Specific probe, primer, kit and method for a nucleic acid sample

Abstract

The present invention provides a probe and primer combination, a standard product, a detection kit, a Real-time PCR detection method and their applications in detecting nucleic acid samples.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to a probe for detecting a nucleic acid sample, a probe and primer combination, a standard product, a Real-time PCR detection kit, and a detection method. Background Art

[0002] Rice transformant RN85zN-eJ is a transgenic rice material resistant to insects and glufosinate herbicide. It has excellent resistance to Lepidoptera pests such as Chilo suppressalis and good tolerance to glufosinate. Using this transformant can cultivate rice varieties resistant to insects and herbicides. Establishing a transformant-specific detection method can provide an effective detection means for the identification and supervision of genetically modified organisms and provide technical support for the safety management of agricultural genetically modified organisms.

[0003] The detection of transformant specificity mainly uses the ordinary PCR method, but its disadvantage is low sensitivity, and it cannot monitor the PCR process in real time and cannot be quantified. With the development of molecular biology technology, Real-time PCR (real-time fluorescence quantitative PCR) has been widely used in transgenic detection. Compared with the conventional PCR technology, it has the characteristics of short time consumption, simple operation, good specificity, and high sensitivity. The process can be monitored in real time, the results can be directly observed, and quantitative detection can be carried out.

[0004] The Real-time PCR method can be divided into two types: the dye method and the probe method. The fluorescent dye in the dye method Real-time PCR can bind to double-stranded DNA and emit fluorescence. Its binding is non-specific, and primer dimers, DNA templates, etc. in the system will all bind to it, so the specificity of the dye method is not high. In the probe method, the probe can specifically bind to the template, and its amplification curve reflects the accumulation of specific products and does not contain components of non-specific amplification. The sensitivity is 10 times higher than that of the dye method. In addition, the dye method only supports single-channel reactions. If multi-channel experiments are required, or different targets of the same sample are to be detected, the most commonly used method is still the probe method.

[0005] The rice transformant RN85zN-eJ and its detection method have been patented, with the application number 2025100877632. The detection method used is ordinary PCR, and the length of the PCR products between the designed detection primers is too large (929 bp and 753 bp), which is not suitable for direct use in real-time PCR. Summary of the Invention

[0006] To solve the above problems, the present invention provides a probe for detecting a nucleic acid sample, a probe and primer combination, a standard product, a detection kit, and a Real-time PCR detection method. The above nucleic acid sample can be the genomic DNA of the rice RN85zN-eJ transformant, or the genomic DNA of the RN85zN-eJ transformant derivative line, or the genomic DNA of the mixed rice material containing the RN85zN-eJ transformant, or a nucleic acid sample containing the RN85zN-eJ identity information separated from the above samples by methods such as PCR amplification. Since the sequence shown in SEQ ID NO. 1 is the specific sequence for confirming the identity information of the RN85zN-eJ transformant, any sample containing the nucleic acid molecule with the sequence shown in SEQ ID NO. 1 can be detected by the method provided by the present invention.

[0007] By designing highly sensitive and specific probes and primer pairs, the present invention can accurately identify the rice RN85zN-eJ transformant and separate it from conventional rice and other transgenic rice materials without RN85zN-eJ. This detection method has the advantages of high specificity, sensitivity, and operational convenience, making up for the disadvantages of the conventional PCR method, such as cumbersome procedures and low detection sensitivity.

[0008] The present invention provides a probe, characterized in that the nucleotide sequence of the probe is 5'-AACCCTGGCGTTACCCAACTTAATTGCA-3'.

[0009] In some embodiments, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. When the probe is in the free state, the fluorescence emitted by the fluorescent group will be absorbed by the quenching group; during the PCR amplification process, the 5' end fluorescent group of the probe tightly bound to the template will be cut by Taq enzyme, thus moving away from the 3' end quenching group, and the fluorescence emitted by the fluorescent group can be received by the instrument, and the generated fluorescence signal is proportional to the amount of the amplification product in the sample.

[0010] In some embodiments, the fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA, or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL, or MGB;

[0011] In some embodiments, the combination of the fluorescent group / quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2;

[0012] In the randomly selected fluorescence group and quenching group test experiments, the above-mentioned probes labeled with fluorescence group and quenching group can all obtain specific detection results. At the same time, the probe labeled with FAM at the 5'-end and BHQ1 at the 3'-end has the lowest labeling cost and can be used as the most preferred probe labeling scheme.

[0013] The present invention also provides a primer and probe combination, characterized in that: it includes the above-mentioned probe and two primers, and the nucleotide sequences of the primers are 5'-CTCTAAGAGGAGTGTCGACAAGCTT-3' and 5'-TTTGCTTGCCATACGGAGATC-3';

[0014] The above-mentioned probe and the probe and primer combination are selected through software design, experimental screening and verification, and are located at the downstream boundary of the exogenous insertion sequence in the RN85zN-eJ transformant.

[0015] The present invention also provides a standard product, characterized in that: the standard product is one or more nucleic acid samples with a concentration of not less than 30 copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1;

[0016] In some embodiments, the standard product is 5 concentrations of 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL and 3×10 copies / μL of RN85zN-eJ genomic DNA; the DNA sample contains the nucleic acid molecule shown in SEQ ID NO. 1;

[0017] In some embodiments, the preparation method of the standard product is: taking an RN85zN-eJ genomic DNA sample with a concentration of 1.5 μg / μL and diluting it 10 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times.

[0018] The present invention also provides a detection kit, characterized in that: the detection kit includes the above-mentioned probe and primer combination and the above-mentioned standard product;

[0019] In some embodiments, the detection kit includes:

[0020] Primer 1, with the sequence 5'-CTCTAAGAGGAGTGTCGACAAGCTT-3';

[0021] Primer 2, with the sequence 5'-TTTGCTTGCCATACGGAGATC-3';

[0022] Probe, with the sequence 5'-AACCCTGGCGTTACCCAACTTAATTGCA-3';

[0023] Standard, consisting of 5 RN85zN-eJ genomic DNA samples with concentrations of 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL and 3×10 copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1;

[0024] Among them, the 5' end of the probe is labeled with the fluorescent group FAM, and the 3' end is labeled with the quenching group BHQ1.

[0025] The present invention also provides a Real-time PCR detection method, characterized in that: using the above detection kit for Real-time PCR detection, wherein the final concentrations of primer 1 and primer 2 in the PCR reaction system are both 0.3 μM, and the final concentration of the probe is 0.15 μM.

[0026] The present invention also provides the application of the above probe, probe and primer combination, standard, detection kit, and detection method in qualitatively or quantitatively detecting nucleic acid samples; wherein, the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.

[0027] The beneficial effects of the present invention are: through software design and multiple experimental screenings, a combination of 1 probe and 2 primers was obtained from a large number of probe primer combinations. On this basis, a Real-time PCR detection method was established and optimized using standard products with appropriate concentration gradients. Using the above probe, probe and primer combination, standard, detection kit, and Real-time PCR detection method, nucleic acid samples containing SEQ ID NO. 1 with a concentration of not less than 30 copies / μL can be specifically detected, and RN85zN-eJ materials can be effectively distinguished from other rice materials without RN85zN-eJ, with extremely high sensitivity and specificity. Description of the Drawings

[0028] By reading the detailed description of the non-restrictive embodiments with reference to the following drawings, other features, purposes, and advantages of the present application will become more obvious:

[0029] Figure 1 Standard curve and linear equation.

[0030] Figure 2 Specific sample detection test. Among them, 1: a mixed sample of Nipponbare and RN85zN-eJ (sample 1); 2: a mixed sample of Nipponbare and RN85zN-eH (sample 2). Detailed implementation manners

[0031] The present invention will be further described below in conjunction with the accompanying drawings. The following examples are only used to illustrate the present invention but do not limit the scope of the present invention.

[0032] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves, and roots, and the above plant parts are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecule of the present invention and thus at least partially consist of transgenic cells.

[0033] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences (5' non-coding sequences) before the coding sequence and regulatory sequences (3' non-coding sequences) after the coding sequence. A "natural gene" refers to a gene that is naturally found with its own regulatory sequences. A "chimeric gene" refers to any gene that is not a natural gene and contains regulatory and coding sequences that are not naturally found. An "endogenous gene" refers to a natural gene that is located at its natural position in the genome of an organism. An "exogenous gene" refers to a foreign gene that currently exists in the genome of an organism and did not originally exist, and also refers to a gene introduced into a recipient cell through a transgenic step. An exogenous gene can include a natural gene or a chimeric gene inserted into a non-natural organism. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where recombinant DNA has been inserted can be referred to as an "insertion site" or a "target site".

[0034] Transformation procedures that result in random integration of foreign DNA lead to transformants with different flanking regions, which are specific to each transformant. When recombinant DNA is introduced into a plant by traditional hybridization, its flanking regions generally do not change. Transformants also contain unique junctions between the heterologous insert DNA and segments of genomic DNA or between two segments of genomic DNA or between two heterologous DNAs. A "junction" is the point where two specific DNA fragments are joined. For example, a junction exists at the position where the insert DNA joins the flanking DNA. Junction points also exist in the transformed organism where two DNA fragments are joined together in a manner found in the natural organism. "Junction DNA" refers to the DNA that contains the junction point.

[0035] The RN85zN-eJ transformant is a plant and seed comprising the transgenic rice RN85zN-eJ and its plant cells or its renewable parts, and the plant parts of RN85zN-eJ include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves, and products from the rice plant RN85zN-eJ, such as rice, straw, rice husks, rice oil, cooked rice, rice flour, rice bran, rice bran layer, and biomass remaining in the rice crop field.

[0036] The term "probe" is a segment of isolated nucleic acid molecule to which a conventional detectable label or reporter molecule is attached, such as a radioisotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to one strand of the target nucleic acid. In the present invention, the probe is complementary to one DNA strand from the genome of the transgenic rice RN85zN-eJ, whether the genomic DNA is from the transgenic rice RN85zN-eJ or its seeds, or from plants or seeds or extracts of transgenic rice RN85zN-eJ and other derivative lines, or a nucleic acid molecule containing the identity information of RN85zN-eJ isolated from RN85zN-eJ. The probes of the present invention include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0037] The term "primer" is a segment of isolated nucleic acid molecule that anneals and binds to a complementary target DNA strand through nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (such as DNA polymerase). The primer pairs of the present invention relate to their application in the amplification of target nucleic acid sequences, such as by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0038] Example 1 Design and screening of specific primer / probe combinations

[0039] The specific detection method of the transformant requires designing primers and probes at the boundary sequences upstream and downstream of the insertion site, and the PCR amplification product needs to include the exogenous sequence and the rice genome sequence. The insertion position of the exogenous fragment of the rice transformant RN85zN-eJ in the rice genome is Chr2: 26846963-26846988 bp, and the full-length insertion sequence is shown in SEQ ID NO. 4, including the upstream genomic flanking sequence (1-342 bp), the exogenous sequence (343-6363 bp), and the downstream genomic flanking sequence (6364-6705 bp). First, design primers and probes according to the boundary sequences of the rice RN85zN-eJ insertion site.

[0040] 1. Design primer and probe combinations

[0041] Input a part (100-600 bp) of the upstream or downstream boundary sequence (or its reverse complementary sequence) into software (such as ABI Primer Express 3.0). This template sequence must contain both the rice genome sequence (with a length of at least 50 bp) and the exogenous insertion sequence (with a length of at least 50 bp). Two of the template sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0042] After setting the relevant parameters in the software according to the following requirements, dozens of primer and probe combinations were obtained in total, and each combination contains 2 primers and 1 probe.

[0043] The probe and primers meet all the following requirements:

[0044] ① The length of the primer is between 18 and 25 bp, and the length of the probe is between 18 and 30 bp;

[0045] ② The Tm value of the primer is between 58 and 60 °C, and the Tm value of the probe is 8-10 °C higher than that of the primer;

[0046] ③ Avoid generating complementary sequences of more than 3 bases inside the probe, inside the primer, or between the probe and the primer;

[0047] ④ The first base at the 5' end of the probe is not G;

[0048] ⑤ The amplification products of the two primers should contain at least 11 bp of the rice genome sequence and at least 11 bp of the exogenous insertion sequence.

[0049] ⑥ The length of the PCR product is between 80-300 bp.

[0050] Finally, select 5 groups of primers and probes with higher software scores as candidate combinations for further screening. The candidate combinations are shown in Table 1.

[0051] Table 1 Five groups of candidate primers and probes with higher software design scores

[0052] Combination Primer 1 Primer 2 Probe P A1 TGGCCGTCGTTTTACAACGT TCACCTGGAACGATCCATCTT AACCCTGGCGTTACCCAACTTAATTGCA A2 CACTGGCCGTCGTTTTACAA TCACCTGGAACGATCCATCTTTG AACCCTGGCGTTACCCAACTTAATTGCAAT A3 TGGCCGTCGTTTTACAACGT TCACCTGGAACGATCCATCTTTG AACCCTGGCGTTACCCAACTTAATTGCAA A4 CCGCATAACTTCGTATAGCCTACA TCACCTGGAACGATCCATCTT AACCCTGGCGTTACCCAACTTAATTGCA A5 CTCTAAGAGGAGTGTCGACAAGCTT TTTGCTTGCCATACGGAGATC AACCCTGGCGTTACCCAACTTAATTGCA

[0053] 2. Primer synthesis and screening

[0054] Synthesize the five groups of primers shown in Table 1 and conduct specific primer screening. The screening process is as follows:

[0055] (1) Use ordinary PCR amplification reaction to detect primer 1 and primer 2 of the five candidate combinations. The electrophoresis results are shown in Table 2. The results show that combination A4 amplified two bands, that is, there was non-specific amplification; combinations A1, A2, A3, and A5 amplified a single specific band of the expected size. Therefore, combination A4 was eliminated; primer 1 and primer 2 of combinations A1, A2, A3, and A5 met the requirements and were further tested.

[0056] Table 2 Screening specific primers by ordinary PCR

[0057] Combination Number of amplified bands Band size (bp) Whether it meets the requirements A1 1 <100 Yes A2 1 <100 Yes A3 1 <100 Yes A4 2 100-250，＞250 No A5 1 100-250 Yes

[0058] (2) Use SYBR Green dye method Real-time PCR reaction to detect primer 1 and primer 2 of combinations A1, A2, A3, and A5. The Real-time PCR reaction results are shown in Table 3. The results show that: the amplification curves of combinations A1, A2, and A3 were normal, and the Ct values < 35, but the melting curves were all double peaks; the amplification curve of combination A5 was normal, and the Ct value < 35, and the melting curve was a single peak. Therefore, combinations A1, A2, and A3 were eliminated; primer 1 and primer 2 of combination A5 met the requirements and could be further tested.

[0059] Table 3 Screening specific primers by SYBR Green dye method Real-time PCR

[0060] Combination Amplification curve Ct value Dissolution curve Whether it meets the requirements A1 Yes 31.56 Double peaks No A2 Yes 32.26 Double peaks No A3 Yes 33.31 Double peaks No A5 Yes 28.96 Single peak Yes

[0061] 3. Probe synthesis and screening

[0062] Synthesize the probe of combination A5, modify the 5' end with the fluorescent labeling group FAM and the 3' end with the fluorescent quenching group BHQ1.

[0063] Use probe method Real-time PCR reaction to detect the primers and probes of combination A5. The reaction results are shown in Table 4. The results show that: combination A5 amplified successfully, and the Ct value was 28.17.

[0064] Therefore, combination A5 can be used as the primers and probes for quantitative detection of rice transformant RN85zN-eJ.

[0065] Table 4 Probe method Real-time PCR screening specific primers and probe combinations

[0066] Combination Amplification curve Ct value Screening result A5 Yes 28.17 √

[0067] The probe and primer of combination A5 are located at the downstream boundary of the exogenous insertion sequence. The sequence is as follows (lowercase letters are vector sequences, uppercase letters are genomic sequences), and the positions of the probe and primer of combination A5 are marked (underlined sequences represent primers, and bold sequences represent probes):

[0068] ctctaagaggagtgtcgacaagctt ggcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaactTAATTGCAATTTGCGAGGCAAAGATGGATCGTTCCAGGTGAGCAGCAGAG GATCTCCGTATG GCAAGCAAA

[0069] The primer and probe sequences are as follows:

[0070] Primer 1: 5'-CTCTAAGAGGAGTGTCGACAAGCTT-3'

[0071] Primer 2: 5'-TTTGCTTGCATACGGAGATC-3'

[0072] Probe P: FAM-AACCCTGGCGTTACCCAACTTAATTGCA-BHQ1

[0073] Example 2 Preparation of Standards

[0074] To quantitatively analyze the initial template amount of a sample using real-time PCR, it is necessary to use a standard sample with a known copy number to make a standard curve, then obtain the Ct value of the sample to be tested through PCR, and finally calculate the copy number of the sample from the standard curve. Therefore, first of all, it is necessary to prepare a suitable standard sample, and the preparation method is as follows:

[0075] 1. Extraction of genomic DNA from rice RN85zN-eJ

[0076] The CTAB method was used for extraction. The specific steps are as follows:

[0077] 1) Take 0.2 g of rice RN85zN-eJ leaves, grind them into powder, add 500-800 μL CTAB, and incubate at 65℃ for 0.5 h;

[0078] 2) Add 700 μL of chloroform or chloroform:isoamyl alcohol (24:1), shake gently, centrifuge at 12,000 rpm for 15 min, and take 400 - 700 μL of the supernatant;

[0079] 3) Add 1 mL of pre-cooled absolute ethanol or isopropanol, mix well, centrifuge at 12,000 rpm for 10 min, and discard the supernatant;

[0080] 4) Wash the precipitate with 75% alcohol, centrifuge at 12,000 rpm for 5 min, discard the alcohol, and invert to absorb and dry;

[0081] 5) Dissolve the DNA with 50 μL of ddH2O, take 5 μL for electrophoresis detection, and then measure the DNA concentration with a UV spectrophotometer to be 1.5 μg / μL.

[0082] II. Preparation of standard products with a series of concentration gradients

[0083] When performing Real-time PCR, the concentration of the standard product template needs to be in the unit of "copies / μL".

[0084] Calculation formula:

[0085] Template concentration (copies / μL) = Avogadro's constant × template mole number, where Avogadro's constant = 6.02×10 23 copies / mol, and template molecular weight = template DNA length (number of bases) × 660 (average molecular weight of bases).

[0086] According to the above formula, the RN85zN-eJ genomic DNA solution with a concentration of 1.5 μg / μL is 6.02×10 23 copies / mol × (1.5×10 -6 g / μL) / (460×10 6 × 660 g / mol), which is 3×10 6 copies / μL

[0087] Take 1 μL of the above solution and perform 10-fold serial dilution to obtain standard products with concentrations of 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 copies / μL, and 3 copies / μL. Store at -20°C for later use.

[0088] Example 3 Establishment and optimization of the probe-based Real-time PCR reaction system

[0089] The present invention obtained available probe and primer combinations through the operation of Example 1, and obtained a series of standard products with concentration gradients through Example 2. However, whether the specific Real-time PCR reaction system can have better effects is also affected by factors such as primer and probe concentrations. Therefore, in order to obtain efficient and accurate quantitative results, it is necessary to further optimize the PCR reaction system.

[0090] I. Establish a preliminary Real-time PCR reaction system

[0091] By diluting the primer and probe combination A5 screened in Example 1 and adding deionized water to dilute its concentration to a working solution of 10 μM, probe-based Real-time PCR amplification was carried out to establish a reaction system.

[0092] The PCR reaction system is as follows: 2×qPCR Mix 10 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 10 μM probe 0.25 μL, template DNA 1 μL, and ddH2O is added to make up the total volume to 20 μL. RN85zN-eJ genomic DNA was used as the template, and ddH2O was used as the blank control.

[0093] The Real-time PCR reaction program is as follows: 95°C for 10 min; 95°C for 10 s, 60°C for 20 s, 72°C for 40 s (fluorescence signal collection), and a total of 40 - 45 cycles are carried out.

[0094] II. Optimize the Real-time PCR reaction system

[0095] Five concentration gradients of the final primer concentration were set, which were 0.2, 0.3, 0.4, 0.5, and 0.6 μM respectively, and the corresponding probe concentration was 1 / 2 times the primer concentration. The Real-time PCR test results of each treatment are shown in Table 5.

[0096] Table 5 Tests of different primer and probe concentrations

[0097] Final concentration of primer (μM) Final concentration of probe (μM) Ct 0.2 0.1 29.11 0.3 0.15 26.35 0.4 0.2 29.24 0.5 0.25 31.62 0.6 0.3 32.04

[0098] The results show that: in the PCR reaction system with a primer concentration of 0.3 μM and a probe concentration of 0.15 μM, the Ct value is the smallest and the fluorescence signal value is the highest. Therefore, it was determined that the final primer concentration for subsequent experiments is 0.3 µM and the probe concentration is 0.15 μM.

[0099] The optimized reaction system is as follows:

[0100] 2×qPCR Mix 10 μL, 0.6 μL of 10 μM forward primer, 0.6 μL of 10 μM reverse primer, 0.3 μL of 10 μM probe, 1 μL of template DNA, and ddH2O was added to make the total volume up to 20 μL. Using the genomic DNA of RN85zN-eJ as the template and ddH2O as the blank control.

[0101] Example 4 Sensitivity Test

[0102] Sensitivity refers to the lowest copy number of a sample that can be detected by a PCR amplification reaction, i.e., the lowest detection limit. When detecting standard products with different concentrations by Real-time PCR, if a standard product at a certain concentration does not show a typical amplification curve or can form an amplification curve but the Ct value > 35, it is considered that the standard product at this concentration exceeds the lowest detection limit of the PCR system.

[0103] Using the probe and primer combination A5 described in Example 1, the reaction system optimized in Example 3, and using the standard products in Example 2 (concentrations of 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 copies / μL, and 3 copies / μL) as templates (3 parallel tests for each concentration), with ddH2O as the blank control, Real-time PCR amplification was carried out to determine the lowest detection limit of the detection method of the present invention. According to the fluorescence signal detected by the instrument, the amplification curve was obtained, and the Ct value was recorded (Table 6). The results showed that when the concentration of the standard product < 30 copies / μL, the Ct value of the amplification curve > 35. Therefore, the lower detection limit of Real-time PCR is 30 copies / μL.

[0104] The above sensitivity detection results indicate that when the concentration of the transformant in the sample is lower than 30 copies / μL, the Ct value of the amplification curve is greater than 35, that is, it is considered that the RN85zN-eJ transformant is not detected in the sample, and the detection result is negative.

[0105] Table 6 Results of Sensitivity Test

[0106] Sample 1 2 3 4 5 6 Template concentration (copies / μL) <![CDATA[3×10 5 > <![CDATA[3×10 4 > <![CDATA[3×10 3 > <![CDATA[3×10 2 > 3×10 3 Ct 22.77 25.32 27.80 30.63 33.38 36.64

[0107] Example 5 Plotting the Standard Curve

[0108] Using multiple standard products with gradient concentrations as templates for Real-time PCR and recording the Ct values, the standard curve was plotted according to the initial template amount (logarithm of the copy number) and the Ct value to obtain the standard equation. When it is necessary to quantify the initial template of the sample to be tested, only the amplification curve needs to be obtained, the Ct value is read, and the initial template amount of the sample to be tested can be calculated by substituting it into the standard equation.

[0109] Using the standard products of Example 2 (concentrations of 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL, 3×10 copies / μL) as templates (3 parallel tests for each concentration), ddH2O as the blank control, using the primer / probe combination A5 of Example 1, and adopting the reaction system of Example 2, Real-time PCR amplification was carried out.

[0110] Taking the logarithm of the standard product concentration as the abscissa and the Ct value as the ordinate, a standard curve was plotted, as shown in Figure 1 . The standard curve equation of the present invention is y = -2.5443x + 36.804 (y represents the Ct value, x is the logarithm of the copy number), the standard curve shows a good linear relationship, R² = 0.9932, the correlation coefficient is high, meeting the requirements of Real-time PCR quantitative detection.

[0111] Example 6 Detection Kit

[0112] A kit for detecting rice RN85zN-eJ was prepared according to the following composition: 2×qPCR Mix, 10 μM forward primer, 10 μM reverse primer, 10 μM probe, the standard product of Example 2, and ddH2O.

[0113] The primer and probe are the combination A5 described in Example 1.

[0114] The reaction system of this kit can be: 2×qPCR Mix 10 μL, 10 μM forward primer 0.6 μL, 10 μM reverse primer 0.6 μL, 10 μM probe 0.3 μL, template DNA 1 μL, ddH2O 7.5 μL, and the total reaction volume is 20 μL.

[0115] The reaction program of this kit for Real-time PCR is: 95°C for 10 min; 95°C for 10 s, 60°C for 20 s, 72°C for 40 s (collecting fluorescence signals), and a total of 40 - 45 cycles are carried out.

[0116] When applying this kit to detect samples, the amplification curve is obtained through the fluorescence signals detected by the instrument, and the copy number of the sample is calculated according to the standard equation established with the standard product and the Ct value of the sample to be detected.

[0117] Example 7 Specificity Test and Sample Detection

[0118] Extract the genomic DNA of rice transformant RN85zN-eJ, receptor control Nipponbare, and other transformant material RN85zN-eH using the DNA extraction method (CTAB method) of Example 2

[0119] Mix the genomic DNA of Nipponbare and RN85zN-eJ as Sample 1, and mix the genomic DNA of Nipponbare and RN85zN-eH as Sample 2. Use pure water as the blank control, and perform Real-time PCR amplification using the kit described in Example 6 and the reaction system of Example 3 for specific test detection. Obtain the amplification curve based on the fluorescence signal detected by the instrument, as Figure 2 shown

[0120] Calculate the copy number according to the Ct value of each sample in the amplification curve. The results are shown in Table 7: The Ct value of the amplification curve of Sample 1 is 22.90, and the copy number is 291584, and the test result is positive; the Ct value of the amplification curve of Sample 2 is greater than 35, and the copy number is lower than the lowest detection limit of 30 copies / μL. Therefore, the test result is negative. Thus, it can be seen that the detection system established by the present invention has good specificity

[0121] Table 7 Detection results of specific tests for test samples

[0122] Sample Ct Copy number 1 22.90 291584 2 38.41 0.23 <![CDATA[ddH2O]]> - -

[0123] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make changes or modifications to equivalent embodiments by using the above-disclosed technical content without departing from the technical solution of the present invention. However, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention

Claims

1. A probe and primer combination, characterized in that The nucleotide sequence of the probe is 5'-AACCCTGGCGTTACCCAACTTAATTGCA-3', and the nucleotide sequences of the primers are 5'-CTCTAAGAGGAGTGTCGACAAGCTT-3' and 5'-TTTGCTTGCCATACGGAGATC-3'.

2. The probe and primer combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group; The fluorescent group is any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA or Texas; the quenching group is any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL or MGB.

3. The probe and primer combination according to claim 2, characterized in that: The combination of the fluorescent group and the quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA or VIC / BHQ2.

4. The probe and primer combination according to claim 3, characterized in that: The fluorescent group is FAM; the quenching group is BHQ1.

5. A kit, characterized in that: The kit comprises the probe and primer combination according to any one of claims 1 to 4 and a standard; Wherein, the standard is a RN85zN-eJ sample with a concentration of not less than 30 copies / μL; Among them, the RN85zN-eJ sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO.

1.

6. The kit according to claim 5, characterized in that: The standard substances are 5 kinds of concentrations, 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3 copies / μL, 3×10 2 copies / μL and 3×10 copies / μL of RN85zN-eJ genomic DNA.

7. Real-time PCR detection method, characterized in that: Real-time PCR detection is performed using the kit described in any one of claims 5 to 6, wherein the final concentration of primers in the PCR reaction system is 0.3 μM, and the final concentration of the probe is 0.15 μM.

8. Use of the probe and primer combination according to any one of claims 1 to 4, the kit according to any one of claims 5 to 6, and the detection method according to claim 7 in quantitative detection of RN85zN-eJ samples; in, The RN85zN-eJ sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.

Images