Probiotics capable of dispelling effects of alcohol and application of probiotics

Abstract

The invention relates to the technical field of functional microorganisms, in particular to a lactobacillus fermentum strain capable of dispelling effects of alcohol and application of the lactobacillus fermentum strain. The lactobacillus fermentum is at least one strain selected from the group consisting of lactobacillus fermentum ibiome020, lactobacillus fermentum ibiome021 and lactobacillus fermentum ibiome022, and the lactobacillus fermentum provided by the invention is a natural bacterium derived from the intestinal tract of a healthy person, is a food directory bacterium, and is high in safety; high-concentration acetaldehyde can be metabolized, a series of discomfort of a human body caused by acetaldehyde accumulation and damage to organs and functions of the human body are prevented, and symptoms such as dizziness, headache, nausea and vomiting and hangover after drinking are relieved; meanwhile, ethanol metabolism capability is achieved, and decomposition of alcohol / ethanol is accelerated; the compound also has excellent gastrointestinal fluid resistance and cholate resistance, can adapt to complex in-vivo environments, can keep activity in a human body, and can play a better role.

Description

Technical Field

[0001] The present invention relates to the technical field of functional microorganisms, and in particular to a Lactobacillus fermentum strain capable of relieving alcohol and its application. Background Art

[0002] Alcohol is a psychoactive substance with addictive properties, permeating daily life, social economy, and cultural activities. Drinking behavior is very common in people's daily lives, and only 5% of adults never touch alcohol in their lifetime. According to a report released by the World Health Organization in 2020, more than 3 million people worldwide die each year due to the harmful use of alcohol, accounting for 5.3% of the total number of deaths. Alcohol is one of the causative factors of more than 200 diseases, injuries, and other health problems. Alcohol dependence and its related problems are the third global public health problem after cardiovascular diseases and tumors, attracting the common attention of the whole society.

[0003] The metabolism of alcohol in the body involves two steps: First, under the action of "alcohol dehydrogenase (ADH)", alcohol is decomposed into toxic acetaldehyde; Second, under the action of "acetaldehyde dehydrogenase (ALDH)", acetaldehyde is decomposed into non-toxic acetic acid. East Asian populations have defects in the genes of alcohol dehydrogenase and acetaldehyde dehydrogenase, with poor alcohol metabolism ability. Therefore, supplementing exogenous ADH and ALDH has great research significance and application prospects.

[0004] Currently, the main anti-alcohol and liver-protecting products on the market are combined preparations of traditional Chinese medicine extracts, which only focus on shortening the drunkenness time and reducing the drunkenness rate, without paying attention to the damage caused by the large accumulation of acetaldehyde, an intermediate metabolite of alcohol metabolism, to the human body; probiotic anti-alcohol products can degrade ethanol, but with low efficiency. Probiotics can protect gastrointestinal health and improve immunity, etc. Therefore, it is a good idea to develop probiotics that can efficiently degrade ethanol and / or acetaldehyde. We have discovered Lactobacillus fermentum that can rapidly and efficiently metabolize ethanol and acetaldehyde, and is resistant to gastrointestinal fluids and bile salts. Summary of the Invention

[0005] In order to efficiently metabolize ethanol and harmful intermediate metabolite acetaldehyde after drinking, the present invention provides a Lactobacillus fermentum that can rapidly and efficiently metabolize ethanol and acetaldehyde.

[0006] The present invention is achieved through the following technical solutions:

[0007] The present invention protects the use of a microbial strain, or a culture of the microbial strain or a processed product thereof in the preparation of an anti-alcoholism drug, wherein the microbial strain belongs to Limosilactobacillus fermentum and has a 16s rRNA sequence with at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identity to SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3.

[0008] In the present specification, the term "culture" refers to a population of Limosilactobacillus fermentum suspended in a culture medium under conditions suitable for the survival and / or growth of Limosilactobacillus fermentum. As will be clearly understood by those of ordinary skill in the art, in some aspects, these terms used herein refer to a combination comprising a population of Limosilactobacillus fermentum and the culture medium in which the population is suspended. In another aspect, these terms used herein also refer to the culture supernatant and culture components after the completion of the culture of Limosilactobacillus fermentum of the present invention. In the present invention, the culture includes, but is not limited to: a bacteria-containing solution, a culture supernatant or a bacteria-containing culture medium obtained by inoculating or transplanting Limosilactobacillus fermentum into a culture medium in any form (liquid or solid).

[0009] In the present specification, the term "processed product" refers to anything that is derived from the culture without particular limitation, and can be obtained by processing such as concentration, gelatinization, spray drying, freeze drying, vacuum drying, drum drying, liquefaction, dilution, pulverization, etc. of the culture. In these processes, well-known methods can be appropriately used.

[0010] In the present invention, in the culture or the processed product, the microbial strain of the present invention can be viable bacteria or dead bacteria.

[0011] In the present specification, the term "strain" can be directly obtained by culturing a deposited strain, or can be a progeny strain (offspring) or a strain cultured from the original strain (subcloned strain).

[0012] Preferably, the anti-alcoholism drug includes at least one of the following: a drug for relieving chronic / acute alcoholism; a drug for relieving alcoholic intestinal injury or alcoholic liver injury.

[0013] Furthermore, the anti-hangover drug can reduce the mortality rate of mammals and the liver index, decrease the contents of liver injury indicators AST and ALT in the serum, and increase the content of GSH in the liver.

[0014] The present invention protects the use of a fermenting agent / functional bacterial agent / nutritional composition in the preparation of products for anti-hangover and / or liver protection. The fermenting agent / functional bacterial agent / nutritional composition contains Limosilactobacillus fermentum strains, or their cultures or processed products, and the strains have a 16s rRNA sequence with at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identity with SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3.

[0015] The present invention protects the use of microbial strains, or cultures or processed products of the microbial strains, fermenting agents, functional bacterial agents or nutritional compositions in anti-hangover not for the purpose of diagnosing and treating diseases. The microbial strains belong to Limosilactobacillus fermentum and have a 16s rRNA sequence with at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identity with SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3; the fermenting agent / functional bacterial agent / nutritional composition contains Limosilactobacillus fermentum strains, or their cultures or processed products, and the strains have a 16s rRNA sequence with at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identity with SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3.

[0016] Preferably, the anti-hangover includes at least one of the following: accelerating the metabolism of ethanol and / or acetaldehyde; delaying the onset of drunkenness; shortening the hangover time; reducing the mortality rate caused by drinking; reducing the liver index; decreasing the content of AST and / or ALT in the serum; relieving discomfort caused by ethanol and / or acetaldehyde; improving alcohol-induced oxidative stress, such as increasing the content of GSH in the liver.

[0017] In the present invention, the improvement refers to reducing levels above the normal range and / or increasing levels below the normal range.

[0018] The present invention also protects a microbial strain, which is at least one of Limosilactobacillus fermentum ibiome020, Limosilactobacillus fermentum ibiome021, and Limosilactobacillus fermentum ibiome022 strains deposited under the accession numbers CCTCC NO: M2024188, CCTCC NO: M2024222, and CCTCC NO: M2024189. The Limosilactobacillus fermentum ibiome020, Limosilactobacillus fermentum ibiome021, and Limosilactobacillus fermentum ibiome022 strains are deposited at the China Center for Type Culture Collection, located at the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit dates are January 24, 2024, January 26, 2024, and January 24, 2024, respectively.

[0019] The present invention further protects a culture or a processed product of the above microbial strain.

[0020] The present invention protects a drug, which comprises the above microbial strain, or a culture or a processed product of the above microbial strain, and a pharmaceutically acceptable excipient.

[0021] There are various classification methods for excipients in preparations, which can be classified according to sources, functions and uses, administration routes, etc. Classified by sources, they can be divided into natural products, semi-synthetic products, and fully synthetic products. Classified by the functions and uses of excipients in preparations, there are 65 types, namely pH regulators, chelating agents, clathrating agents, coating agents, protecting agents, moisturizing agents, disintegrants, surfactants, virus inactivators, supplements, precipitants, film-forming materials, flavoring agents, excipients for lyophilization, carbon dioxide adsorbents, foaming agents, fragrances, preservatives, excipients, desiccants, curing agents, buffers, sustained and controlled release materials, adhesives, taste-correcting agents, antioxidants, antioxidant synergists, anti-adhesion agents, air displacement agents, condensers, base materials for pastes, gel materials, polishing agents, propellants, solvents, softeners, emulsifiers, ointment bases, soft capsule materials, lubricants, wetting agents, penetration enhancers, osmotic pressure regulators, suppository bases, sweeteners, fillers, pill cores, stabilizers, adsorbents, absorbents, diluents, defoaming agents, flocculants, ethanol modifiers, plaster bases, inks, thickeners, solubilizers, plasticizers, adhesives, adjuvants for traditional Chinese medicine processing, filter aids, cosolvents, suspending agents, and coloring agents.

[0022] The pharmaceutically acceptable excipients include at least one of adjuvants, stabilizers or protectants, bacteriostatic agents, excipients, solubilizers, flavoring agents, diluents, and buffers.

[0023] Adjuvant: A substance that is a mixture of one or more components that binds to a vaccine antigen to enhance [such as boost, accelerate, prolong, and / or potentially direct] its specific immune response and the clinical effect of the vaccine.

[0024] Stabilizer or protectant: A substance used to stabilize or protect the active ingredient of a biological product and prevent its degradation or loss of activity.

[0025] Bacteriostatic agent: A substance used to inhibit the growth of microorganisms and prevent microbial contamination. Excipient: A substance used in freeze-dried products to form the drug and act as a scaffold. Solubilizer: A substance used to increase the solubility of a drug. Flavoring agent: A substance used to improve the taste of an oral drug. Diluents and buffers: Solvents used to dissolve and dilute the product and adjust the pH of the product, such as water for injection, sodium chloride injection, phosphate-buffered saline (PBS), etc.

[0026] Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monobasic), calcium stearate, croscarmellose, crospovidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0027] The drug can be prepared in the form of an injection preparation or an oral preparation. The injection preparation can be classified into liquid injections, powder for injection, and tablets for injection according to the physical state; and can be classified into intradermal injections, subcutaneous injections, intramuscular injections, intravenous injections, and intraspinal injections according to the injection site. Preferably, the solvent of the injection preparation includes water for injection or physiological saline.

[0028] Preparations for oral use include tablets containing an active ingredient admixed with a non-toxic pharmaceutically acceptable excipient. These excipients can be, for example, inert diluents or fillers (such as sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starches including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate or sodium phosphate); granulating and disintegrating agents (such as cellulose derivatives including microcrystalline cellulose, starches including potato starch, croscarmellose sodium, alginates or alginic acid); binders (such as sucrose, glucose, sorbitol, gum arabic, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, ethyl cellulose, polyvinylpyrrolidone or polyethylene glycol); and lubricants, glidants and anti-adhesion agents (such as magnesium stearate, zinc stearate, stearic acid, silica, hydrogenated vegetable oil or talc). Preparations for oral use can also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (such as potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with a water or oil medium (such as peanut oil, liquid paraffin or olive oil). Powders, granules and pills can be prepared in a conventional manner using the ingredients mentioned above under tablets or capsules, for example using mixers, fluidized bed equipment or spray drying equipment.

[0029] Other pharmaceutically acceptable excipients for oral preparations include, but are not limited to, colorants, flavorants, plasticizers, humectants and buffering agents. Preparations for oral use can also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (such as potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with a water or oil medium (such as peanut oil, liquid paraffin or olive oil). Powders, granules and pills can be prepared in a conventional manner using the ingredients mentioned above under tablets or capsules, for example using mixers, fluidized bed equipment or spray drying equipment.

[0030] In some embodiments, the administration includes intramuscular, intravenous (e.g., in the form of a sterile solution and in a solvent system suitable for intravenous use), intradermal, intra-arterial, intraperitoneal, intralesional, intracranial, intra-articular, intra-prostatic, intrapleural, intratracheal, intranasal, intravitreal, intravaginal, intrarectal, transdermal, intratumoral, transperitoneal, subcutaneous, subconjunctival, intracapsular, transmucosal, intrapericardial, intraumbilical, intraocular, oral (e.g., tablets, capsules, cachets, caplets or syrups), transdermal (e.g., in the form of creams, gels, lotions or ointments), topical, by inhalation, by injection or by infusion (e.g., continuous infusion in the form of creams or lipid compositions, local perfusion directly soaking the target cells, catheterization, lavage) of the drugs described herein.

[0031] The present invention protects a pharmaceutical composition comprising the above-mentioned microbial strains, or a culture or a processed product thereof of the above-mentioned microbial strains, and a combined drug, wherein the combined drug is another drug that synergistically acts with Limosilactobacillus fermentum.

[0032] The dosage forms of the drugs described in the present invention are granules, capsules, tablets, powders, oral liquids, suspensions or emulsions, etc.

[0033] The effective dose of the present invention is that the total viable count of the viable bacteria preparation made from Limosilactobacillus fermentum as the main drug active ingredient is 10 6 -10 14 CFU.

[0034] The medication cycle is based on achieving the effect, including but not limited to taking 1 - 3 times a day, 3 - 7 days a week, etc., and is also related to the action concentration of the specific preparation.

[0035] The present invention also protects a starter / functional bacterial agent / nutritional composition comprising the above-mentioned microbial strains, or a culture or a processed product thereof of the above-mentioned microbial strains.

[0036] The starter or functional bacterial agent includes a bacterial solution prepared from the above-mentioned microbial strains, or a powder or granule obtained by further processing; one or more non-antagonistic microbial agents can be further contained in the starter, and a compound bacterial agent is prepared from one or more selected from Lactobacillus plantarum, Bacillus coagulans, Lactobacillus casei, Bifidobacterium longum subsp. longum, etc.

[0037] The effective bacterial agent concentration and viable count are 10 6 -10 14 CFU.

[0038] The starter or functional bacterial agent can also be used as a functional food or nutritional product.

[0039] A nutritional composition comprising the above-mentioned microbial strains, or a culture or processed product of the microbial strains. Preferably, the nutritional composition is a food, a nutritional product, a supplement, a probiotic or a synbiotic.

[0040] The food comprises the above-mentioned microbial strains, or a culture or processed product of the microbial strains and auxiliary substances for realizing the food function, and the presented forms include but are not limited to "dietary supplements", "fermented foods", etc.

[0041] The dietary supplement is obtained by processing a culture or processed product of the above-mentioned microbial strains and further adding nutrients such as cellulose, vitamins, minerals, etc.

[0042] The fermented foods include dairy products, soy products or fruit and vegetable products, etc. The dairy products are milk, sour cream or cheese, etc. The soy products are soy milk, tempeh or miso, etc. The fruit and vegetable products are cucumber, carrot, beet, celery or cabbage products, etc.

[0043] The probiotic refers to live microorganisms that are beneficial to the health of the host organism when provided in an appropriate amount.

[0044] The synbiotic refers to those foods containing a mixture of prebiotics and probiotics. They usually contain prebiotic components that are beneficial for growth and / or metabolic activity, and generally have a probiotic effect in combination with, such as but not limited to, the above-mentioned microbial strains and fructooligosaccharides or galactooligosaccharides.

[0045] The beneficial effects of the present invention are as follows:

[0046] The Lactobacillus fermentum of the present invention is a natural bacterium derived from the healthy human intestine and is a food catalog bacterium with high safety; it can metabolize high concentrations of acetaldehyde, prevent a series of discomforts caused by the accumulation of acetaldehyde and the damage to human organs and their functions, so as to relieve symptoms such as dizziness, headache, nausea and vomiting, and hangover after drinking; at the same time, it has the ability to metabolize ethanol and accelerate the decomposition of alcohol / ethanol; it also has excellent resistance to gastrointestinal fluids and bile salts, can adapt to the complex internal environment, and can maintain its activity and play a better role in the human body.

[0047] Biological deposit description

[0048] Limosilactobacillus fermentum ibiome020, Limosilactobacillus fermentum ibiome021, and Limosilactobacillus fermentum ibiome022, with preservation dates of January 24, 2024, January 26, 2024, and January 24, 2024 respectively. The preservation location is the China Center for Type Culture Collection, with the address being the China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation numbers are CCTCC NO: M 2024188, CCTCC NO: M 2024222, and CCTCC NO: M 2024189 respectively. Description of Drawings

[0049] Figures 1 to 3 This is the smear microscopy image (40X) of ibiome020, ibiome021, and ibiome022 of the present invention.

[0050] Figure 4 This is the colony morphology of ibiome020, ibiome021, and ibiome022 of the present invention on solid medium.

[0051] Figure 5 This is the statistical chart of the growth of ibiome020, ibiome021, ibiome022 of the present invention and control bacteria 1, control bacteria 2, and control bacteria 3 in culture media with different concentrations of acetaldehyde.

[0052] Figure 6 This is the statistical chart of the viable count logarithm results of the pH2 gastric juice tolerance of ibiome020, ibiome021, and ibiome022 of the present invention.

[0053] Figure 7 This is the statistical chart of the viable count logarithm results of the pH8 intestinal juice tolerance of ibiome020, ibiome021, and ibiome022 of the present invention.

[0054] Figure 8 This is the statistical chart of the viable count logarithm results of the 0.6% bile salt tolerance of ibiome020, ibiome021, and ibiome022 of the present invention.

[0055] Figure 9 This is the statistical chart for evaluating the in vivo effect of ibiome020, ibiome021, and ibiome022 of the present invention in relieving alcohol intoxication (9A: Drunkenness time; 9B: Sobering-up time).

[0056] Figure 10Statistical chart of the results of evaluating the survival rate of the present invention's ibiome020, ibiome021, and ibiome022 in an in vivo acute alcoholic liver injury mouse model.

[0057] Figure 11 Statistical chart of the results of evaluating the liver index of the present invention's ibiome020, ibiome021, and ibiome022 in an in vivo acute alcoholic liver injury mouse model.

[0058] Figure 12 Statistical chart of the results of evaluating serum AST and ALT of the present invention's ibiome020, ibiome021, and ibiome022 in an in vivo acute alcoholic liver injury mouse model.

[0059] Figure 13 Statistical chart of the results of evaluating liver GSH of the present invention's ibiome020, ibiome021, and ibiome022 in an in vivo acute alcoholic liver injury mouse model.

[0060] Figure 14 Statistical chart of the results of the effect of the present invention's ibiome022 on the contents of ethanol and acetaldehyde in serum after drinking. Detailed implementation manners

[0061] To better understand the present invention, the present invention will be further described below in conjunction with embodiments and the accompanying drawings. The following embodiments are only for illustrating the present invention rather than limiting it.

[0062] Example 1 Isolation of intestinal bacteria

[0063] Healthy volunteers who have not used antibiotics within one year were recruited. After signing the informed consent form, the volunteers took 2 - 5 grams of fresh feces by themselves, put them into a sample collection tube containing glycerol, homogenized them by shaking, and placed the processed feces sample in an ice box and delivered it to the applicant's laboratory for strain isolation within 24 hours.

[0064] ① Pretreatment of feces samples: Take 1 mL of the mixture from the sample collection tube containing well - mixed glycerol and feces and add it to 9 mL of 1× sterile PBS solution, mix it with a vortex oscillator, and then take 100 μL of the mixed solution from the above - mentioned mixed solution and perform serial dilution to 10 -9 , for plate coating.

[0065] ② Take 100 μL of the diluted sample and spread it on media such as GAM (purchased from Qingdao Haibo Biotechnology, product number HB8518-1), BHI (purchased from Qingdao Haibo Biotechnology, product number HB8297-1), MRS (purchased from Solarbio, product number M8540), RCM (purchased from Qingdao Haibo Biotechnology, product number HB0316). After the surface of the petri dish is dry, invert it and place it in a microaerophilic workbench for cultivation (temperature: 37 °C, O 2 : 5%, CO 2 : 5%, mixed gas: 90%). Incubate statically for 24 - 36 h. After monoclonal colonies grow out, streak the monoclonal colonies for purification multiple times. Perform 16s rRNA sequencing on the purified strain to determine the taxonomic status of the strain.

[0066] 16s rRNA sequencing: Perform 16s rRNA PCR amplification on the strain to be identified. Amplification system: 2Taq MasterMix (Novoprotein; P112-01) 12.5 μL, primer 1 (27F: AGAGTTTGATCCTGGCTCAG) 1 μL, primer 2 (1492R: TACGGCTACCTTGTTACGACTT) 1 μL, bacterial liquid from liquid culture 1 μL, ddH2O 9.5 μL; Amplification conditions: 95 °C for 3 min; 95 °C for 15 s, 58 °C for 15 s, 72 °C for 30 s, 35 cycles; 72 °C for 5 min. Send the amplification product to Qingke Biotechnology Co., Ltd. for sequencing. Submit the 16s rRNA gene sequence of the strain returned by the sequencing to the NCBI Basic Local Alignment Search Tool for 16s rRNA gene analysis of the strain. Among the alignment results, the species corresponding to the strain with the highest similarity is used as the species of the corresponding strain. Thus, a human intestinal microbiota library was established.

[0067] Example 2 Primary Screening and Identification of Acetaldehyde-Tolerant Strains

[0068] We cultured the strains in the above-mentioned human intestinal microbiota library using 0.1% (m / v) acetaldehyde solution (absorb 13.9 μL of 36% acetaldehyde stock solution filtered through a 0.22 μm filter membrane and add it to 5 mL of MRS medium and mix well), and found that 3 strains of Limosilactobacillus fermentum had strong acetaldehyde tolerance, named ibiome020, ibiome021, and ibiome022 respectively. The 16s rRNA sequences of the three strains of Limosilactobacillus fermentum were SEQ ID NO.1-3 respectively, and were submitted to the NCBI Basic Local Alignment Search Tool for 16s rRNA gene analysis of the strains. The alignment results showed that the strains with the highest similarity to them were Limosilactobacillus fermentum strain NBRC 15885, Limosilactobacillus fermentum strain CIP 102980, and Limosilactobacillus fermentum strain NBRC 15885, with similarity of 99.66%, 99.65%, and 99.58% respectively. When the three strains were compared pairwise, the similarity of the 16s rRNA sequences was 99.52%, 99.52%, and 99.79% respectively.

[0069] Using a microscope, smear and microscopic examination of ibiome020, ibiome021, and ibiome022 were carried out at 40X respectively, and the microscopic examination pictures are as Figures 1-3 shown. It can be seen from the figure that ibiome020, ibiome021, and ibiome022 are Gram-positive, rod-shaped, short rod-shaped or spherical, without spores and without motility.

[0070] After culturing ibiome020, ibiome021, and ibiome022 on MRS medium for 48 h and taking pictures, the single colony pictures are as Figure 4 shown. It can be seen that ibiome020: diameter 1 mm, round, white, surface raised; ibiome021: diameter 2 mm, round, milky white, surface raised; ibiome022: diameter 1 mm, irregular shape, white, flat.

[0071] Example 3 Limosilactobacillus fermentum can grow in high-concentration acetaldehyde

[0072] To evaluate the acetaldehyde tolerance of the above 3 strains of Limosilactobacillus fermentum, we tested the growth of the strains at different acetaldehyde concentrations. The experimental method is as follows:

[0073] Activation of strains: Take out Lactobacillus fermentum ibiome020, ibiome021, ibiome022 preserved in 20% glycerol in an -80°C refrigerator, as well as Lactobacillus plantarum (control strain 1), Lactobacillus brevis (control strain 2), Lactobacillus rhamnosus (control strain 3) for the control experiment, and two strains of Lactobacillus fermentum (control strain 4, control strain 5). After thawing and mixing, respectively aspirate 20 μL of the bacterial solution and streak it on MRS medium. After resuscitation culture in a 37°C anaerobic incubator for 24 h, pick single colonies, verify that the 16s rRNA sequence is correct, and then inoculate the bacteria into 5 mL of MRS medium and culture overnight in a 37°C anaerobic incubator for activation.

[0074] Preparation of MRS medium containing acetaldehyde: The 0.36 g / mL (36%) acetaldehyde stock solution is filtered and sterilized with a 0.22 μm pore size filter membrane. Calculate the volume of the acetaldehyde stock solution to be aspirated according to Table 1 below, add it to the MRS medium and mix well to prepare MRS media containing 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, and 0.4% acetaldehyde respectively.

[0075] Table 1 Preparation of MRS medium containing acetaldehyde

[0076]

[0077] Respectively take 50 μL of the activated ibiome020, ibiome021, ibiome022, control strain 1 (Lactobacillus plantarum), control strain 2 (Lactobacillus brevis), control strain 3 (Lactobacillus rhamnosus), control strain 4 (Lactobacillus fermentum), and control strain 5 (Lactobacillus fermentum) bacterial solutions into the above MRS media containing 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, and 0.4% acetaldehyde, and culture in a 37°C anaerobic incubator for 24 h. Measure OD with an enzyme-linked immunosorbent assay (ELISA) reader 600 , observe their growth status, and the results are shown in Table 2 and Figure 5 as follows.

[0078] Table 2 OD values of Lactobacillus fermentum in media with different concentrations of acetaldehyde 600 values

[0079]

[0080] Experimental results: Strains ibiome020, ibiome021, and ibiome022 can still grow in a high concentration of 0.4% acetaldehyde, significantly better than the control strains, indicating that Lactobacillus fermentum ibiome020, ibiome021, and ibiome022 have significant advantages in acetaldehyde tolerance.

[0081] Example 4 16-hour acetaldehyde metabolism of Lactobacillus fermentum

[0082] To verify the ability of Lactobacillus fermentum to metabolize acetaldehyde, we used pre-column derivatization with 2,4-dinitrophenylhydrazine - high performance liquid chromatography to detect the acetaldehyde metabolism of Lactobacillus fermentum over 16 hours.

[0083] Experimental method:

[0084] 1. Reagent preparation

[0085] (1) Saturated aqueous solution of 2,4-dinitrophenylhydrazine (DNPH): Take an appropriate amount of solid 2,4-dinitrophenylhydrazine (DNPH), add a small amount of water, and while dripping concentrated sulfuric acid to dissolve it, dilute it with water to make a saturated solution. Extract and purify it several times with dichloromethane, and store it in a sealed and light-proof manner;

[0086] (2) Acetate buffer solution (pH = 5): Weigh 25.1 g of sodium acetate, dissolve it in an appropriate amount of water, add 6 mL of concentrated acetic acid, and then dilute it with water to 250 mL.

[0087] 2. Preparation of standard curve

[0088] (1) Accurately pipette 20 μL of the acetaldehyde stock solution dissolved in MRS medium at 0, 100, 200, 500, 1000, 2000, 4000 mg / L into test tubes. Add 500 μL of acetate buffer solution (pH = 5) and 800 μL of saturated aqueous solution of 2,4-dinitrophenylhydrazine to each tube, and make up the volume to 10 mL with water. Shake well and derivatize in a 60 °C water bath for 20 min;

[0089] (2) After cooling to room temperature, add 3.00 mL of n-hexane to extract the derivative. After standing for layer separation, pipette 1 mL of the n-hexane layer with a pipette gun and dry it in a nitrogen blowing instrument at 50 °C;

[0090] (3) Add 1 mL of the mobile phase (acetonitrile: water = 52:48 (V:V)), filter it with a 0.22 μm filter head into an auto-sampler vial for measurement.

[0091] 3. Sample pretreatment

[0092] (1) Prepare MRS medium containing 0.1% acetaldehyde. Centrifuge the activated ibiome020, ibiome021, ibiome022, and control strain 1 bacterial solutions to remove the supernatant, add 1 mL of MRS medium containing 0.1% acetaldehyde, and culture in a 37 °C anaerobic incubator for 16 h;

[0093] (2) Dilute the bacterial solution 100 times for detection: After centrifuging the bacterial solution, take 20 μL of the supernatant into a test tube. Add 500 μL of acetate buffer solution and 800 μL of saturated aqueous solution of 2,4-dinitrophenylhydrazine to each tube, and make up the volume to 10 mL with water. The remaining steps are the same as above.

[0094] 4. Chromatographic conditions

[0095] Chromatographic column: Agilent Eclipse XDB C18 stainless steel column (250 mm × 4.6 mm, 5 μm); mobile phase: acetonitrile: water = 52:48 (V:V); flow rate: 1.0 mL / min; detection wavelength: 365 nm; column temperature: 40 °C; injection volume: 10 μL, isocratic elution.

[0096] Experimental results:

[0097] As can be seen from Table 3, in the MRS medium containing 0.1% acetaldehyde, after anaerobic culture at 37 °C for 16 h, the acetaldehyde metabolic rate of Lactobacillus fermentum was all as high as over 99%, while the control strain 1 only metabolized 8.7%; indicating that Lactobacillus fermentum has a strong acetaldehyde metabolic capacity.

[0098] Table 3 Detection results of acetaldehyde metabolism of Lactobacillus fermentum

[0099]

[0100] Example 5 Acetaldehyde metabolism of Lactobacillus fermentum for 4 h

[0101] In order to verify the ability of Lactobacillus fermentum to metabolize high-concentration acetaldehyde in a short time, we used pre-column derivation with 2,4-dinitrophenylhydrazine - high performance liquid chromatography to detect the acetaldehyde metabolism of Lactobacillus fermentum for 4 h.

[0102] Except for sample pretreatment, the remaining experimental methods were the same as in Example 4.

[0103] Sample pretreatment:

[0104] (1) Prepare MRS media containing 0.2%, 0.3%, and 0.4% acetaldehyde. Measure the OD of the freshly cultured overnight bacterial solution. The OD values of ibiome020, ibiome021, ibiome022, and the control strain 1 (Lactobacillus plantarum) were 1.127, 1.1106, 1.2056, and 1.3677 respectively. Calculate the amount of bacterial solution required for 2OD, add it to a 14 mL EP tube, centrifuge to remove the supernatant, and then add 2 mL of the MRS medium with 3 acetaldehyde concentrations respectively, and culture in an anaerobic incubator at 37 °C for 4 h;

[0105] (2) Detection of diluted bacterial solution: After centrifuging the bacterial solution, take 20 μL of the supernatant into a test tube, add 500 μL of sodium acetate buffer solution and 800 μL of saturated 2,4-dinitrophenylhydrazine aqueous solution to each tube, and make up the volume to 10 mL with water. The remaining steps are the same as above.

[0106] Experimental results:

[0107] As can be seen from Table 4, in the MRS medium containing 0.2-0.4% acetaldehyde, after anaerobic cultivation at 37°C for 4 h, the acetaldehyde metabolic rates of Lactobacillus fermentum ibiome020, ibiome021, and ibiome022 were all as high as over 80%, while the control strain 1 only metabolized 3.89-9.24%.

[0108] Table 4 4-h metabolic rate of high-concentration acetaldehyde by Lactobacillus fermentum

[0109]

[0110] Example 6 Acetaldehyde metabolism of Lactobacillus fermentum for 1-2 h

[0111] To verify the ability of Lactobacillus fermentum to metabolize high-concentration acetaldehyde in a short time, we used pre-column derivation with 2,4-dinitrophenylhydrazine-high performance liquid chromatography to detect the acetaldehyde metabolism of Lactobacillus fermentum for 1-2 h.

[0112] Except for sample pretreatment, the remaining experimental methods were the same as those in Example 4.

[0113] Sample pretreatment:

[0114] (1) Prepare MRS medium containing 0.2%, 0.3%, and 0.4% acetaldehyde. Measure the OD of the freshly cultured overnight bacterial solution. The OD values of ibiome020, ibiome021, and ibiome022 were 1.2234, 1.258, and 1.4273 respectively. Calculate the amounts of bacterial solution required for 2OD, add them to 14 mL EP tubes, centrifuge to remove the supernatant, and add 2 mL of MRS medium with 3 acetaldehyde concentrations respectively. Cultivate in an anaerobic incubator at 37°C for 2 h, and take samples at 1 h and 2 h.

[0115] (2) Bacterial solution dilution detection: After centrifuging the bacterial solution, take 20 μL of the supernatant into a test tube. Add 500 μL of sodium acetate buffer solution and 800 μL of saturated aqueous solution of 2,4-dinitrophenylhydrazine to each tube, and make up the volume to 10 mL with water. The remaining steps are the same as above.

[0116] Experimental results:

[0117] As can be seen from Table 5, in the MRS medium containing 0.2 - 0.4% acetaldehyde, Lactobacillus fermentum ibiome020, ibiome021, and ibiome022 were anaerobically cultured at 37°C for 1 h. The metabolic rate at 0.2% was between 42.19% - 69.70%, the metabolic rate at 0.3% was between 21.66% - 35.76%, and the metabolic rate at 0.4% was between 13.48% - 22.96%. After culturing for 2 h, the metabolic rate at 0.2% was above 90%, the metabolic rate at 0.3% was between 61.55% - 87.89%, and the metabolic rate at 0.4% was between 29.24% - 56.72%. At a low concentration, most of it could be metabolized in 1 h and basically completely metabolized in 2 h. At a high concentration, less was metabolized in 1 h and about half was metabolized in 2 h. As time increased, the metabolism significantly accelerated.

[0118] Table 5 Metabolic rate of Lactobacillus fermentum at high - concentration acetaldehyde for 1 - 2 h

[0119]

[0120]

[0121] Example 7 Lactobacillus fermentum can grow in high - concentration ethanol

[0122] To verify the ethanol tolerance ability of Lactobacillus fermentum, it was inoculated into ethanol at different concentrations to detect its growth. The experimental method is as follows:

[0123] Strain activation: The same as Example 3.

[0124] Prepare MRS medium containing ethanol: Calculate and pipette the volume of absolute ethanol according to Table 6, add it to the MRS medium and mix well to prepare MRS media containing 0%, 10%, 12%, and 15% ethanol respectively.

[0125] Table 6 Preparation of MRS medium containing ethanol

[0126]

[0127] Take 50 μL of the activated ibiome020, ibiome021, ibiome022, and control bacterium 1 (Lactobacillus plantarum) bacterial solutions respectively and add them to the above MRS media containing 0%, 10%, 12%, and 15% ethanol, and culture them in an anaerobic incubator at 37°C for 24 h. Measure the OD 600 , observe their growth status, and the OD 600 values are shown in Table 7.

[0128] Table 7 OD 600 values of Lactobacillus fermentum in ethanol media at different concentrations

[0129] Ethanol concentration (v / v) 0％ 10％ 12％ 15％ ibiome020 1.3733 1.3482 1.3531 1.3113 ibiome021 1.3533 1.3692 1.345 1.3314 ibiome022 1.3218 1.2158 1.2856 1.2856 Control bacterium 1 1.3671 0.8712 0.2679 0.1254

[0130] Experimental results:

[0131] As can be seen from Table 7, compared with the control medium without ethanol, Lactobacillus fermentum showed no growth inhibition in the media with ethanol contents of 10%, 12%, and 15%, indicating excellent ethanol tolerance. However, the growth of control bacterium 1 (Lactobacillus plantarum) was significantly affected in the presence of ethanol.

[0132] Example 8: Lactobacillus fermentum has excellent gastrointestinal fluid tolerance

[0133] To verify the tolerance of Lactobacillus fermentum to human gastrointestinal fluids and bile salts, an artificial gastrointestinal fluid environment was simulated to detect the viable count of Lactobacillus fermentum. The experimental method is as follows:

[0134] 1. Reagent preparation

[0135] (1) Artificial gastric juice: Add 10 g of pepsin (CSN pharm, CSN51458) to 800 mL of water, adjust the pH to 2 with dilute hydrochloric acid, and make up the volume to 1000 mL with water;

[0136] (2) (0% bile salt) Artificial intestinal juice: Dissolve 6.8 g of potassium dihydrogen phosphate in 500 mL of pure water, adjust the pH value to 8.0 with 0.1 mol / L sodium hydroxide solution. Separately, dissolve 10 g of pancreatin (Aladdin, P110505) in an appropriate amount of water. Mix the two solutions and make up the volume to 1000 mL with water;

[0137] (3) (0.6% bile salt) Artificial intestinal juice: Add solid bile salt (OXOID, LP0055) to the above (0% bile salt) artificial intestinal juice to prepare a 0.6% (m / v) bile salt simulated intestinal juice group.

[0138] 2. Simulated artificial gastric juice experiment

[0139] After shaking the activated bacterial solution well, take 1 mL of the bacterial suspension and add it to 9 mL of artificial gastric juice (pH = 2.0). Incubate statically at 37°C for 3 h. Take the artificial gastric juice at 0, 1, and 3 h of incubation for plate viable count: Take 20 μL of the bacterial solution and add it to a 96-well plate containing 180 μL of sterile water, and dilute it serially to 10 -6 ; 10 -1 -10 -6 Take 100 μL of each dilution and spread it. Using 0 h as the control, calculate the survival rate according to formula I.

[0140] Simulated artificial gastric juice survival rate (%) = Nt / N0 * 100% Formula I

[0141] Where Nt represents the viable count after incubation for t h, and N0 represents the viable count at 0 h.

[0142] 3. Experiment of Simulating Artificial Intestinal Juice (0% Bile Salt)

[0143] Take 1 mL of the artificial gastric juice cultured for 3 h in item 2 above and add it to 9 mL of artificial intestinal juice (pH = 8.0) containing 0% bile salt, and incubate statically at 37°C for 3 h. Take the artificial intestinal juice cultured for 0, 1, and 3 h respectively for plate viable count: Add 20 μL of the bacterial liquid to a 96-well plate containing 180 μL of sterile water and dilute it serially to 10 -6 ; 10 -1 -10 -6 Take 100 μL of each dilution and spread it. Using 0 h as a control, calculate the survival rate according to formula II.

[0144] Survival rate of simulating artificial intestinal juice (%) = Nt / N0 * 100% Formula II

[0145] Wherein, Nt represents the number of viable bacteria after culturing for t h, and N0 represents the number of viable bacteria at 0 h.

[0146] 4. Experiment of Simulating Artificial Intestinal Juice (0.6% Bile Salt)

[0147] Take 1 mL of the artificial gastric juice cultured for 3 h in item 2 above and add it to 9 mL of artificial intestinal juice (pH = 8.0) containing 0.6% bile salt, and incubate statically at 37°C for 3 h. Take the artificial intestinal juice cultured for 0, 1, and 3 h respectively for plate viable count: Add 20 μL of the bacterial liquid to a 96-well plate containing 180 μL of sterile water and dilute it serially to 10 -6 ; 10 -1 -10 -6 Take 100 μL of each dilution and spread it. Using 0 h as a control, calculate the survival rate according to formula II.

[0148] Experimental results:

[0149] In addition to being digested in the stomach, exogenous bacteria must also be digested and transported through the small intestine before they can reach their destination for colonization and play a role. Therefore, the tolerance of the three screened Lactobacillus fermentum strains to gastrointestinal juices and bile salts was determined, and the results are shown in Tables 8 - 10 and Figures 6-8 . From Table 8 and Figure 6 it can be seen that after the strain was treated with simulated gastric juice for 3 h, the viable bacteria cfu remained at the order of 10 8 , indicating that the strain can survive and grow in gastric juice and has good acid tolerance. From Table 9 and Figure 7 it can be seen that after the strain was treated with simulated intestinal juice for 3 h, the viable bacteria cfu remained at the original order of magnitude, indicating that the strain can survive and grow in intestinal juice and has good alkali tolerance. From Table 10 and Figure 8 it can be seen that after the strain was treated with intestinal juice simulating a 0.6% bile salt concentration for 3 h, the survival rate results at 0.6% and 0% bile salt concentrations showed little difference, indicating that the strain can survive and grow in intestinal juice with a relatively high bile salt concentration and has good bile salt tolerance.

[0150] Table 8 Detection results of the gastric juice tolerance of Limosilactobacillus fermentum

[0151]

[0152]

[0153] Table 9 Detection results of the intestinal juice tolerance of Limosilactobacillus fermentum

[0154]

[0155] Table 10 Detection results of the bile salt tolerance of Limosilactobacillus fermentum

[0156]

[0157] Example 9 Preparation of Limosilactobacillus fermentum-containing bacterial powder

[0158] Limosilactobacillus fermentum ibiome020, (Limosilactobacillus fermentum) ibiome021, Limosilactobacillus fermentum ibiome022 (2*10 9 CFU / mL) were anaerobically cultured using MRS medium at 37 °C for 24 - 36 h, centrifuged, cooled and dried until the water content was less than 3%, thus preparing Limosilactobacillus fermentum-containing bacterial powder, which can be used as a starter, a functional bacterial agent or a drug after packaging.

[0159] Example 10 Solid beverage containing Limosilactobacillus fermentum

[0160] A solid beverage containing Limosilactobacillus fermentum ibiome020, comprising the following substances by mass percentage: dietary fiber powder 5%, stachyose 35%, maltodextrin 30%, Limosilactobacillus fermentum ibiome020 30%. Its preparation method is as follows:

[0161] (1) Preparation of materials: Weigh dietary fiber powder, stachyose, maltodextrin, Limosilactobacillus fermentum ibiome020 according to the formula quality for standby;

[0162] (2) Preliminary mixing: Add dietary fiber powder, stachyose, maltodextrin and mix evenly to obtain the preliminary mixture for standby;

[0163] (3) Secondary mixing: Add Limosilactobacillus fermentum ibiome020 to the primary mixture prepared in step (2), and stir and mix evenly at low temperature;

[0164] (4) Packaging: Package the mixture obtained in step (3) to obtain a solid beverage containing Limosilactobacillus fermentum ibiome020.

[0165] Example 11 Dairy products containing Limosilactobacillus

[0166] A coagulated fermented dairy product containing Limosilactobacillus fermentum ibiome021 is prepared according to the following steps:

[0167] (1) Weigh 10 kg of raw milk, standardize it, add 5 g of zinc sulfate and 0.8 kg of arabinose, mix evenly and place it in a blending tank to obtain Material 1;

[0168] (2) Homogenize Material 1 at 70 °C and 20 MPa for 10 min, and sterilize it at 90 - 95 °C for 5 - 10 min to obtain Material 2;

[0169] (3) Rapidly cool Material 2 to 35 - 39 °C, inoculate Limosilactobacillus fermentum ibiome021 at an inoculation amount of 0.01%, fill it into containers, cover it, ferment at 37 °C until coagulation, and stop fermentation when the coagulation state is good and the pH reaches 4.2 - 4.5. Then quickly put it into a refrigerator at 2 - 6 °C and ripen for 12 h to obtain a coagulated fermented milk (i.e., yogurt) prepared with Limosilactobacillus fermentum ibiome021 as the starter.

[0170] Example 12 Fermented fruit and vegetable products containing Limosilactobacillus

[0171] A fermented fruit and vegetable product containing Limosilactobacillus fermentum ibiome022 is prepared as follows:

[0172] (1) Take 5 kg of fruit and vegetable raw materials, add 5 kg of purified water, 5 g of zinc sulfate, and mix evenly with 1.0 kg of arabinose to obtain Material 3;

[0173] (2) Homogenize Material 3 at 70 °C and 20 MPa for 10 min, and sterilize it at 90 - 95 °C for 5 - 10 min to obtain Material 4;

[0174] (3) Rapidly cool the material 3 to 37 °C, inoculate Limosilactobacillus fermentum ibiome022 at an inoculation amount of 0.01%, fill it into containers, cover it, ferment in a 37 °C fermentation chamber for 16 h, then rapidly cool it to 4 °C and ripen for about 12 h to obtain a fermented fruit and vegetable product prepared with Limosilactobacillus fermentum ibiome022 as the starter.

[0175] Example 13 Evaluation of the Effect of Alcohol Detoxification in Vivo

[0176] 1. Experimental Method

[0177] (1) Grouping of Mice:

[0178] Forty male C57BL / 6J mice were randomly divided into 4 groups according to body weight, with 10 mice in each group. They were adaptively fed for 3 days. The grouping information is as follows:

[0179] ① Model group (model): Intragastric administration of 0.2 mL PBS;

[0180] ② ibiome020: Intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome020 bacterial powder;

[0181] ③ ibiome021: Intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome021 bacterial powder;

[0182] ④ ibiome022: Intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome022 bacterial powder.

[0183] (2) Intragastric Administration and Index Measurement:

[0184] Before the experiment, the mice were fasted for 16 hours without water deprivation. Each group of mice was gavaged with the corresponding drug (probiotic or PBS), and 1 hour after drug administration, an alcohol solution of 0.3 mL / 20 g of animal body weight was gavaged once. The alcohol solution was an aqueous ethanol solution with a volume percentage of 50%. After each group of mice was gavaged with alcohol, the drunken state of the mice was observed, and the drunken time (the time from gavage to the disappearance of the righting reflex, i.e., the righting reflex disappearance time) and the sobering time (the time from the disappearance of the righting reflex to recovery, i.e., the righting reflex recovery time) were recorded. After gavage with alcohol, the mice were gently placed on their backs. If they maintained the posture of lying on their backs for more than 30 s, that is, the righting reflex disappeared, they were considered drunk.

[0185] 2. Experimental results

[0186] After acute alcohol consumption, the amount of alcohol in the body exceeds the maximum metabolic capacity of the body, causing the blood alcohol concentration to rise rapidly. Alcohol enters the brain through the blood, affecting the function of the central nervous system and showing a state of alcohol poisoning. We can test the anti-alcohol effects of anti-alcohol drugs through the drunken latency (drunken time) and drunken sleep time (sobering time). As Figure 9 shown, gavage with Limosilactobacillus fermentum ibiome020, Limosilactobacillus fermentum ibiome021, and Limosilactobacillus fermentum ibiome022 can all delay the drunken time of mice ( Figure 9 A), compared with the model group, delayed by 224.97% (P<0.05), 140.94%, and 205.77% (P = 0.06), respectively. At the same time, gavage with Limosilactobacillus fermentum ibiome022 can also shorten the sobering time of mice ( Figure 9 B), compared with the model group, shortened by 30.88% (P = 0.09).

[0187] Example 14 Acute alcoholic liver injury mouse model in vivo - Evaluation of survival rate and liver index

[0188] 1. Experimental method

[0189] (1) Grouping of mice:

[0190] Forty male C57BL / 6J mice were randomly divided into 4 groups according to body weight, with 10 mice in each group. They were adaptively fed for 3 days. The grouping information is as follows:

[0191] ① Model group (model): gavaged with 0.2 mL PBS;

[0192] ②ibiome020: Gavage with 10 9 CFU / mouse Limosilactobacillus fermentum ibiome020 powder;

[0193] ③ibiome021: Gavage with 10 9 CFU / mouse Limosilactobacillus fermentum ibiome021 powder;

[0194] ④ibiome022: Gavage with 10 9 CFU / mouse Limosilactobacillus fermentum ibiome022 powder.

[0195] (2) Gavage and index measurement:

[0196] Before the experiment, the mice were not fasted or water - deprived. Each group of mice was gavaged with the corresponding drug (probiotic or PBS) once a day, and 1 hour after drug administration, 0.2 mL / 20 g of an alcohol solution (ethanol aqueous solution with a volume percentage of 50%) was gavaged. The drugs and alcohol solution were gavaged continuously for 7 days in this way. After the 7 - day gavage of the mice, they were fasted but not water - deprived for 12 h, weighed, decapitated, and the liver was taken for weighing. The liver index of the mice was calculated (liver weight / body weight). During the experiment, the death situation of the mice was counted, and the survival curve was plotted and the survival rate was calculated.

[0197] 2. Experimental results

[0198] High - concentration alcohol can cause a certain mortality rate in mice. As Figure 10 shown, compared with the model group, gavage with Limosilactobacillus fermentum ibiome022 can significantly improve the survival rate of mice (P < 0.05), and the mortality rate is reduced by 40%. Gavage with Limosilactobacillus fermentum ibiome020 and Limosilactobacillus fermentum ibiome021 can also reduce the mortality rate of mice by 20% and 30% respectively.

[0199] After alcohol induces liver injury, it will trigger lipid metabolism disorders, fat accumulation in hepatocytes, resulting in fatty degeneration of hepatocytes, an enlarged liver, an increase in liver weight, and ultimately an increase in the liver index. As Figure 11As shown, compared with the model group, intragastric administration of Limosilactobacillus fermentum ibiome020, Limosilactobacillus fermentum ibiome021, and Limosilactobacillus fermentum ibiome022 could all significantly reduce the liver index of mice (P<0.05, P<0.05, P<0.05).

[0200] Example 15 Acute alcoholic liver injury mouse model in vivo - Evaluation of serum AST and ALT and liver GSH

[0201] 1. Experimental method

[0202] (1) Grouping of mice:

[0203] Forty male C57BL / 6J mice were randomly divided into 4 groups according to body weight, with 10 mice in each group. After 3 days of adaptive feeding, the grouping information is as follows:

[0204] ① Model group (model): Intragastric administration of 0.2 mL PBS;

[0205] ② ibiome020: Intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome020 powder;

[0206] ③ ibiome021: Intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome021 powder;

[0207] ④ ibiome022: Intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome022 powder.

[0208] (2) Intragastric administration and index determination:

[0209] Before the experiment, the mice were not fasted or water - deprived. Each group of mice was gavaged with the corresponding drug (probiotic or PBS) once a day. Two days after gavage, on the third day, the corresponding drug (probiotic or PBS) was first gavaged, and 1 h later, 0.3 mL / 20 g of an alcohol solution (an aqueous ethanol solution with a volume percentage of 50%) was gavaged. Six hours later, 0.15 mL / 20 g of the alcohol solution (an aqueous ethanol solution with a volume percentage of 50%) was gavaged again. After the gavage ended, the mice were fasted but not water - deprived for 12 hours, and then blood and liver were taken to detect serum AST and ALT and liver GSH content.

[0210] 2. Experimental results

[0211] AST and ALT are two types of transaminases present in hepatocytes. AST is mainly present in mitochondria, and ALT is present in the cytosol. When hepatocytes encounter severe lesions or necrosis, AST and ALT in hepatocytes will leak into the blood from hepatocytes. Therefore, the changes in the activities of AST and ALT in serum can be used as specific indicators to judge whether there is damage in hepatocytes. As Figure 12 shown, compared with the model group, Limosilactobacillus fermentum ibiome022 can significantly reduce the contents of liver injury indicators AST and ALT in serum (P < 0.01, P < 0.05).

[0212] Under the induction of high - dose alcohol, oxidative stress will occur in the liver. Glutathione (GSH) is the main endogenous antioxidant in cells to resist oxidative stress. As Figure 13 shown, gavaging Limosilactobacillus fermentum ibiome020, Limosilactobacillus fermentum ibiome021, and Limosilactobacillus fermentum ibiome022 can all significantly increase the GSH content in the liver (P < 0.001, P < 0.01, P < 0.05).

[0213] Example 16 Effects of Limosilactobacillus fermentum ibiome022 on the contents of ethanol and acetaldehyde in serum

[0214] 1. Experimental method

[0215] (1) Grouping of mice:

[0216] Twenty male C57BL / 6J mice were randomly divided into 2 groups according to body weight, with 10 mice in each group. After 3 days of adaptive feeding, the grouping information is as follows:

[0217] ① Model group (model): intragastric administration of 0.2 mL of PBS;

[0218] ② ibiome022: intragastric administration of 10 9 CFU / mouse of Limosilactobacillus fermentum ibiome022 bacterial powder.

[0219] (2) Intragastric administration and index determination:

[0220] The corresponding drugs (probiotics or PBS) were intragastrically administered to the mice in each group for 2 consecutive days, once a day. The mice were fasted but allowed to drink water at 18:00 on the second night. On the third day, the drug (probiotic or PBS) was first intragastrically administered, and 1 h later, 0.3 mL / 20 g of an alcohol solution (an aqueous ethanol solution with a volume percentage of 50%) was intragastrically administered. Blood was taken at 4 h and 8 h after intragastric administration of alcohol to detect the serum ethanol and acetaldehyde contents.

[0221] 2. Experimental results

[0222] The rapid increase in the contents of ethanol and acetaldehyde in the body caused by drinking is the direct cause of body damage. We directly detected the contents of ethanol and acetaldehyde in the serum after intragastric administration of Limosilactobacillus fermentum ibiome022 and the alcohol solution. The results are as Figure 14 shown. Intragastric administration of Limosilactobacillus fermentum ibiome022 can significantly reduce the content of ethanol in the serum at 4 h and 8 h after the mice drink alcohol (P < 0.05, P < 0.05) and the content of acetaldehyde in the serum at 8 h after drinking alcohol (P < 0.05); compared with the model group, after 4 h and 8 h of drinking alcohol, the content of ethanol in the serum decreased by 13% and 11% respectively ( Figure 14 A); after 8 h of drinking alcohol, the content of acetaldehyde in the serum decreased by 33% ( Figure 14 B).

[0223] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a microbial strain, or a culture of the microbial strain or a processed product thereof in the preparation of a hangover remedy, characterized in that: The microbial strain belongs to Lactobacillus fermentum ( Limosilactobacillus fermentum ), and having a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO:

3.

2. The use according to claim 1, wherein the alcohol sobering drug comprises at least one of the following: Medications to relieve chronic / acute alcohol intoxication; Medicines to relieve alcohol-induced intestinal damage or alcohol-induced liver damage.

3. Use of a fermentation agent / functional bacterial agent / nutritional composition in the preparation of a product for sobering up and / or protecting the liver, characterized in that: The fermentation agent / functional bacterial agent / nutritional composition comprises fermented lactobacillus ( Limosilactobacillus fermentum ) strain, or a culture or processed product thereof, and the strain has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO:

3.

4. Use of a microbial strain, or a culture of the microbial strain or a processed product thereof, a fermentation agent, a functional bacterial agent or a nutritional composition for the purpose of sobering up for purposes other than diagnosis and treatment of a disease, characterized in that: The microbial strain belongs to Lactobacillus fermentum ( Limosilactobacillus fermentum ), and having a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; the fermentation agent / functional bacterial agent / nutritional composition comprises fermented Lactobacillus ( Limosilactobacillus fermentum ) strain, or a culture or processed product thereof, and the strain has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO:

3.

5. The use according to any one of claims 1 to 4, characterized in that: The hangover remedy comprises at least one of the following: Accelerate the metabolism of ethanol and / or acetaldehyde; Delayed onset of intoxication; Shorten the sobering time; Reduce alcohol-related mortality; Reduce liver index; Reduce serum AST and / or ALT levels; Relieve discomfort caused by ethanol and / or acetaldehyde; Improve alcohol-induced oxidative stress, such as increasing GSH levels in the liver.

6. A microbial strain, characterized in that: The microbial strain is a fermented lactobacillus ( Limosilactobacillus fermentum )ibiome020, Lactobacillus fermentum( Limosilactobacillus fermentum )ibiome021、Lactobacillus fermentum( Limosilactobacillus fermentum ) at least one of the ibiome022 strains, the fermented Lactobacillus ( Limosilactobacillus fermentum )ibiome020, Lactobacillus fermentum( Limosilactobacillus fermentum )ibiome021、Lactobacillus fermentum( Limosilactobacillus fermentum ) The ibiome022 strain is deposited in the China Center for Type Culture Collection, located at China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit dates of January 24, 2024, January 26, 2024, and January 24, 2024, respectively.

7. A culture of the microbial strain according to claim 6 or a processed product thereof.

8. A medicine, characterized in that: The composition comprises the microbial strain according to claim 6, or the culture or processed product of the microbial strain according to claim 7, and pharmaceutically acceptable excipients. Preferably, the excipients include at least one of an adjuvant, a stabilizer or a protective agent, an antibacterial agent, an excipient, a solubilizing agent, a flavoring agent, a diluent, and a buffer.

9. A pharmaceutical composition, characterized in that: A microbial strain according to claim 6, or a culture or a processed product thereof comprising the microbial strain according to claim 7, and a combined drug, wherein the combined drug is other drugs that are used in combination with Lactobacillus fermentum ( Limosilactobacillus fermentum ) drugs that act synergistically.

10. A fermentation agent / functional bacterial agent / nutritional composition, characterized in that: Comprising the microbial strain according to claim 6, or the culture of the microbial strain according to claim 7 or a processed product thereof; preferably, the nutritional composition is a food, a nutrient, a supplement, a probiotic or a symbiotic bacteria.

Images