Construction method of POMGNT1 overexpression plasmid

By constructing the POMGNT1 overexpression plasmid, RNA was extracted using mouse tail tissue and ligated to the vector, the problems of low and unstable POMGNT1 protein expression efficiency were solved, and the protein expression volume was significantly improved and the reliability was improved, providing effective tool support for subsequent research.

CN120060304APending Publication Date: 2025-05-30CHONGQING MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510209626.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

In the prior art, when constructing POMGNT1 overexpression plasmids, the expression efficiency of POMGNT1 protein is low and the expression amount is unstable, making it difficult to meet the needs of subsequent upstream and downstream research on POMGNT1.

Method used

The POMGNT1 gene was obtained by extracting total RNA based on mouse tail tissue, reverse transcription and PCR amplification, and ligated to the incision of the pLV3-CMV-MCS-3×FLAG-CopGFP-Puro vector, forming a new circular plasmid DNA, namely the POMGNT1 overexpression plasmid.

Benefits of technology

The expression efficiency of exogenous proteins has been improved, and the expression of POMGNT1 protein has increased by about 2 times, and its expression is reliable, which can provide tool support for subsequent upstream and downstream research on POMGNT1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060304A_ABST
    Figure CN120060304A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a POMGNT1 overexpression plasmid construction method which comprises the following steps: firstly, extracting total RNA (Ribonucleic Acid) from mouse tail tissues; carrying out reverse transcription on the extracted total RNA and then carrying out PCR (Polymerase Chain Reaction) amplification to obtain a POMGNT1 gene; the preparation method comprises the following steps: carrying out enzyme digestion on a pLV3-CMV-MCS-3 * FLAG-CopGFP-Puro carrier; connecting the POMGNT1 gene to the incision of the vector subjected to enzyme digestion to obtain a new annular plasmid DNA (deoxyribonucleic acid), namely a POMGNT1 overexpression plasmid; according to the obtained POMGNT1 overexpression substance, the expression efficiency of foreign protein is improved, the expression quantity of POMGNT1 protein is improved by about two times, POMGNT1 protein expression is reliable, tool support can be provided for follow-up POMGNT1 upstream and downstream research, and then the problems that in the prior art, when POMGNT1 overexpression plasmids are constructed, the POMGNT1 protein is low in expression efficiency and unstable in expression quantity, and the POMGNT1 overexpression plasmids are difficult to construct are solved. The requirements of subsequent POMGNT1 upstream and downstream research are difficult to meet.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for constructing a POMGNT1 overexpression plasmid. Background Art

[0002] N-acetylglucosaminyl-β-1,2-mannosyltransferase 1 (POMGnT1) is a key glycosyltransferase that plays a crucial role in the O-mannosylation modification process of proteins. It has important functions in glycobiology and cell signal transduction, and is particularly important for the development and functional maintenance of the neuromuscular system.

[0003] In normal mouse brain tissue, the transcriptional and protein products of POMGnT1 show strong expression in the cerebral cortex and hippocampal regions. Further studies have found that the protein of POMGnT1 is mainly expressed in mature neurons. At the organelle level, POMGnT1 is mainly enriched in the Golgi apparatus. Therefore, it can be seen that the expression of POMGnT1 in the mouse brain has certain regional specificity.

[0004] Through its glycosyltransferase activity, POMGnT1 performs post-translational modification on certain proteins in the brain tissue, such as dystroglycan (DG). POMGnT1 can increase the mannose groups of the α subunit of DG, thereby enhancing the interaction between DG and the extracellular matrix (ECM) basement membrane (BM). The binding force between α-DG with insufficient mannose glycosylation modification and the extracellular matrix is weakened, which may affect the structure and function of the neuromuscular system.

[0005] Mutations in POMGnT1 can lead to muscle-eye-brain (MEB) disease, and one of the main characteristics of this disease is anatomical abnormalities in the brain. These findings further support the view that POMGnT1 affects brain development in vivo by mannose glycosylation modification of α-DG. In the tissues / organs of higher animals, the brain is the most complex part in terms of function, and the regulation of its protein expression is also the most complex and delicate. The specific expression characteristics of POMGnT1 protein and its influence on mannose glycosylation modification suggest that POMGnT1 protein plays an important role in brain development. Existing studies have shown that the deletion of POMGnT1 in the POMGnT1 knockout mouse model can lead to various brain development abnormalities, including extensive changes in the distribution of neurons in the neocortex, excessive migration of neurons during the development of the cerebral cortex, lighter brain weight, reduced number of granule cells, smaller cerebellum, and rupture of the pial basement membrane and dentate gyrus defects.

[0006] In addition to MEB disease, recent studies have also found that abnormal glycosylation may be related to the occurrence and development of Alzheimer's disease (AD). In the N2a / APP cell model of AD, overexpression of POMGnT1 can inhibit the production of amyloid proteins and the hyperphosphorylation of Tau proteins, which further broadens the research field of POMGnT1 and provides clues for its potential therapeutic role in neurodegenerative diseases.

[0007] However, in the existing technology, although the importance of POMGNT1 as a novel potential drug target for muscle-eye-brain disease and Alzheimer's disease has been recognized, when constructing the POMGNT1 overexpression plasmid, the expression efficiency of the POMGNT1 protein is low, and the expression level is unstable, making it difficult to meet the needs of subsequent upstream and downstream research on POMGNT1. Summary of the Invention

[0008] The purpose of the present invention is to provide a method for constructing a POMGNT1 overexpression plasmid, aiming to solve the technical problem in the existing technology that when constructing the POMGNT1 overexpression plasmid, the expression efficiency of the POMGNT1 protein is low, and the expression level is unstable, making it difficult to meet the needs of subsequent upstream and downstream research on POMGNT1.

[0009] To achieve the above purpose, a method for constructing a POMGNT1 overexpression plasmid adopted by the present invention includes the following steps:

[0010] Extract total RNA from mouse tail tissue;

[0011] After reverse transcription of the extracted total RNA, perform PCR amplification to obtain the POMGNT1 gene;

[0012] Digest the pLV3-CMV-MCS-3×FLAG-CopGFP-Puro vector;

[0013] Connect the POMGNT1 gene to the incision of the digested vector to obtain a new circular plasmid DNA, which is the POMGNT1 overexpression plasmid.

[0014] Among them, when performing reverse transcription on the extracted total RNA and then performing PCR amplification to obtain the POMGNT1 gene, the primers are as follows:

[0015] Forward primer: (5’-3’): CTGATACGAACT CGGAATTCG CCA CCATGG ATGACT GGAAGCCCA G;

[0016] Reverse primer: (5’-3’): TGGTCTTTGTAGTCGGATCC CGT TTG TTCAGC AGC CCC T.

[0017] Among them, after performing PCR amplification to obtain the POMGNT1 gene, 1% agarose gel electrophoresis was used for identification. Electrophoresis was carried out at a constant voltage of 130 V for 30 min, and ultraviolet development was performed to identify the band of the POMGNT1 gene. After development, the gene fragment was purified using a gel extraction and purification kit.

[0018] Among them, when ligating the POMGNT1 gene to the incision of the vector after digestion, the method used was:

[0019] The amplified POMGNT1 gene was ligated to the gap of the vector after digestion by seamless cloning.

[0020] Among them, when ligating the POMGNT1 gene to the incision of the vector after digestion to obtain a new circular plasmid DNA:

[0021] The concentrations of the POMGNT1 fragment and the recovered fragment of the vector after double digestion were detected, and ligation was carried out in a reaction system with a vector fragment: target fragment = 1:3;

[0022] After that, the ligation product was transformed into competent cells: The Stbl3 competent cells were taken out from the -80°C refrigerator and thawed on ice in advance; the ligation product was added to 100 μl of competent cells and incubated on ice for 30 min; heat shock was performed in a 42°C water bath for 45 s, and then immediately placed on ice for 2 min; 900 μl of LB was added, and the mixture was shaken vigorously on a shaker at 37°C for 1 h; the mixture was spread on an LB plate containing Amp antibiotic; it was placed in an incubator at 37°C overnight;

[0023] Subsequently, 2 - 3 single colonies on the LB plates were selected and transferred to 20 ml of LB culture medium respectively, and cultured with shaking at 37°C for 12 - 16 h;

[0024] Finally, gene sequencing and plasmid extraction were performed to obtain the POMGNT1 overexpression plasmid, and the plasmid was stored at -20°C.

[0025] A POMGNT1 overexpression plasmid constructed by the method for constructing a POMGNT1 overexpression plasmid as described above,

[0026] Use in the preparation of products for detecting or studying the POMGNT1 target.

[0027] A POMGNT1 overexpression plasmid constructed by the method for constructing a POMGNT1 overexpression plasmid as described above,

[0028] Use in the preparation of products for treating or detecting or studying diseases related to POMGNT1.

[0029] Among them, diseases related to POMGNT1 include but are not limited to Alzheimer's disease and mental diseases.

[0030] A method for constructing a POMGNT1 overexpression plasmid of the present invention first extracts total RNA from mouse tail tissue; after reverse transcription of the extracted total RNA, PCR amplification is performed to obtain the POMGNT1 gene; the pLV3-CMV-MCS-3×FLAG-CopGFP-Puro vector is digested with enzymes; the POMGNT1 gene is ligated to the incision of the digested vector to obtain a new circular plasmid DNA, which is the POMGNT1 overexpression plasmid; the POMGNT1 overexpression plasmid obtained by the present invention improves the expression efficiency of foreign proteins, increases the expression level of the POMGNT1 protein by about 2 times, and the expression of the POMGNT1 protein is reliable, which can provide tool support for the subsequent research on the upstream and downstream of POMGNT1, and further solves the technical problems in the prior art that when constructing the POMGNT1 overexpression plasmid, the expression efficiency of the POMGNT1 protein is low, the expression level is unstable, and it is difficult to meet the needs of the subsequent research on the upstream and downstream of POMGNT1. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0032] Figure 1 is a schematic diagram of the construction mode of the POMGNT1 overexpression plasmid of the present invention.

[0033] Figure 2 is a schematic diagram of the verification result of the mRNA level of POMGNT1 after transfection of the present invention.

[0034] Figure 3 In [the figure], both a and b are schematic diagrams of the verification results of the protein level of POMGNT1 after transfection. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0035] The following details the embodiments of the present invention. The examples of the embodiments are shown in the drawings. The embodiments described below with reference to the drawings are exemplary and are intended to explain the present invention and should not be construed as a limitation of the present invention.

[0036] Please refer to Figures 1 to 3 , in which Figure 1 is a schematic diagram of the construction mode of the POMGNT1 overexpression plasmid of the present invention. Figure 2 is a schematic diagram of the verification result of the mRNA level of POMGNT1 after transfection of the present invention. Figure 3Schematic diagram of the verification results of the protein levels of POMGNT1 after transfection for both a and b.

[0037] The present invention provides a method for constructing a POMGNT1 overexpression plasmid, comprising the following steps:

[0038] S1. Extract total RNA from mouse tail tissue;

[0039] S2. Perform reverse transcription on the extracted total RNA and then conduct PCR amplification to obtain the POMGNT1 gene;

[0040] For this specific embodiment, when performing reverse transcription on the extracted total RNA and then conducting PCR amplification to obtain the POMGNT1 gene, the primers are as follows:

[0041] Forward primer: (5’-3’): CTGATA CGAACT CGGAAT TCG CCA CCATGG ATGACT GGAAGCCCA G;

[0042] Reverse primer: (5’-3’): TGGTCTTTGTAGTCGGATCC CGT TTG TTC AGC AGC CCC T.

[0043] The PCR reaction system for the POMGNT1 gene is as follows in the table:

[0044] Table 1

[0045] Component Dosage 5xPS Buffer (AL91346A, TaKaRa) 10 μL 2.5 mM dNTP Mix (AL21859, TaKaRa) 4 μL Primer1 (10 uM) 2.5 μL Primer2 (10 uM) 2.5 μL Template 500 ng PrimeSTAR 0.5 μL Sterile water Make up to 50 μL Component Dosage 5xPS Buffer (AL91346A, TaKaRa) 10 μL 2.5 mM dNTP Mix (AL21859, TaKaRa) 4 μL Primer1 (10 uM) 2.5 μL

[0046] S3. Digest the pLV3-CMV-MCS-3×FLAG-CopGFP-Puro vector;

[0047] S4. Connect the POMGNT1 gene to the incision of the digested vector to obtain a new circular plasmid DNA, which is the POMGNT1 overexpression plasmid.

[0048] For this specific embodiment, when connecting the POMGNT1 gene to the incision of the digested vector, the method used is:

[0049] Use seamless cloning to connect the amplified POMGNT1 gene to the gap of the digested vector.

[0050] When connecting the POMGNT1 gene to the incision of the digested vector to obtain a new circular plasmid DNA:

[0051] Detect the concentrations of the recovered fragments of the POMGNT1 fragment and the vector after double digestion, and perform ligation in a reaction system with a vector fragment: target fragment = 1:3;

[0052]

[0053] After that, the ligated product was transformed into competent cells: Take out the Stbl3 competent cells from the -80°C refrigerator in advance and melt them on ice; Add the ligation product to 100 μl of competent cells and incubate on ice for 30 min; Heat shock in a 42°C water bath for 45 s, then immediately place on ice for 2 min; Add 900 μl of LB and shake vigorously on a shaker at 37°C for 1 h; Spread the mixture on an LB plate containing Amp antibiotic; Incubate in an incubator at 37°C overnight;

[0054] Then, pick 2-3 single colonies on the LB plates and transfer them to 20 ml of LB culture medium respectively, and shake and culture at 37°C for 12-16 h;

[0055] Finally, gene sequencing and plasmid extraction were carried out to obtain the POMGNT1 overexpression plasmid, and the plasmid was stored at -20°C.

[0056] After the construction of the POMGNT1 overexpression plasmid was completed, an in vitro expression experiment of the POMGNT1 exogenous protein was carried out as follows:

[0057] Mouse neuron cells (N2A) were cultured in vitro. When the cells grew to the logarithmic growth phase and the number reached about 60%, lipo3000 was used for plasmid transfection. The medium was changed 6 hours after transfection. The expression of POMGNT1 was detected 48 hours after transfection: Extract cell RNA for Real-time qPCR to detect the mRNA level of POMGNT1 and protein lysate for Western blot to detect the protein level of POMGNT1. The results are shown in Appendix Figure 2 and Appendix Figure 3 , transfection was carried out on N2A cells. The Real-time qPCR results showed that the POMGNT1 RNA level in the overexpression group was about 400 times that of the normal group, and the WB results showed that the protein level of POMGNT1 in the overexpression group was more than 2 times that of the normal group. Generally speaking, the POMGNT1 mRNA level was at least 400 times that of the normal group, and the protein level of CTSC in the overexpression group was more than 2 times that of the control group.

[0058] Using a method for constructing a POMGNT1 overexpression plasmid of this embodiment, first, total RNA is extracted from mouse tail tissue; after reverse transcription of the extracted total RNA, PCR amplification is performed to obtain the POMGNT1 gene; the pLV3-CMV-MCS-3×FLAG-CopGFP-Puro vector is digested with enzymes; the POMGNT1 gene is ligated to the incision of the vector after enzyme digestion to obtain a new circular plasmid DNA, which is the POMGNT1 overexpression plasmid; the POMGNT1 overexpression plasmid obtained in the present invention improves the expression efficiency of foreign proteins, increases the expression level of the POMGNT1 protein by about 2 times, and the expression of the POMGNT1 protein is reliable, which can provide tool support for the subsequent research on the upstream and downstream of POMGNT1, thereby solving the technical problem in the prior art that when constructing a POMGNT1 overexpression plasmid, the expression efficiency of the POMGNT1 protein is low, the expression level is unstable, and it is difficult to meet the requirements of the subsequent research on the upstream and downstream of POMGNT1.

[0059] The above-disclosed is only a preferred embodiment of the present invention, and of course, it cannot be used to limit the scope of the rights of the present invention. Those of ordinary skill in the art can understand the whole or part of the processes of implementing the above embodiments, and the equivalent changes made according to the claims of the present invention still fall within the scope covered by the present invention.

Claims

1. A method for constructing a POMGNT1 overexpression plasmid, characterized in that: The steps include: Based on the extraction of total RNA from mouse tail tissue; The extracted total RNA was reverse transcribed and then amplified by PCR to obtain the POMGNT1 gene; The pLV3-CMV-MCS-3×FLAG-CopGFP-Puro vector was digested with enzymes; The POMGNT1 gene was connected to the cut end of the vector after enzyme digestion to obtain a new circular plasmid DNA, which was the POMGNT1 overexpression plasmid.

2. The method for constructing a POMGNT1 overexpression plasmid according to claim 1, characterized in that: The extracted total RNA was reverse transcribed and then amplified by PCR to obtain the POMGNT1 gene. The primers were as follows: The upstream primers were: (5′-3′): CTGATACGAACT CGGAATTCG CCA CCATGG ATGACT GGAAGC CCA G; The downstream primer is: (5'-3'): TGGTCTTTGTAGTCGGATCC CGT TTG TTCAGC AGC CCC T.

3. The method for constructing a POMGNT1 overexpression plasmid according to claim 2, characterized in that: After PCR amplification, the POMGNT1 gene was obtained and identified by 1% agarose gel electrophoresis at a constant voltage of 130V for 30min. The band of the POMGNT1 gene was identified by ultraviolet development. After development, the gene fragment was purified using a gel recovery and purification kit.

4. The method for constructing a POMGNT1 overexpression plasmid according to claim 3, characterized in that: When the POMGNT1 gene is connected to the cut end of the vector after restriction digestion, the method used is: The amplified POMGNT1 gene was connected to the gap of the vector after restriction digestion by seamless cloning.

5. The method for constructing a POMGNT1 overexpression plasmid according to claim 4, characterized in that: When the POMGNT1 gene is connected to the cut end of the vector after restriction digestion to obtain a new circular plasmid DNA: Detect the concentration of the recovered fragment of the POMGNT1 fragment and the vector after double enzyme digestion, and connect them with the reaction system of vector fragment: target fragment = 1:3; Then, the ligated product was transformed into competent cells: Stbl3 competent cells were taken out from the -80°C refrigerator in advance and thawed on ice; Add 100 μl of competent cells to the ligation product and place on ice for 30 min; heat shock in a 42°C water bath for 45 s, then immediately place on ice for 2 min; add 900 μl of LB and shake vigorously at 37°C for 1 h; spread the mixture on an LB plate containing Amp antibiotics; place in a 37°C incubator overnight; Then, select 2-3 single colonies on the LB plates, transfer them to 20 ml LB culture medium, and culture them in a shaking incubator at 37°C for 12-16 hours. Finally, gene sequencing and plasmid extraction were performed to obtain the POMGNT1 overexpression plasmid, and the plasmid was stored at -20°C.

6. A POMGNT1 overexpression plasmid constructed by the method for constructing a POMGNT1 overexpression plasmid according to claim 5, characterized in that: Application in the preparation of products for detecting or studying POMGNT1 targets.

7. A POMGNT1 overexpression plasmid constructed by the method for constructing a POMGNT1 overexpression plasmid according to claim 5, characterized in that: Application in the preparation of products for treating, detecting or studying diseases related to POMGNT1.