing the number of lateral roots, and / or increasing the fresh weight of the whole plant under mannitol stress and / or alkali stress.

8. Application of the rubber tree HbACS2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector as claimed in claim 3, or the host bacteria or expression cassette as claimed in claim 4 in improving plant stem length, and / or increasing plant fresh weight, and / or increasing plant fruit pod number, and / or increasing fruit pod length.

9. The use according to claim 7 or 8, characterized in that: The plant is Arabidopsis thaliana.

10. An HbACS2-specific antibody, characterized in that: The amino acid sequence of its antigen epitope oligopeptide is AAREALAVQISPVVFD.

Images