Complement molecule C1qb polyclonal antibody and colloidal gold test strip preparation method
By preparing C1qb polyclonal antibody and colloidal gold test strips, the accuracy and speed of C1q detection in the prior art were solved, and the rapid and convenient detection of C1q level was achieved, the sensitivity and specificity of the detection were improved, and it was suitable for a variety of clinical diagnosis.
Patent Information
- Application Number
- CN202510232632.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to accurately and quickly detect the complement molecule C1q. Because of the large molecular weight of C1q, there is a cross-reaction problem in the preparation of polyclonal antibodies, which affects the reliability of the detection results.
By truncating the recombinant protein C1qb as a coated antigen, high-titer antiserum was determined using the indirect ELISA method and purified by protein A column to prepare a polyclonal antibody capable of recognizing C1qb. In addition, colloidal gold labeling technology was used to prepare C1qb polyclonal antibody colloidal gold test strips to achieve rapid detection.
It realizes rapid and convenient detection of C1q level, overcomes the non-specific reaction problem caused by the large molecular weight of C1q, improves the sensitivity and specificity of the detection, and is suitable for early detection of autoimmune diseases, Alzheimer's disease and auxiliary diagnosis of infectious diseases.
Smart Images

Figure CN120058925A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of polyclonal antibody preparation, and in particular to a method for preparing a complement molecule C1qb polyclonal antibody and a method for preparing a colloidal gold test strip. Background Art
[0002] The complement system is an important component of the innate immune system. The complement molecule C1q is the initiator molecule of the classical activation pathway in the complement system and plays an important role in the body's immune defense and immune homeostasis.
[0003] The C1q molecule is a glycoprotein with a relatively large molecular weight, consisting of 18 polypeptide chains, including 6 a chains, 6 b chains and 6 c chains. The amino acid sequences of these three chains have certain homology, and structurally they all contain a collagen-like region at the N-terminus and a globular head region at the C-terminus. It is closely related to autoimmune diseases, infectious diseases, and neurodegenerative diseases, so the establishment of a detection method for C1q is particularly important. However, the C1q molecule is relatively large, and there is no more accurate, reliable, and rapid detection method. The preparation of polyclonal antibodies for C1q has many cross-reactions and is not conducive to the preparation of a detection kit. Therefore, the strategy adopted by the present invention is to take a part of C1q, namely C1qb. Establishing a detection for C1qb reflects the level of C1q. Summary of the invention
[0004] The primary purpose of the present invention is to provide a method for preparing a polyclonal antibody of the complement molecule C1qb. In the early stage, the C1q truncated recombinant protein C1qb is used as the coating antigen, and the high titer C1qb antiserum is determined by the indirect ELISA method, and the C1q polyclonal antibody is prepared by purification through a protein A column. The present invention also provides a method for preparing a colloidal gold test strip for detecting C1qb, which can quickly detect C1qb in body fluids to reflect the level of C1q. The disadvantages of C1q molecular weight being too large and the preparation of antibodies having more non-specific reactions, thereby affecting the test results, are overcome. The present invention provides a fast and convenient new method for infection detection, early detection of Alzheimer's Disease (AD), and auxiliary detection and diagnosis of autoimmune diseases.
[0005] The technical solution of the present invention is to clone the gene of C1qb into the pET28a vector in the early stage to obtain the C1qb recombinant protein. The electrophoretically pure C1qb recombinant protein is purified by Ni column. After emulsification, rabbits are immunized, and serum is obtained and purified by protein A column to finally prepare polyclonal antibodies and colloidal gold test strips capable of recognizing C1qb.
[0006] The technical solution of the present invention specifically includes the following contents:
[0007] A method for preparing a polyclonal antibody against complement molecule C1qb, comprising the following steps:
[0008] Step 1: Preparation of C1qb recombinant protein antigen;
[0009] Specific primers were designed for the C1qb gene sequence in NCBI. After amplifying the gene sequence, it was cloned into the pET28a vector, transformed into the expression strain BL21, and fermented to prepare the antigen. After purification by Ni column, an electrophoretically pure protein was obtained, and after renaturation and ultrafiltration, a recombinant protein with a concentration higher than 100 μg / mL was obtained for the preparation of polyclonal antibodies.
[0010] Step 2: Preparation of C1qb high-titer polyclonal antibody;
[0011] Using the C1qb recombinant protein as the coating antigen, female Japanese white rabbits at 12 weeks of age were subcutaneously immunized by multi-point subcutaneous injection. Then, blood was collected from the marginal ear vein for titer determination. After the titer was higher than 120,000, the whole blood of the rabbits was taken to prepare serum. After purification by protein A column, a high-titer polyclonal antibody was obtained and the titer was detected again to confirm the preparation of a high-titer polyclonal antibody.
[0012] Furthermore, in the said Step 2, using the C1qb recombinant protein as the coating antigen, female Japanese white rabbits at 12 weeks of age were subcutaneously immunized by multi-point subcutaneous injection. The specific immunization method: 200 μg was immunized each time, once a week; for the first immunization, it was emulsified evenly with an equal volume of Freund's complete adjuvant and then immunized, and for subsequent immunizations, it was emulsified evenly with an equal volume of Freund's incomplete adjuvant and then immunized. After three immunizations, for the fourth time, 100 μg of C1qb recombinant protein was emulsified evenly with Freund's incomplete adjuvant and then immunized.
[0013] A method for preparing a polyclonal antibody against complement molecule C1qb is prepared by using the above preparation method.
[0014] The present invention also provides a method for preparing a colloidal gold test strip of C1qb polyclonal antibody, comprising the following steps:
[0015] Step 1: Take 99 mL of ultrapure water, add 1 mL of 1% chloroauric acid solution and heat with stirring. After boiling, add 0.7 mL - 2 mL of 1% trisodium citrate to prepare colloidal gold of different particle sizes. It can be seen with the naked eye that the color of the colloidal gold solution changes from gray to purple and then to a stable red. After turning red, continue to stir and heat for 10 min - 15 min until the solution is transparent, and cool to room temperature. Add ultrapure water to make the solution volume constant to the original volume of 100 mL and store it in a 4°C refrigerator.
[0016] Step 2: Take the prepared colloidal gold solution, add 0.2M K 2 CO3 Adjust the pH of the solution, add the polyclonal antibody of complement molecule C1qb prepared (hereinafter referred to as C1qb polyclonal antibody), mix well and let stand for 20 min, and then add 10% NaCl solution for lysis reaction. Observe that the color of the solution no longer changes.
[0017] Step 3: The test strip consists of a sample pad, a nitrocellulose (NC) membrane, a water absorption pad, and a gold-labeled pad. Paste the sample pad at one end of the NC membrane so that 2 mm - 3 mm of the sample pad overlaps with the NC membrane; paste the water absorption pad at the other end of the NC membrane, also making it partially overlap with the NC membrane. Paste the gold-labeled pad between the sample pad and the NC membrane so that it partially overlaps with both the sample pad and the NC membrane to ensure that the liquid can pass through smoothly. Cut the glass fiber membrane into a size of 4 mm * 1 cm as the gold-labeled pad, soak the gold-labeled pad in the solution containing colloidal gold-labeled antibody for 20 min - 30 min, and then air-dry it at room temperature. Dot the C1qb polyclonal antibody on the NC membrane at a concentration of 0.8 mg / mL as the TL, and dilute the goat anti-rabbit IgG concentration to 0.6 mg / mL as the CL. Finally, form a complete test strip structure.
[0018] Further, in the said Step 1, the maximum absorption wavelength is measured by an enzyme-linked immunosorbent assay (ELISA) reader, and the morphology and uniformity of the colloidal gold are observed by transmission electron microscopy (TEM). It is determined that when the ratio of trisodium citrate: chloroauric acid is 1:1, the uniformity and particle size of the colloidal gold are the best.
[0019] Further, in the said Step 2, through the screening of the optimal antibody concentration gradient and pH value, by comparing the color change situation and detecting the maximum absorption wavelength by an ELISA reader, it is determined that 16 μg / mL of C1qb polyclonal antibody, 2 μL of 0.2 M K 2 CO 3 and 0.2 mL of 10% NaCl are added to 1 mL of colloidal gold solution, and the coupling effect of the C1qb polyclonal antibody and the colloidal gold is the best.
[0020] After comparison, the optimal reconstitution solution formula is 5% sucrose, 1% Tween-20, and 2% BSA.
[0021] Further, in step 3, in order to obtain the optimal monitoring conditions, the prepared recombinant antigen was diluted to the lowest detectable concentration for sample detection. First, the developing time was investigated, and the results showed that the bands in the test strip were clearer within 15 min. In order to improve the sensitivity and specificity of the colloidal gold test strip, C1qb polyclonal antibodies and secondary antibodies with concentration gradients were used for the experiment. After comparison, the optimal membrane coating concentration for TL was 0.8 mg / mL, and the optimal membrane coating concentration for CL was 0.6 mg / mL. In order to determine the lowest detection limit of C1qb in the sample detected by the colloidal gold test strip, C1qb was diluted with 0.01 M PBS solution into samples with gradient concentrations of 20 ng / mL, 40 ng / mL, 60 ng / mL, 80 ng / mL, and 100 ng / mL, and spotting tests were performed. After comparison, the test strip could detect C1qb protein as low as 20 ng / mL.
[0022] Advantages of the present invention:
[0023] The present invention uses the previously prepared C1q truncated C1qb recombinant protein as the coated antigen, determines a high-titer rabbit-derived polyclonal antiserum by the indirect ELISA method, purifies it through a protein A column, and for the first time prepares a C1qb polyclonal antibody. Based on this, the optimal pH, antibody concentration, and colloidal gold labeling conditions are screened. By designing a gradient of standard protein concentrations, a detection and diagnostic colloidal gold test strip with a C1qb protein concentration as low as 20 ng / mL is prepared, which has good sensitivity and specificity and can provide an effective detection method for the rapid clinical diagnosis of autoimmune diseases, early AD, and infectious diseases. Description of the drawings
[0024] Figure 1 It is the SDS-PAGE gel electrophoresis pattern of the recombinant protein C1qb purified by Ni column in the present invention; Lane M: 26616 Marker, Lane 1: total protein of the loaded sample, Lane 2: protein fraction not bound to the column, Lane 3: protein fraction eluted with the equilibration buffer, Lane 4: protein fraction eluted with 50 mM imidazole, Lane 5: protein fraction eluted with 100 mM imidazole, Lane 6: protein fraction eluted with 500 mM imidazole, Lane 7: elution fraction with EDTA;
[0025] Figure 2 It is the SDS-PAGE gel electrophoresis pattern of the C1qb polyclonal antibody purified by protein A column in the present invention; Lane M: 26616 Marker, Lane 1: unpurified antiserum, Lane 2: fraction not bound to the column, Lane 3: eluted fraction at pH 7.2, Lane 4: eluted fraction at pH 3.0;
[0026] Figure 3 Determination of the titer of the C1qb polyclonal antiserum and antibody in the present invention by ELISA method;
[0027] Figure 4 Comparison of the maximum absorption peaks of colloidal gold to determine the uniformity of colloidal gold in the present invention;
[0028] Figure 5 Observation of the particle size uniformity of colloidal gold by transmission electron microscopy in the present invention;
[0029] Figure 6 Determination of the optimal amount of antibody conjugated to colloidal gold in the present invention; where (a) is the absorbance-concentration curve, and (b) is the result diagram of the colloidal gold immunochromatographic assay;
[0030] Figure 7 Determination of the optimal pH value of the antibody conjugated to colloidal gold in the present invention; where (a) is the absorbance-K 2 CO 3 dose curve, and (b) is the result diagram of the colloidal gold immunochromatographic assay;
[0031] Figure 8 Comparison of the optimal detection time of the colloidal gold test strip in the present invention; where (a) is the change of the clarity of the test strip over time, and (b) is the color development effect of four different reconstitution solutions;
[0032] Figure 9 Determination of the optimal coating antibody concentration of the colloidal gold test strip in the present invention; where (a) is the optimal CL membrane coating concentration, and (b) is the optimal TL membrane coating concentration;
[0033] Figure 10 Comparison of the lowest detection line of the colloidal gold test strip in the present invention. Detailed implementation manners
[0034] Furthermore, the present invention will be elaborated in detail below in combination with the accompanying drawings through specific implementation manners and implementation cases. The specific implementation manners and examples described herein are only used to illustrate the present invention in detail and do not limit the present invention.
[0035] For those experimental steps or conditions not specified in the examples, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. For the reagents and instrument equipment not specified for the manufacturer, they are all conventional reagent products that can be obtained through commercial purchase.
[0036] Experimental materials: Female Japanese white rabbits at 12 weeks of age were purchased from Liaoning Changsheng Biotechnology Co., Ltd.; Protein A was purchased from Beijing Solarbio Science & Technology Co., Ltd.; Freund's complete adjuvant and Freund's incomplete adjuvant were purchased from SIGMA; Tween-20 was purchased from Beijing Solarbio Science & Technology Co., Ltd.; Goat anti-rabbit antibody was purchased from Shanghai Sangon Biotech Co., Ltd.; TMB solution, PBS, 5X protein loading buffer, and 5X-Tris glycine electrophoresis buffer were purchased from Beijing Solarbio Science & Technology Co., Ltd.; Skim milk powder and SDS-PAGE gel kit were purchased from Beyotime Biotechnology Co., Ltd.; Chloroauric acid and trisodium citrate were purchased from Sinopharm Chemical Reagent Co., Ltd.; PVC plates, nitrocellulose (NC) membranes, sample pads, absorbent pads, and gold conjugate pads were purchased from Shanghai Goldbio Co., Ltd.
[0037] In the present invention, the test strip is composed of a sample pad, a nitrocellulose (NC) membrane, an absorbent pad, and a gold conjugate pad. The sample pad is pasted at one end of the NC membrane so that 2 mm - 3 mm of the sample pad overlaps with the NC membrane; the absorbent pad is pasted at the other end of the NC membrane, also making it partially overlap with the NC membrane. The gold conjugate pad is pasted between the sample pad and the NC membrane, making it partially overlap with both the sample pad and the NC membrane to ensure that the liquid can pass through smoothly. The glass fiber membrane is cut into a size of 4 mm * 1 cm as the gold conjugate pad, and the gold conjugate pad is soaked in a solution containing colloidal gold-labeled antibody for 30 min and then air-dried at room temperature.
[0038] Example 1
[0039] A method for preparing a polyclonal antibody against C1qb, comprising the following steps:
[0040] Step 1: Preparation of C1qb recombinant protein antigen;
[0041] Specific primers were designed for the C1qb gene sequence in NCBI, and the primer sequences were:
[0042] C1qb-F: ATGAAGACACAGTGGGGTGAGG;
[0043] C1qb-R: TTACGCATCCATGTCAGGGAAAAG;
[0044] Use high-fidelity DNA polymerase for PCR amplification to obtain the C1qb gene fragment, and perform agarose gel electrophoresis on the PCR product to confirm whether the size of the amplified fragment is correct. After amplifying the gene sequence, select NdeI and XhoI restriction sites to clone into the pET28a vector, transform the recombinant plasmid into the expression strain BL21, and spread the transformed recombinant bacteria on LB plates containing kanamycin and culture overnight to screen out successfully transformed colonies. Pick a single colony and inoculate it into LB liquid culture medium containing kanamycin and culture at 37°C until OD 600 When the pH reaches 0.6-0.8, isopropyl-β-D-thiogalactoside (IPTG) is added to a final concentration of 0.5mM-1mM to induce the expression of the C1qb gene driven by the T7 promoter, and the culture is expanded for 4h and the expression is induced by IPTG at 37℃ for 4h. After centrifugation at 4000rpm for 15min, the bacteria are collected and the culture medium is removed and the pre-cooled 10mM PBS is repeatedly blown and resuspended with a pipette. The resuspended bacteria are placed in ice water and ultrasonically broken and centrifuged at 12000rpm for 15min to obtain precipitated inclusion bodies, which are denatured and dissolved overnight at 4℃ by the equilibrium solution (pH 8.0 Tris buffer containing 8M urea). The next day, centrifuge at 12000rpm and 4℃ for 40min, and the supernatant protein solution is drawn with a syringe. After filtering out the residue through 0.45μm and 0.22μm filters, the supernatant protein solution is purified on a Ni column. After balancing solution, elution with 50mM imidazole, and removal of impurities with 100mM imidazole, the electrophoretically pure C1qb recombinant protein with a molecular weight of about 28kDa was obtained when eluting with 500mM imidazole, which was consistent with the protein molecular weight predicted by the amino acid sequence. No uneluted recombinant protein was found under the ethylenediaminetetraacetic acid (EDTA) elution condition, indicating that the 500mM imidazole elution condition is more suitable for the C1qb recombinant protein ( Figure 1 ). The C1qb recombinant protein was renatured by diluting the sample 10 times in batches using pre-cooled 10mM PBS. A 0.22μm filter was used to remove the precipitated protein in the interval between each dilution and the urea concentration was gradually reduced using an ultrafiltration tube. The recombinant protein obtained by refolding ultrafiltration was measured by the BCA protein concentration detection kit to have a concentration of approximately 200μg / mL. This concentration higher than 100μg / mL can be used for the preparation of polyclonal antibodies.
[0045] Step 2: Preparation of high titer polyclonal antibody against C1qb;
[0046] Female Japanese white rabbits at 12 weeks of age were subcutaneously immunized by multi-point subcutaneous injection. Each immunization used 200 μg of C1qb recombinant protein, and the immunization was carried out once a week. For the first immunization, it was emulsified evenly with an equal volume of Freund's complete adjuvant before immunization. For subsequent immunizations, it was emulsified evenly with an equal volume of Freund's incomplete adjuvant before immunization. After three immunizations, for the fourth time, 100 μg of C1qb recombinant protein was emulsified evenly with Freund's incomplete adjuvant before immunization as a booster injection to further enhance the antibody titer. Finally, blood was collected from the marginal ear vein for titer determination. The titer determination used the ELISA (enzyme-linked immunosorbent assay) method. The immune effect was evaluated by detecting the antibody concentration against C1qb in the serum. After the titer was higher than 120,000, whole blood of the rabbit was taken to prepare serum. 100 μL of C1qb recombinant protein at a concentration of 10 μg / mL was added to the polystyrene plate to coat the antigen overnight at 4°C. After blocking, the rabbit serum and goat anti-rabbit secondary antibody diluted in gradients were incubated respectively. After the TMB color reaction, the OD value was detected by an enzyme-linked immunosorbent assay. The positive serum was determined by whether the P / N value (the ratio of the OD values of positive serum and negative serum) was greater than 1.8. The highest dilution degree at this time was the titer of the serum. After detection, at the condition of 1:128,000, the P / N value was 1.9, higher than 1.8. Therefore, the titer of the antiserum was about 128,000. Finally, after purification by a protein A column, the miscellaneous proteins in the serum were removed under the elution condition of pH 7.2, and polyclonal antibody IgG with electrophoretic purity was obtained under the condition of pH 3.0, in which the heavy chain was about 50 kDa and the light chain was about 25 kDa( Figure 2 ).). The titer was detected again to confirm that a high-titer C1qb polyclonal antibody was prepared( Figure 3 ).
[0047] ELISA titer determination steps:
[0048] 1. Coating antigen
[0049] Using C1qb recombinant protein as the antigen, 100 μL at a concentration of 10 μg / mL was added to each well of the ELISA plate. The ELISA plate was incubated overnight at 4°C to enable the antigen to bind firmly to the surface of the well.
[0050] 2. Blocking
[0051] Using the blocking solution (PBST solution containing 5% skim milk powder), 200 μL was added to each well to reduce non-specific binding. Blocking was carried out at 37°C for 1 h.
[0052] 3. Diluting antibody
[0053] The C1qb polyclonal antiserum and negative control serum were serially diluted. The dilution multiples ranged from 1000-fold to 128,000-fold.
[0054] 4. Adding antibody
[0055] Add the diluted antiserum into the corresponding ELISA wells, 100 μL per well. Incubate the ELISA plate at 37 °C for 1 h to allow the antibodies to bind to the antigens.
[0056] 5. Washing
[0057] Wash the ELISA plate with the washing solution (PBST, i.e., PBS solution containing 0.05% Tween-20) to remove the unbound antibodies. Repeat the washing 3 times.
[0058] 6. Adding the secondary antibody
[0059] Add the enzyme-labeled secondary antibody (HRP-labeled goat anti-rabbit antibody IgG) that specifically binds to the primary antibody (polyclonal antiserum). Incubate the ELISA plate at 37 °C for 1 h.
[0060] 7. Washing again
[0061] Repeat the washing process in step 5.
[0062] 8. Color development
[0063] Add the chromogenic substrate (TMB substrate) and react at 37 °C for 15 min to allow the color to develop.
[0064] 9. Terminating the reaction
[0065] Add the stop solution (10% sulfuric acid) to stop the reaction.
[0066] 10. Measurement
[0067] Measure the absorbance (OD value) of each well at a wavelength of 450 nm using an ELISA reader.
[0068] 11. Data analysis
[0069] Based on the absorbance values, plot a standard curve to determine the titer of the antibody.
[0070] Example 2
[0071] A method for preparing colloidal gold, comprising the following steps:
[0072] Add 99 mL of ultrapure water and 1 mL of 1% chloroauric acid solution to a clean 250-mL beaker, and heat with stirring. After heating to boiling, add 0.7 mL, 1.0 mL, 1.5 mL, and 2 mL of 1% sodium citrate solution respectively to prepare colloidal gold with different particle sizes. It can be seen that the color of the colloidal gold solution changes from gray to purple and then to a stable red. After the solution turns red, continue stirring and heating for 10 min until the solution becomes transparent. Cool to room temperature, and add ultrapure water to restore the solution to its original volume of 100 mL. Store it in a refrigerator at 4°C. Judgment of the quality of colloidal gold: The prepared colloidal gold solution can be judged by observing its color, light transmittance, and uniformity with the naked eye. A distinct Tyndall effect can be observed when irradiated with a laser pointer. Accurately pipette 200 μL of the colloidal gold solution into a 96-well plate, and perform absorption spectrum scanning within the wavelength range of 400 nm - 600 nm using an enzyme-linked immunosorbent assay (ELISA) reader. A narrower peak width and a smaller peak height ratio indicate that the colloidal gold is more homogeneous ( Figure 4 ). As can be seen from Figure 4 , the colloidal gold solution (red curve) prepared with 1.0 mL of sodium citrate has a narrower peak width and a moderate peak height. That is, when the ratio of sodium citrate to chloroauric acid is 1:1, the colloidal gold has the best homogeneity and particle size, and the best quality. Ultrasonicate the prepared colloidal gold in an ultrasonic cleaning tank in a centrifuge tube for 10 min to disperse the particle aggregates. Pipette 50 μL of the colloidal gold, drop it on a copper mesh, and after drying at room temperature, perform transmission electron microscopy (TEM) detection. If the colloidal gold particles are of uniform size under the electron microscope, it indicates stable properties, strong affinity, good biocompatibility, and easy immobilization and modification of biomolecules ( Figure 5 ).
[0073] Example 3
[0074] A method for preparing a C1qb polyclonal antibody colloidal gold test strip and its application, including the following steps:
[0075] Step 1: Preparation of colloidal gold-coupled antibody;
[0076] To determine the optimal labeling amount of the antibody protein. Take 1 mL of the colloidal gold solution prepared in Example 2, add 2 μL of 0.2 M K 2 CO 3 solution to adjust to the optimal pH, change the amount of protein added, and add 0, 2, 4, 8, 16, and 32 μg of the prepared C1qb polyclonal antibody (pAbs) from a - f respectively. Mix well and let stand for 20 min, then add 200 μL of 10% NaCl solution for a breaking reaction. It can be observed with the naked eye that the color of the solution no longer changes when the protein amount is 8 μg ( Figure 6(a)), further measured with a spectrophotometer, the results were consistent. As the antibody dose increased, the absorbance value gradually increased until it reached a plateau, indicating that within this dose range, the antibody was saturated, and further increasing the dose would not significantly change the absorbance. Figure 6 (b)). To allow the pAbs to fully bind to the colloidal gold, some additional pAbs were added based on 8 μg, and subsequent experiments were carried out with 16 μg of pAbs for labeling. The method for determining the optimal pH when the above colloidal gold particles were labeled with antibody protein is as follows: For 1 mL of colloidal gold solution, by adjusting the addition amount of 0.2 M K 2 CO 3 solution, the pH environment during the preparation of colloidal gold was changed. 0, 1, 2, 3, 4, and 5 μL of 0.2 M K 2 CO 3 were added from a - f respectively. When the addition condition was 2 μL of 0.2 M K 2 CO 3 solution, the colloidal gold solution maintained a stable state, and further increasing the addition amount of 0.2 M K 2 CO 3 solution could not change the solution color. Figure 7 (b)), further measured with a spectrophotometer, the results were consistent. Figure 7 (a)), so the amount of 2 μL of 0.2 M K 2 CO 3 was the addition amount of the optimal pH. Through the optimal antibody concentration gradient, by comparing the color change situation to screen the pH value, and by detecting the maximum absorption wavelength with an enzyme - linked immunosorbent assay (ELISA) reader, it was determined that adding 16 μg / mL of C1qb polyclonal antibody, 2 μL of 0.2 M K 2 CO 3 , and 200 μL of 10% NaCl solution to 1 mL of colloidal gold solution could achieve the best coupling effect between C1qb polyclonal antibody and colloidal gold.
[0077] Using a complex solution can make the coupled colloidal gold - antibody complex maintain a dispersed state, which is convenient for subsequent storage and application. The optimal complex solution formula in the present invention is 5% sucrose, 1% Tween - 20, and 2% BSA.
[0078] Step two: Optimization and application of the colloidal gold test strip;
[0079] To obtain the best monitoring conditions, the prepared C1qb recombinant protein antigen was diluted to the lowest detectable concentration for sample detection. The test strip consists of a sample pad, a nitrocellulose (NC) membrane, an absorbent pad, and a gold-labeled pad. The primary or secondary antibody that specifically binds to the C1qb recombinant protein antigen was pre-fixed on the test strip by dotting or spraying. The test strip was dried to ensure that the antibody was firmly attached to the test strip. The test strip was cut into an appropriate size and connected to the absorbent paper and the sample pad to form a complete test strip structure. First, the developing time was investigated. 100 μL of the C1qb recombinant protein antigen with a concentration of 20 ng / mL was dropped on the sample pad of the prepared test strip. By comparing the clarity of the TL and CL test lines at different time points, the best monitoring conditions of the test strip were determined. The results showed that the bands in the test strip were clearer within 15 min, gradually began to blur after 30 min, and almost disappeared after 2 h( Figure 8 (a)). To further verify the best monitoring conditions, a spectrophotometer was used to measure the absorbance of the test strip at different time points to evaluate the intensity of the bands on the test strip. The measurement results of the spectrophotometer should be consistent with the results observed by the naked eye, that is, at 10 min, the absorbance of the test strip reached the maximum value and then began to decline. Based on this result, the result was judged within 15 min, which reflected the convenience and accuracy of this method.
[0080] After determining the best monitoring conditions, it is also necessary to select a suitable reconstitution solution formula to ensure the stability of the test strip during storage and use. Four reconstitution solution formulas were designed: 4% sucrose, 0.5% Tween-20, 1.5% BSA; 5% sucrose, 1% Tween-20, 2% BSA; 6% sucrose, 1.5% Tween-20, 2.5% BSA; 5% glucose, 1% Tween-20, 2% BSA, which were used for test strips 1-4 in turn. After comparing the color development effects of the test strips with four different reconstitution solution formulas, as Figure 8 (b) shows, the color development effect of the second test strip was the clearest. Therefore, the best reconstitution solution formula was determined to be 5% sucrose, 1% Tween-20, and 2% BSA. This formula helps to maintain the stability of the test strip and prevent the blurring or disappearance of the bands.
[0081] To improve the sensitivity and specificity of the colloidal gold test strip, antibodies and secondary antibodies (goat anti-rabbit antibodies) with a concentration gradient were set for testing. The CL antibody concentration was set to be diluted to 0.4 mg / mL, 0.6 mg / mL, and 1.0 mg / mL. After comparison, the CL of the second group of test strips was clearer. Therefore, the best CL membrane coating concentration was determined to be 0.6 mg / mL( Figure 9(a)). The concentrations of the TL antibody were set at 0.05 mg / mL, 0.1 mg / mL, 0.2 mg / mL, 0.4 mg / mL, 0.8 mg / mL, and 1.6 mg / mL. After comparison, the TL of the fifth group of test strips was relatively clear. Therefore, the optimal TL membrane coating concentration was determined to be 0.8 mg / mL( Figure 9 (b)). To determine the lowest detection limit of C1qb in the sample by the colloidal gold test strip, C1qb was diluted with 0.01 M PBS solution into samples with gradient concentrations of 20 ng / mL, 40 ng / mL, 60 ng / mL, 80 ng / mL, and 100 ng / mL, and spotted for testing. After comparison, a clear detection band could still be seen on the first group of test strips of this test strip. Therefore, it was determined that the test strip could detect C1qb protein as low as 20 ng / mL Figure 10 ).
Claims
1. A method for preparing a polyclonal antibody against complement molecule C1qb, characterized in that: The gene of C1qb was cloned into the pET28a vector to obtain the C1qb recombinant protein, which was then purified by Ni column to obtain the electrophoretically pure C1qb recombinant protein. After emulsification, rabbits were immunized and the serum was obtained and purified by protein A column to prepare a polyclonal antibody that can recognize C1qb.
2. The method for preparing a polyclonal antibody against complement molecule C1qb according to claim 1, characterized in that: The following steps are involved: Step 1: Preparation of C1qb recombinant protein antigen; Specific primers were designed for the C1qb gene sequence in NCBI, and the gene sequence was amplified and cloned into the pET28a vector, which was transformed into the expression strain BL21 for fermentation to prepare the antigen. After Ni column purification, the electrophoresis-pure protein was obtained, and the recombinant protein with a concentration higher than 100 μg / mL was obtained by refolding ultrafiltration. Step 2: Preparation of high titer polyclonal antibody against C1qb; Using C1qb recombinant protein as coating antigen, female Japanese big-eared rabbits were subcutaneously immunized by multiple subcutaneous injections, and then blood was collected from the marginal ear vein for titer determination. When the titer was higher than 120,000, whole blood was collected from the rabbit to prepare serum, and high-titer polyclonal antibodies were obtained after purification with a protein A column.
3. The method for preparing a polyclonal antibody against complement molecule C1qb according to claim 2, characterized in that: In the step 2, C1qb recombinant protein is used as the coating antigen, and 12-week-old female Japanese big-eared rabbits are subcutaneously immunized by multiple subcutaneous injections. The specific immunization method is: 200 μg each time, once a week; the first immunization is emulsified with an equal volume of Freund's complete adjuvant and then immunized, and the subsequent immunizations are emulsified with an equal volume of Freund's incomplete adjuvant and then immunized. After three immunizations, 100 μg of C1qb recombinant protein is emulsified with Freund's incomplete adjuvant and then immunized for the fourth time.
4. A polyclonal antibody against complement molecule C1qb, characterized in that: The method is prepared by any one of claims 1 to 3.
5. A method for preparing a C1qb polyclonal antibody colloidal gold test strip, characterized in that: The following steps are involved: Step 1: Take 99mL ultrapure water, add 1mL 1% chloroauric acid solution and heat and stir until boiling, then add 0.7mL-2mL 1% trisodium citrate to burn the colloidal gold. The color of the colloidal gold solution can be seen to change from gray to purple and then to a stable red. After turning red, continue to stir and heat for 10min-15min until the solution is transparent, cool to room temperature, add ultrapure water to make the solution dilute to the original volume of 100mL, and store in a refrigerator at 4℃; Step 2: Take the prepared colloidal gold solution, add 0.2M K2CO3 solution to adjust the pH, add the polyclonal antibody of complement molecule C1qb as claimed in claim 4, mix and let stand for 20 minutes, then add 10% NaCl solution for decomposition reaction, and observe that the color of the colloidal gold solution no longer changes; Step 3: The test strip consists of a sample pad, NC membrane, a water absorbent pad, and a gold label pad. The sample pad is pasted on one end of the NC membrane so that the sample pad and the NC membrane overlap by 2mm-3mm. The water absorbent pad is pasted on the other end of the NC membrane so that it also overlaps with the NC membrane. The gold label pad is pasted between the sample pad and the NC membrane so that it overlaps with both the sample pad and the NC membrane to ensure that the liquid can pass smoothly. The glass fiber membrane is cut into a size of 4mm*1cm as the gold label pad. The gold label pad is soaked in a solution containing colloidal gold-labeled antibodies for 20min-30min and then dried naturally at room temperature.
6. The method for preparing a C1qb polyclonal antibody colloidal gold test strip according to claim 5, characterized in that: In the step 1, the ratio of trisodium citrate to chloroauric acid is 1:
1.
7. The method for preparing a C1qb polyclonal antibody colloidal gold test strip according to claim 5, characterized in that: In the step 2, 16 μg / mL of polyclonal antibody of complement molecule C1qb, 2 μL of 0.2M K2CO3, and 0.2 mL of 10% NaCl were added to 1 mL of colloidal gold solution.
8. The method for preparing a C1qb polyclonal antibody colloidal gold test strip according to claim 5, characterized in that: In the step 3, the concentration of the polyclonal antibody of the complement molecule C1qb was set to 0.8 mg / mL as TL on the NC membrane by spot coating, and the concentration of goat anti-rabbit IgG was diluted to 0.6 mg / mL as CL.
9. The method for preparing a C1qb polyclonal antibody colloidal gold test strip according to claim 5, characterized in that: In step 3, the detection limit of the test strip is 20 ng / mL of C1qb protein.
10. The method for preparing a C1qb polyclonal antibody colloidal gold test strip according to claim 5, characterized in that: Reconstitution solution formula: 5% sucrose, 1% Tween-20, 2% BSA.