Method for inducing plant disease resistance by using hydrolase active mutant of xyloglucan specific glucanase XEG1

Abstract

The invention discloses a method for inducing plant disease resistance by using a hydrolase active mutant of xyloglucan specific glucanase XEG1. A pichia pastoris eukaryotic expression system is utilized to obtain the purified hydrolase activity mutant XEG1E136D protein of the phytophthora sojae core pathogenic factor xyloglucan specific glucanase XEG1, and the hydrolase activity mutant XEG1E136D protein does not have the hydrolase activity of plant cell walls and can activate the systemic resistance of plants. The XEG1E136D is overexpressed into a biocontrol bacterium trichoderma harzianum by utilizing an agrobacterium-mediated fungal transformation optimization system, and the XEG1E136D is proved to be capable of secreting XEG1E136D protein to the outside of cells and activating the broad-spectrum systemic resistance of plants. The XEG1E136D protein expressed by the trichoderma harzianum can be used as a plant vaccine to improve the prevention and treatment effect, and the trichoderma harzianum XEG1E136D protein has a wide application prospect in the field of plant disease prevention and treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for inducing plant disease resistance by using a hydrolase activity mutant XEG1 of the xyloglucan-specific glucanase XEG1, a core pathogenic factor of Phytophthora sojae. E136D Specifically, it is a method for activating broad-spectrum systemic resistance of plants by using an engineered bacterium to express the XEG1 E136D protein as a "plant vaccine". Background Art

[0002] Phytophthora sojae in Oomycete can cause soybean root rot by infecting the roots and stems of soybeans, causing serious losses to the global economy. In agricultural production, the proportion of excellent varieties resistant to soybean root rot is relatively low, and the evolution and variation of pathogens have caused soybeans to lose their resistance to them; many chemical agents have poor control effects on soybean root rot and are prone to cause drug resistance in pathogens, and will also cause serious environmental pollution. Therefore, it is of great significance to develop green, efficient, and long-lasting Phytophthora control strategies. There is an innate immune system in plants, mainly including two categories: one is pathogen-associated molecular patterns (PAMPs), which can be recognized by pattern recognition receptors (PRRs) on the surface of plant cell membranes, activating the non-specific basic defense response of host plants, that is, PTI immune response. This immune response has a certain effect on most pathogens and has persistence and broad-spectrum properties; the other is the avirulence effector proteins of pathogens, which can be recognized by intracellular NLR (Nucleotide-bounding leucine-rich repeat proteins) disease-resistant proteins (i.e., R proteins), thus triggering a stronger immune response in plants, that is, ETI (Effector-triggered immunity) immune response. The two major immune systems of plants, PTI and ETI, work together to resist the infection of pathogens. Previous studies in our laboratory have shown that the core virulence factor of Phytophthora sojae, xyloglucan-specific glucanase XEG1, depends on its hydrolase activity to exert its toxic function and can be recognized by the cell membrane receptor protein RXEG1 in plants to activate plant immune responses. Using biological agents instead of traditional chemical control not only ensures the yield and quality of crops but also protects the ecological environment. Spraying biological agents in the field can quickly enrich microorganisms in the soil and play a long-term and effective ecological function. Trichoderma harzianum in biological agents has strong competitiveness and metabolic ability, parasitizes pathogens through competition for nutrients and ecological niches or antagonizes pathogens, has broad-spectrum resistance to a variety of pathogens, and is widely used in the prevention and control of various soil-borne diseases in the field. At present, Trichoderma harzianum can produce various glycoside hydrolases through industrial fermentation.

[0003] Plant immune elicitors, namely "plant vaccines", mainly enhance the physiological functions of plants, increase the resistance of plants to pathogenic factors, and thus improve the induced resistance of plants. The research of this invention found that the xyloglucan-specific glucanase with mutated hydrolase activity in Phytophthora sojae loses its toxic function, so it can be used as a good plant immune elicitor and can be expressed by engineered bacteria to achieve the field control of plant diseases. Summary of the Invention

[0004] The object of the present invention is to provide a hydrolase activity mutant XEG1 of the xyloglucan-specific glucanase XEG1, a core pathogenic factor of Phytophthora sojae. E136D Its application in activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases.

[0005] Another object of the present invention is to provide a method for activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases.

[0006] Another object of the present invention is to provide a product for activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases.

[0007] The object of the present invention can be achieved by the following technical solutions:

[0008] In a first aspect, the present invention claims protection for a protein XEG1 with an amino acid sequence as shown in SEQ ID NO.1 E136D or a biomaterial related to the protein XEG1 E136D in at least one of the following (A1)-(A4):

[0009] (A1) Application in activating or inducing broad-spectrum systemic resistance in plants;

[0010] (A2) Application in preparing a product for activating or inducing broad-spectrum systemic resistance in plants;

[0011] (A3) Application in controlling plant diseases;

[0012] (A4) Application in preparing a product for controlling plant diseases.

[0013] Furthermore, the biomaterial related to the protein XEG1 E136D is at least one of the following (B1)-(B4):

[0014] (B1) A nucleic acid molecule encoding the protein XEG1 E136D ;

[0015] (B2) An expression cassette containing the nucleic acid molecule described in (B1);

[0016] (B3) A recombinant vector containing the nucleic acid molecule described in (B1), or a recombinant vector containing the expression cassette described in (B2);

[0017] (B4) A recombinant microorganism containing the nucleic acid molecule described in (B1), or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector described in (B3).

[0018] Furthermore, the nucleotide sequence of the nucleic acid molecule in (B1) is as shown in SEQ ID NO.2 or SEQ ID NO.3.

[0019] Furthermore, the above application is: expressing the protein XEG1 using an engineered bacterium. E136D As a plant immune elicitor, it activates or induces broad-spectrum systemic resistance in plants or controls plant diseases.

[0020] In a second aspect, the present invention claims a method for activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases, which comprises overexpressing the aforementioned protein XEG1 in an engineered bacterium strain and applying the engineered bacterium strain to plants. E136D In a third aspect, the present invention claims a product for activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases, which product comprises at least one of the following (C1)-(C4):

[0021] (C1) The aforementioned protein XEG1;

[0022] (C2) A preparation containing the protein XEG1; E136D ;

[0023] (C3) An engineered bacterium strain for overexpressing the protein XEG1; E136D (C4) A bacterial agent, biological fertilizer, bacterial suspension or fermentation product prepared from the engineered bacterium strain described in (C3).

[0024] In the technical solution of the present invention, the engineered bacterium is a biocontrol bacterium or an expression bacterium. Further, the biocontrol bacterium is Trichoderma harzianum, but not limited thereto; the expression bacterium is Pichia pastoris, but not limited thereto. E136D In the technical solution of the present invention, the activation or induction of broad-spectrum systemic resistance in plants is the activation or induction of immune resistance of plants to pathogenic bacteria; the control of plant diseases is to improve the ability of plants to resist diseases caused by pathogenic bacteria; the pathogenic bacteria are at least one of oomycetes, fungi and bacteria that can infect crops.

[0025] Further, the pathogenic bacteria are at least one of Phytophthora sojae, Fusarium oxysporum and Magnaporthe oryzae. The plant is at least one of soybean, tobacco, tomato and potato.

[0026] In a fourth aspect, the present invention claims the aforementioned protein XEG1 or its related biological materials.

[0027] During the research process of the present invention, two enzyme activity mutation sites of the xyloglucan-specific glucanase XEG1, a core pathogenic factor of Phytophthora sojae, were screened out, namely E136D and E222D (as

[0028]

[0029] In a fourth aspect, the present invention claims the aforementioned protein XEG1 E136D or its related biological materials.

[0030] During the research process of the present invention, two enzyme activity mutation sites of the xyloglucan-specific glucanase XEG1, a core pathogenic factor of Phytophthora sojae, were screened out, namely E136D and E222D (as Figure 1As shown in the figure, the amino acid sequence of the E136D protein is SEQ ID NO.1, and the nucleotide sequence of its encoding gene is SEQ ID NO.2. Research has found that among the two enzyme activity mutation sites, when Glu136 mutates to Asp136, the 3D simulated interaction distance between XEG1 and RXEG1 changes from 3.3 Å to 3.8 Å; when Glu222 mutates to Asp222, the 3D simulated interaction distance between XEG1 and RXEG1 changes from 2.7 Å to 4.7 Å. Therefore, E136D has a relatively small impact on the interaction between XEG1 and RXEG1. Therefore, the present invention uses XEG1 E136D as the object, and adopts an efficient and universal recombinant protein expression and preparation method based on three steps of affinity chromatography, ion exchange, and gel sieving to obtain a high-purity protein.

[0031] The present invention has established an overexpression system and screening of overexpressed strains of Trichoderma harzianum XEG1 mediated by Agrobacterium tumefaciens. E136D

[0032] The present invention utilizes the biocontrol bacterium Trichoderma harzianum to secrete XEG1 E136D protein extracellularly and uses it as a "plant vaccine" to activate broad-spectrum systemic resistance in plants.

[0033] Advantages of the present invention:

[0034] The present invention uses the Pichia pastoris eukaryotic expression system to obtain a large amount of purified hydrolase activity mutant XEG1 of the xyloglucan-specific glucanase XEG1, a core pathogenic factor of Phytophthora sojae. E136D The protein has been verified to have no hydrolase activity against plant cell walls and can activate systemic resistance in plants. The present invention uses an optimized system for Agrobacterium-mediated fungal transformation to overexpress XEG1 E136D into the biocontrol bacterium Trichoderma harzianum (T-22). It has been verified that it can secrete XEG1 E136D protein extracellularly and activate broad-spectrum systemic resistance in plants. The control effect can be improved by using Trichoderma harzianum to express XEG1 E136D protein as a "plant vaccine", and it has broad application prospects in the field of controlling plant diseases. Description of the Drawings

[0035] Figure 1 are two enzyme activity mutation sites of XEG1.

[0036] Figure 2 is XEG1 E136D recombinant protein purification result.

[0037] Figure 3 is the establishment of the overexpression system of Trichoderma harzianum XEG1 E136D ​​

[0038] Figure 4 For Trichoderma harzianum XEG1 E136D Screening of overexpression strains.

[0039] Figure 5 For Trichoderma harzianum T-22 E136D Extracellular secretion of XEG1 E136D protein.

[0040] Figure 6 For Trichoderma harzianum T-22 E136D Activating the systemic resistance of soybean Hefeng 47 to resist the infection of Phytophthora sojae;

[0041] Among them, a. Phenotype map of soybean treated with different Trichoderma strains and then inoculated with Phytophthora sojae; b. Biomass analysis of soybean treated with different Trichoderma strains and then inoculated with Phytophthora sojae; c. Lesion length analysis of soybean treated with different Trichoderma strains and then inoculated with Phytophthora sojae.

[0042] Figure 7 For Trichoderma harzianum T-22 E136D Activating the systemic resistance of tobacco to resist the infection of Phytophthora nicotianae;

[0043] Among them, a. Phenotype map of tobacco treated with different Trichoderma strains and then inoculated with Phytophthora nicotianae; b. Biomass analysis of tobacco treated with different Trichoderma strains and then inoculated with Phytophthora nicotianae. Specific implementation manners

[0044] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clear and understandable, the present invention will be further described in detail below with reference to embodiments.

[0045] The experimental methods used in the following embodiments are all conventional methods unless otherwise specified.

[0046] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0047] Example 1: Preparation method of high-purity XEG1 E136D

[0048] 1. Establishment of Pichia pastoris eukaryotic expression system for XEG1 E136D

[0049] (1)Cloning of target gene

[0050] According to the cDNA sequence of XEG1 E136D specific primers were designed, and XEG1 synthesized after optimizing fungal codons by PCR E136D ​​The target fragment sequence was amplified using a sequence as a template (the codon-optimized sequence is shown in SEQ ID NO.3), where the forward primer sequence is GGGACTGGGCCAAGAGCACTA (SEQ ID NO.6), the reverse primer sequence is ATGGTCTTGGTGGCGACGAAC (SEQ ID NO.7), and 6 histidine tags and a stop codon were added at the C-terminus.

[0051] (2) Construction of the Pichia pastoris eukaryotic expression vector

[0052] It includes digesting the pPIC9K plasmid (commercially available, Thermo Fisher) with the restriction endonuclease SnaBI; verifying by gel electrophoresis and recovering the digestion products; the target gene PsXEG1 E136D ligating the linearized vector pPIC9K; transforming the ligation product into competent Escherichia coli JM109 cells and screening for positive clones; the recombinant transformant pPIC9K-XEG1 E136D plasmid extraction; pPIC9K-XEG1 E136D large-scale plasmid extraction; the recombinant transformant pPIC9K-XEG1 E136D linearization and the recombinant transformant pPIC9K-XEG1 E136D transforming Pichia pastoris GS115.

[0053] (3) Inducing the expression of the protein of the recombinant Pichia pastoris strain

[0054] Inducing XEG1 in the recombinant Pichia pastoris E136D detecting the protein expression strain; expanding the culture of the highly efficient recombinant yeast strain; the exogenous protein XEG1 of Pichia pastoris E136D purification; the purified protein XEG1 E136D SDS-PAGE electrophoresis; Western blot detection and Coomassie brilliant blue staining. 2. XEG1 E136DIsolation and purification of recombinant protein: The target protein was purified by a three-step method using an AKTA protein isolation and purification chromatography system (GE Healthcare, USA): (1) The protein sample was exchanged into the loading buffer (0.2 M Tris-HCl, 0.5 mol / L sodium chloride, pH 8.0) using a HiTrap Desalting chromatography column (20 mL; GE Healthcare, USA), and then the sample was loaded onto a HisTrap HP chromatography column (5 mL; GE Healthcare, USA) equilibrated with the loading buffer. The non-specifically bound proteins were eluted using the loading buffer containing 0.05 M imidazole, and the target protein was eluted and collected using the loading buffer containing 0.25 M imidazole. (2) The protein sample was loaded onto a cation exchange chromatography (Source 15Q 4.6 / 100PE), and a linear gradient elution was performed with 0%-50% (v / v) elution buffer (0.02 M MES, 0.5 M sodium chloride, pH 6.0) for 20 column volumes. The fractions collected in tubes were analyzed by SDS-PAGE to determine whether to retain them. (3) The protein sample purified by anion exchange was loaded onto a molecular sieve (Superdex 200 10 / 30GL), and eluted using a buffer (0.02 M Tris-HCl, 0.1 M sodium chloride, pH 8.0). The fractions were collected according to the peaks, and the components of each peak were analyzed by SDS-PAGE to enrich the target protein. The results showed that high-purity XEG1 was obtained through three steps of purification. E136D Protein( Figure 2 ).

[0055] Example 2: Trichoderma harzianum XEG1 E136D Method for obtaining the strain

[0056] 1. Establishment of an overexpression system for Trichoderma harzianum XEG1 mediated by Agrobacterium E136D

[0057] (1) Cloning of the target gene

[0058] Specific primers were designed according to the cDNA sequence of XEG1 E136D , and the target fragment sequence was obtained by PCR amplification using the synthesized XEG1 E136D sequence optimized for fungal codons as the template (the codon-optimized sequence is shown in SEQ ID NO.3). The forward primer sequence is GGGACTGGGCCAAGAGCACTA (SEQ ID NO.6), and the reverse primer sequence is ATGGTCTTGGTGGCGACGAAC (SEQ ID NO.7).

[0059] (2) Construction of an Agrobacterium-mediated transformation vector for Trichoderma harzianum​

[0060] Including digesting the ThOE-HA2 plasmid (the complete gene sequence is shown in SEQ ID NO.5) with the restriction endonuclease SmaI, and digesting the ThKO plasmid (the complete gene sequence is shown in SEQ ID NO.4) with KpnⅠ; verifying by gel electrophoresis and recovering the digestion products; synthesizing the target gene XEG1 E136D sequence and ligating it to the linearized vector ThOE-HA2; the ligation product ThOE-XEG1 E136D -HA2 was transformed into competent Escherichia coli JM109 cells and positive clones were screened; the recombinant transformant ThOE-XEG1 E136D -HA2 plasmid was extracted; respectively using 2 pairs of primers (F -XEG1 E136D（Cri） -HA2: ctcgagggggggcccggtaccGGAGGTCAACAATGAATGCCTAT (SEQ ID NO.8), R -XEG1 E136D（Cri） -HA2: ctatagggcgaattgggtaccTTAACTAGTTCTAGAAGCGTAATCTGGAA (SEQ ID NO.9); F-XEG1 E136D（Trans） -HA2: ctcgagggggggcccggtaccTTAACTAGTTCTAGAAGCGTAATCTGGAA (SEQ ID NO.10), R-XEG1 E136D（Trans） -HA2: ctatagggcgaattgggtaccGGAGGTCAACAATGAATGCCTAT (SEQ ID NO.11)) were used to perform PCR amplification with ThOE-XEG1 E136D -HA2 as the template to obtain ThOE-XEG1 E136D（Cri） -HA2 and ThOE-XEG1 E136D（Trans） -HA2 fragments; the ThOE-XEG1 E136D(Cri / Trans) -HA2 fragments were respectively ligated to the linearized vector ThKO; the ligation product ThKO-ThOE-XEG1 E136D(Cri / Trans) -HA2 were respectively transformed into competent Escherichia coli JM109 cells and positive clones were screened; the recombinant transformants ThKO-ThOE-XEG1 E136D(Cri / Trans) -HA2 plasmid was extracted, and the construction of overexpression vectors with two different transcriptional directions was completed( Figure 3 ).

[0061] (3) Agrobacterium-mediated transformation system of Trichoderma harzianum

[0062] ① Plasmids and strains

[0063] The plasmid vector contains a green fluorescent protein GFP gene driven by a fungal promoter and a hygromycin B resistance gene. The plasmid was transferred into Agrobacterium tumefaciens strain AGL-1 (commercially available) by the freeze-thaw method. Trichoderma harzianum strain T-22 was used as the parental strain, which was commercially available and provided by our laboratory.

[0064] ② Medium

[0065] Induction Medium (IM) Medium (g·L -1 ):K 2 HPO 4 ,2.05 g;KH 2 PO 4 ,1.45 g;NaCl, 0.15 g;MgSO 4 ·7H 2 O,0.50 g;CaCl 2 ·6H 2 O,0.1 g;FeSO 4 ·7H 2 O,0.0025 g;(NH4) 2 SO 4 ,0.5g;Glucose, 2.0 g;40 mmol·L -1 2-(N-morpholino) ethanesulfonic acid (MES), pH 5.3, 0.5% (V / V) glycerol.

[0066] PSA Medium (g·L -1 ):Potato, 200.0 g;Sucrose, 20.0 g;Agar, 15.0 g.

[0067] LB Medium (g·L -1 ):Tryptone, 10 g;Yeast extract, 5g;NaCl, 10 g.

[0068] ③ Materials and Reagents

[0069] 50 mg / ml acetosyringone; sterile DMSO; 50 mg / L hygromycin B; 500 mg / L cefotaxime; sterile 2 ml EP tubes; sterile small beakers (containing Miracloth); sterile spreading rods and forceps; sterile blue and yellow pipette tips; sterile cellophane; sterile toothpicks; sterile water, etc.

[0070] ④ Transformation Method

[0071] In LB culture medium containing 50 mg / L kanamycin and rifampicin, initially culture Agrobacterium tumefaciens AGL-1 for about 16 h (30 °C / 200 rpm). In a laminar flow hood, collect the bacterial solution with a 2 ml EP tube, and centrifuge at 5000 rpm for 3 min to collect the bacterial cells.

[0072] Add 50 mg / L acetosyringone to the IM culture medium, resuspend the bacterial cells with 5 ml of the IM culture medium, and adjust the OD 600 value between 0.6 and 0.8.

[0073] Cut Trichoderma harzianum mycelial blocks into sterile water, vortex, filter the spore solution through Miracloth into a small beaker, observe the spore number under a microscope using a hemocytometer, and adjust the spore concentration to 10 6 -10 9 cells / ml (i.e., about 6 - 10 spores in each small square of the hemocytometer).

[0074] Pour IM solid plates (90 mm) in a laminar flow hood, stick sterile glass paper onto the plates, dry them. Mix the Agrobacterium suspension and the Trichoderma harzianum spore solution evenly at a ratio of 1:1 (v:v). Pipette 200 μl of the mixed bacterial solution onto the IM plate with glass paper, spread it evenly with a sterile spreading rod, dry it, and then place it in a 25 °C incubator for dark incubation for 2 d.

[0075] After mycelia grow on the surface of the glass paper, use sterile forceps to remove the glass paper in a laminar flow hood, place the side with mycelia facing up in another sterile empty Petri dish (90 mm), cover it with PSA solid medium containing 50 mg / L hygromycin B and 500 mg / L cephalosporin, dry it, and then place it in a 25 °C incubator for dark incubation for 5 - 7 d.

[0076] After the Trichoderma harzianum transformants grow, pour PSA plates containing 50 mg / L hygromycin B in a laminar flow hood. Use a sterile toothpick to pick the transformants onto the PSA resistant plates, and incubate them in a 25 °C incubator in the dark for subsequent verification and screening.

[0077] 2. Trichoderma harzianum XEG1 E136D Screening of overexpression strains

[0078] (1)PCR verification

[0079] The mycelial blocks of Trichoderma harzianum transformants were cut in a laminar flow hood and placed in 2-ml EP tubes. The DNA of the transformants was crudely extracted by the CTAB method. The transformants were respectively verified and screened by PCR using the hygromycin primers (HYG-F: GGCCATGGATGCGATCGCT (SEQ ID NO.12); HYG-R: CTATTCCTTTGCCCTCGGACG (SEQ ID NO.13)), the reference primers of Trichoderma harzianum (RtTef1-F: TACAAGATCGGTGGTATTGGAACA (SEQ ID NO.14); RtTef1-R: AGCTGCTCGTGGTGCATCTC (SEQ ID NO.15)), and the XEG1 E136D gene primer pairs, and multiple positive overexpression transformants were obtained. Figure 4 Those marked with red asterisks are positive transformants ( Figure 4 ).

[0080] (2) Western blot verification

[0081] The mycelial blocks of Trichoderma harzianum transformants were ground to extract total proteins, and the expression of XEG1 E136D protein in the mycelia of Trichoderma harzianum T-22 was detected by Western blot. E136D ;

[0082] The mycelial blocks of Trichoderma harzianum transformants were cut into sterile water, vortexed and mixed evenly, and the spore suspension was filtered into PSA culture medium. The mixture was cultured in the dark at 25 °C / 80 rpm on a shaker for 10 d, and the culture solution was collected by centrifugation. Using (NH4) 2 SO 4 precipitation-dialysis-affinity chromatography technology, and the extracellular secretion of XEG1 E136D protein in Trichoderma harzianum T-22 was detected by Western blot. E136D ( Figure 5 ), and the detection results showed that compared with the wild-type T22 strain, the fusion protein XEG1 E136 D-HA could be detected in 6 transformants, indicating that Trichoderma could secrete and express XEG1 E136 D-HA protein. Among them, two overexpression transformants Th-OEXEG1 E136D(Cri) -14 / 15 had relatively high Western blot detection signals, indicating that these two transformants had the characteristic of high expression level. Therefore, these two transformants were selected for subsequent experiments and were re-named T-22 E136D -1 / 2 respectively.

[0083] Example 3: Detecting the induction of broad-spectrum systemic resistance in plants by Trichoderma harzianum T-22 E136D

[0084] 1. Trichoderma harzianum T-22 E136D Determination of activating the systemic resistance of soybean Hefeng 47

[0085] (1)Trichoderma harzianum T-22 E136D Experiment of mixing with soil and potting

[0086] The Trichoderma harzianum transformant T-22 E136D and Trichoderma harzianum T-22 were activated on PSA plates (150 mm). After the mycelium covered the plates, it was mixed into vermiculite, and after mixing evenly, it was filled into small flower pots. The vermiculite without mycelium was used as the blank control. Soybean Hefeng 47 was sown in the small flower pots, with 3 pots for each treatment and 15 soybeans sown in each pot. The soybeans were cultivated under light in the greenhouse;

[0087] When the soybean had newly emerged trifoliate leaves, it was wounded and inoculated with the pre-activated Phytophthora sojae P6497 mycelial cake on its stem, and then cultivated under moisturized conditions in the greenhouse. Subsequently, the disease incidence of the plants under each treatment was observed. Statistical analysis of the lesion length ( Figure 6 a and b in) showed that compared with the control (CT) group, the Trichoderma treatment group could slow down the infection of Phytophthora sojae. At the same time, the transformant T-22 E136D treatment group showed a stronger ability to inhibit the infection of Phytophthora sojae than the wild-type T22 strain treatment group; the relative biomass of Phytophthora sojae in different treatment groups was detected by RT-qPCR, and the experimental results further proved that the transformant T-22 E136D treatment group showed a stronger ability to inhibit the infection of Phytophthora sojae than the wild-type T22 strain treatment group.

[0088] (2)Determination of the relative biomass of Phytophthora sojae at the inoculation site of soybeans in each treatment

[0089] Samples were taken from the plants in each treatment after inoculation with Phytophthora sojae. After the samples were freeze-dried, genomic DNA was extracted precisely, and the relative biomass of Phytophthora sojae was detected by real-time fluorescence quantitative PCR.

[0090] 2. Trichoderma harzianum T-22 E136D Determination of activating the systemic resistance of Nicotiana benthamiana

[0091] (1)Trichoderma harzianum T-22 E136D Experiment of mixing with soil and potting

[0092] Trichoderma harzianum T-22 E136D and Trichoderma harzianum T-22 were activated on PSA plates (150 mm). After the mycelium covered the plates, it was mixed into vermiculite, and after mixing evenly, it was filled into small flower pots. The vermiculite without mycelium was used as the blank control. Nicotiana benthamiana was sown in the small flower pots, with 3 pots for each treatment and 1 tobacco plant in each pot, and placed in the greenhouse for light cultivation;

[0093] When the tobacco grows to the third round of leaves, take the leaves and inoculate the pre-activated Phytophthora parasitica var. nicotianae strain agar discs on both sides of the leaves respectively. Incubate them under humid conditions in the greenhouse, and then observe the disease incidence of the plants under each treatment. Statistical analysis of the lesion areas ( Figure 7 a) in E136D showed that compared with the control (CT), treating the tobacco roots with Trichoderma can activate the plant systemic resistance and slow down the ability of Phytophthora parasitica var. nicotianae to infect the leaves. At the same time, the transformant T-22

[0094] (2)Determination of the relative biomass of Phytophthora parasitica var. nicotianae at the inoculation sites of each treatment of soybean

[0095] Sample the plants of each treatment after inoculation with Phytophthora parasitica var. nicotianae. After freeze-drying the samples, extract the genomic DNA precisely, and use real-time fluorescence quantitative PCR to detect the relative biomass of Phytophthora parasitica var. nicotianae. The results of biomass analysis showed that the Trichoderma treatment group had less Phytophthora parasitica var. nicotianae biomass than the control (CT) group. At the same time, the transformant T-22 E136D treatment group had less Phytophthora parasitica var. nicotianae biomass than the wild-type T22 strain treatment, further proving that the transformant T-22 E136D had a stronger ability to inhibit the infection of Phytophthora parasitica var. nicotianae than the wild-type T22 strain ( Figure 7 b) in

Claims

1. Protein XEG1 with amino acid sequence as shown in SEQ ID NO.1 E136D or the protein XEG1 E136D The relevant biological materials are used in at least one of the following (A1)-(A4): (A1) Application in activating or inducing broad-spectrum systemic resistance in plants; (A2) Use in the preparation of products for activating or inducing broad-spectrum systemic resistance in plants; (A3) Application in the prevention and control of plant diseases; (A4) Application in the preparation of products for preventing and controlling plant diseases.

2. The use according to claim 1, characterized in that: XEG1 E136D The relevant biological material is at least one of the following (B1)-(B4): (B1) encodes the protein XEG1 E136D nucleic acid molecules; (B2) an expression cassette containing the nucleic acid molecule described in (B1); (B3) a recombinant vector containing the nucleic acid molecule described in (B1), or a recombinant vector containing the expression cassette described in (B2); (B4) A recombinant microorganism containing the nucleic acid molecule described in (B1), or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector described in (B3).

3. The use according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule in (B1) is shown as SEQ ID NO.2 or SEQ ID NO.

3.

4. The use according to claim 1, characterized in that: Using engineered bacteria to express the protein XEG1 E136D As a plant immune inducer, it activates or induces broad-spectrum systemic resistance in plants or prevents and controls plant diseases.

5. The use according to claim 1 or 4, characterized in that: The activation or induction of plant broad-spectrum systemic resistance is to activate or induce plant immune resistance to pathogenic bacteria; the prevention and control of plant diseases is to improve the ability of plants to resist diseases caused by pathogenic bacteria; the pathogenic bacteria are at least one of oomycetes, fungi and bacteria that can infect crops.

6. The use according to claim 5, characterized in that: The pathogenic bacteria is at least one of Phytophthora, Fusarium and Rice Blast.

7. The use according to claim 1 or 4, characterized in that: The plant is at least one of soybean, tobacco, tomato and potato.

8. A method for activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases, characterized in that: The protein XEG1 described in claim 1 E136D The engineered bacterial strain is overexpressed and applied to plants.

9. A product for activating or inducing broad-spectrum systemic resistance in plants or controlling plant diseases, characterized in that: The product contains at least one of the following (C1)-(C4): (C1) The protein XEG1 described in claim 1 E136D ; (C2) contains the protein XEG1 E136D Preparations; (C3) for overexpression of the protein XEG1 E136D Engineered bacterial strains; (C4) A bacterial agent, biological fertilizer, bacterial suspension or fermentation product prepared from the engineered bacterial strain described in (C3).

10. The product according to claim 9, characterized in that The engineered bacteria are biocontrol bacteria or expression bacteria.

Images