Application of cassava mosaic virus AC4 in inhibiting degradation of mRNA decay substrate

Abstract

The invention provides application of an AC4 gene and the like in improvement of GFP expression quantity and / or inhibition of degradation of an mRNA attenuated substrate taking GFP as a reporter gene. The research finds that AC4 has an mRNA decay inhibition function, can inhibit the degradation of a nonsense mediated mRNA decay substrate taking GFP as a reporter gene and the degradation of an arabidopsis thaliana endogenous nonsense mediated mRNA decay substrate without influencing ARE dependent turnover, can improve the mRNA expression quantity of AtUPF1, AtXRN4, AT1G0106020, RPS6 and the like, can reduce the expression quantity of AT1G72450 and AT2G400, can dwarf an arabidopsis thaliana seedling and / or curl a leaf, and can be used for preparing an anti-tumor drug for preventing and treating the arabidopsis thaliana endogenous nonsense mediated mRNA decay substrate. According to the present invention, the strain can effectively inhibit the growth of AC4, enhance the pathogenicity of PVX, and interact with MeUpf1 or AtUpf1, such that the growth ability of yeast in an auxotrophic culture medium can be improved, and the research result can lay the foundation for the clarification of the AC4 function;

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of cassava mosaic virus AC4 in inhibiting the degradation of mRNA decay substrates. Background Art

[0002] mRNA decay, as a highly conserved self - protection mechanism, plays an important role in resisting virus invasion (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation - modified Pelota - Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632 - 642.; Wu J, Zhang Y, Li F, Zhang X, Ye J, Wei T, Li Z, Tao X, Cui F, Wang X, Zhang L, Yan F, Li S, Liu Y, Li D, Zhou X, Li Y. Plant virology in the 21st century in China: Recent advances and future directions. J Integr Plant Biol. 2023a, doi: 10.1111 / jipb.13580.). mRNA decay includes pathways such as nonsense - mediated mRNA decay (NMD), Staufen1 - mediated mRNA decay (SMD), and structure - mediated RNA decay (SRD). Upstream frameshift 1 (UPF1) is a key component of the three mRNA decay pathways (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation - modified Pelota - Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632 - 642.).Research has found that NMD, SMD, and SRD are all involved in antiviral defense (May JP, Simon AE. Targeting of viral RNAs by Upf1-mediated RNA decay pathways. Curr Opin Virol. 2021, 47:1-8.; Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023, 16(3):632-642.). Among them, NMD plays an important regulatory role in the gene expression, growth and development, and stress defense response of organisms by rapidly degrading unstable and defective mRNAs to achieve the regulation of mRNA quantity and quality control. Viruses are obligate parasites that have evolved to evade or tolerate various host immune defense mechanisms during the interaction with hosts to achieve infection. Exploring the various immune defense mechanisms by which different viruses evade or tolerate hosts has become the forefront and hot spot of research in this field (Sun H, Jing X, Wang C, Wang P, Huang Z, Sun B, Li P, Li H, Zhang C. The Great Game between Plants and Viruses: A Focus on Protein Homeostasis. Int J Mol Sci. 2023, 24(16):12582.). The research results not only have important theoretical value but also provide new technologies for the green prevention and control of viral diseases.

[0003] Cassava mosaic disease (CMD) caused by cassava mosaic geminivirus (CMVs) poses a serious threat to the development of the cassava industry and food security in China. CMD was first reported in Hainan and Fujian in China in 2018, and subsequent reports have been found in other planting areas (Wang et al., 2018). Therefore, it is urgent to carry out basic research on antiviral breeding. Sri Lankan cassava mosaic virus ( Sri Lankan cassava mosaic virus, SLCMV) is a strain of cassava mosaic virus and belongs to the genus Begomovirus in the family Geminiviridae. It is a typical bipartite single-stranded DNA virus, and its genome consists of two circular components, DNA-A and DNA-B. The DNA-A component encodes two proteins, AV1 and AV2, on the sense strand, and four proteins, AC1, AC2, AC3, and AC4, on the antisense strand; the DNA-B component encodes BV1 and BC1 (Patil et al., 2009; Chen et al., 2019). The virus has an extremely small genome, so most of the encoded proteins are multifunctional proteins. Studies have shown that AC4 is not only a symptom determinant of SLCMV but also a viral silencing suppressor, which can inhibit host PTGS and enhance viral pathogenicity (Vanitharani et al., 2004; Chen et al., 2019). Whether AC4 has other functions has not been reported and remains to be studied. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide the application of cassava mosaic virus AC4 in inhibiting the degradation of mRNA decay substrates. The present invention discovers that AC4 inhibits the degradation of nonsense-mediated mRNA decay substrates with GFP as the reporter gene and endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana, indicating that AC4 has the function of inhibiting mRNA decay and the first 18 bases are the key regions where AC4 interacts with the key gene Upf1 in the Arabidopsis thaliana mRNA degradation signaling pathway.

[0005] The first aspect of the present invention is to provide the application of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacterium containing the coding region of the AC4 gene in increasing the GFP expression level and / or inhibiting the degradation of mRNA decay substrates with GFP as the reporter gene; wherein, the nucleotide sequence of the AC4 gene is as shown in SEQ ID NO:1.

[0006] Among them, the first 18 bases of AC4 are the key regions for AC4 to increase the GFP expression level and / or inhibit the degradation of mRNA decay substrates with GFP as the reporter gene.

[0007] The second aspect of the present invention is to provide the application of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacterium containing the coding region of the AC4 gene in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana without affecting ARE-dependent turnover; wherein, the nucleotide sequence of the AC4 gene is as shown in SEQ ID NO:1.

[0008] Among them, the genes related to Arabidopsis thaliana endogenous nonsense-mediated mRNA decay are AtUPF1, and / or AtPARN, and / or AtDCP2, and / or AtXRN4, and / or AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and the target genes mediated by ARE for degradation are At1G72450 and / or At2G40000.

[0009] The third aspect of the present invention is to provide the application of the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacterium containing the coding region of the AC4 gene in regulating the mRNA expression levels of AtUPF1, and / or AtPARN, and / or AtDCP2, and / or AtXRN4, and / or AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein the nucleotide sequence of the AC4 gene is as shown in SEQ ID NO:1.

[0010] Among them, the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacterium containing the coding region of the AC4 gene increases the mRNA expression levels of AtUPF1, AtPARN, AtDCP2, and AtXRN4.

[0011] Among them, the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacterium containing the coding region of the AC4 gene increases the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570.

[0012] Among them, the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacterium containing the coding region of the AC4 gene reduces the expression levels of AT1G72450 and AT2G400.

[0013] The fourth aspect of the present invention is to provide the application of the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacterium containing the coding region of the AC4 gene in dwarfing Arabidopsis thaliana seedlings and / or curling leaves.

[0014] The fifth aspect of the present invention is to provide the application of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacterium containing the coding region of the AC4 gene in enhancing the pathogenicity of PVX.

[0015] Among them, the 1st to 18th bases of AC4 are the key regions for enhancing the pathogenicity of PVX.

[0016] The sixth aspect of the present invention is to provide the application of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacterium containing the coding region of the AC4 gene in interacting with MeUpf1 and / or AtUpf1; among them, the nucleotide sequence of the AC4 gene is as shown in SEQ ID NO:1; the nucleotide sequence of the gene corresponding to MeUpf1 is as shown in SEQ ID NO:2; the nucleotide sequence of the gene corresponding to AtUpf1 is as shown in SEQ ID NO:3.

[0017] Among them, the interaction between AC4 and MeUpf1 or AtUpf1 improves the growth ability of yeast in the SD / -Ade / -His / -Leu / -Trp auxotrophic medium containing the self-activation inhibitor 3-AT.

[0018] Among them, the 1st to 18th bases of AC4 are the key regions for the interaction between AC4 and AtUpf1.

[0019] The research of the present invention finds that AC4 has the function of inhibiting mRNA decay, can inhibit the degradation of the nonsense-mediated mRNA decay substrate with GFP as the reporter gene and the degradation of the endogenous nonsense-mediated mRNA decay (NMD) substrate in Arabidopsis thaliana without affecting the ARE-dependent turnover, can increase the mRNA expression levels of AtUPF1, AtPARN, AtDCP2, AtXRN4, AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, AT5G22570, reduce the expression levels of AT1G72450 and AT2G400, can dwarf the Arabidopsis seedlings and / or curl the leaves, enhance the pathogenicity of PVX, has an interaction with MeUpf1 or AtUpf1, and can improve the growth ability of yeast in the SD / -Ade / -His / -Leu / -Trp auxotrophic medium containing the self-activation inhibitor 3-AT. The research results will lay a foundation for clarifying the function of AC4. Brief Description of the Drawings

[0020] Figure 1Schematic diagram of injection into Nicotiana benthamiana leaves. Reporter is the expression vector pG1300-PTC or pG1300; Vec is the empty vector p1300-Flag; AC4 is p1300-AC4-Flag; AC4 Δ1-18 is p1300-AC4 Δ1-18 -Flag; p19 is the expression vector pZP-p19.

[0021] Figure 2 For different GFP reporter vectors, the expression vectors pG1300-PTC or pG1300 were respectively mixed with the empty vector p1300-Flag or p1300-AC4-Flag or p1300-AC4 Δ1-18 -Flag and pZP-p19 in equal volumes and injected into Nicotiana benthamiana leaves. The GFP expression was observed 5 days after injection. Vec is the empty vector p1300-Flag; AC4 is p1300-AC4-Flag; AC4 Δ1-18 is p1300-AC4 Δ1-18 -Flag.

[0022] Figure 3 Shows the effect of overexpressing AC4 on the known NMD pathway. (a) Phenotype of 4-week-old Arabidopsis thaliana seedlings. (b) RT-qPCR was used to detect the effect of overexpressing AC4 on the expression of key factors in the NMD pathway. (c-f) RT-qPCR was used to detect the effect of overexpressing AC4 on the expression of known NMD target transcripts: (c) Premature termination codon genes (PTC: AT1G01060, RPS6, and SMG7) (d) Upstream open reading frame genes (uORFs: AT5G35490, AT5G64430, and ATG36730) (e) Unknown NMD target genes (AT4G13900, AT5G22570) (f) ARE target genes of AU-rich unstable elements (AT1G72450, AT2G4000).

[0023] Figure 4 Shows the experimental results of AC4 protein promoting PVX infection of Nicotiana benthamiana. (a) Phenotypes of wild-type Nicotiana benthamiana at 7 days post inoculation (7 dpa) and 12 days post inoculation (12 dpa) after injection with buffer (Mock), virus vector PVX-AC4 Δ1-18 (PVX-AC4 Δ1-18 ) and PVX-AC4 (PVX-AC4). (b) RT-qPCR was used to analyze the mRNA level of PVX coat protein (CP) in plants. (c) Western blot was used to detect the viral CP protein in plants.

[0024] Figure 5Results of yeast interaction experiments. AD-AC4 + BD-MeUpf1, AD-AC4 + BD-AtUpf1, AD-AC4 Δ1-18 + BD-AtUpf1 represent the co-transformed yeast combinations of pGADT7-AC4 + pGBKT7-MeUpf1, pGADT7-AC4 + pGBKT7-AtUpf1, and pGADT7-AC4 Δ1-18 + pGBKT7-AtUpf1, respectively. SD-LW: SD / -Leu / -Trp medium; SD-LWHA+7.5mM 3AT: SD-LWHA / -Ade / -His / -Leu / -Trp medium + 7.5mM 3AT. Detailed implementation manners

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments for better understanding. For those not specified in the embodiments regarding specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments not specified for the manufacturers, they are all conventional products that can be obtained through commercial purchase.

[0026] 1 Plant materials Wild-type Nicotiana benthamiana N. benthamiana and Arabidopsis thaliana A. thaliana .

[0027] 2 Experimental methods and results

[0028] 2.1 Construction of plant expression vectors (1) pG1300-PTC vector The construction method of the plant expression vector p1300-PTC containing a premature termination codon is as follows: Using pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) as a template, the 438th base C of GFP in the vector was mutated to A by site-directed mutagenesis (shown in SEQ ID NO:5). After correct sequencing identification, it was named pG1300-PTC.

[0029] (2)p1300-AC4-GFP vector Refer to the reported SLCMV sequence (GenBank: KT861468.1), and commissioned Shanghai Sangon Biotech Co., Ltd. to artificially synthesize the target fragment AC4-XbaI & BamHI (the specific sequence is shown in Table 2). The synthesized fragment and the pG1300 vector were both double-digested with XbaI and BamHI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was named p1300-AC4-GFP after being identified as correct by PCR and sequencing.

[0030] (3)p1300-AC4 Δ1-18 -GFP vector Refer to the reported SLCMV sequence (GenBank: KT861468.1), and commissioned Shanghai Sangon Biotech Co., Ltd. to artificially synthesize the target fragment AC4 Δ1-18 -SalII & BamHI (the specific sequence is shown in Table 2). The synthesized fragment and the pG1300 vector were both double-digested with XbaI and BamHI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was named p1300-AC4-AC4 Δ1-18 -GFP.

[0031] (4)p1300-AC4-Flag vector Refer to the reported SLCMV sequence (GenBank: KT861468.1), and commissioned Shanghai Sangon Biotech Co., Ltd. to artificially synthesize the target fragment AC4-SpeI & KpnI (the specific sequence is shown in Table 2). The synthesized fragment and the pF1300 vector (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology , 116 (3),744–755.) were both double-digested with SpeI & KpnI and then ligated. The ligation product was transformed into Escherichia coli, and the positive clone was named p1300-AC4-Flag after being identified as correct by PCR and sequencing.

[0032] (5)p1300-AC4 Δ1-18 -Flag vector Refer to the reported SLCMV sequence (GenBank: KT861468.1), and commissioned Sangon Biotech (Shanghai) Co., Ltd. to artificially synthesize the target fragment AC4 Δ1-18 -SpeI & KpnI (the specific sequence is shown in Table 2). Both the synthesized fragment and the pG1300 vector were double-digested with SpeI & KpnI and then ligated. The ligation product was transformed into Escherichia coli. After the positive clone was identified as correct by PCR and sequencing, it was named p1300-AC4 Δ1-18 -Flag.

[0033] (6)AD-AC4 Δ1-18 vector Refer to the reported SLCMV sequence (GenBank: KT861468.1), and commissioned Sangon Biotech (Shanghai) Co., Ltd. to artificially synthesize the target fragment AC4 Δ1-18 -EcoR & BamHI (the specific sequence is shown in Table 2). Both the synthesized fragment and the pGADT vector were double-digested with EcoR and BamHI and then ligated. The ligation product was transformed into Escherichia coli. After the positive clone was identified as correct by PCR and sequencing, it was named AD-AC4 Δ1-18 。

[0034] (7)BD-MeUpf1 vector Using primers MeUpf1-1F SfiI and MeUpf1-3813R BamHI (the specific sequence is shown in Table 1), MeUpf1 was amplified with cassava cDNA as the template; the PCR amplification system was 1 μL of each primer (10 μmol / L), 10 μL of 2*Magic Green TaqSuperMix, and supplemented with ddH 2 O to 20 μL. The amplification program was pre-denaturation at 94°C for 5 min, then denaturation at 94°C for 60 s, annealing at 56°C for 30 s, extension at 72°C for 90 s, with 35 cycles, and finally complete extension at 72°C for 10 min. The PCR product was double-digested with SfiI and BamHI and ligated to the large fragment of pGBKT recovered by the same double digestion. After the positive clone was identified as correct by PCR and sequencing, it was named BD-MeUpf1.

[0035] (8)BD-AtUpf1 vector Using primers AtUpf1-1F SfiI and AtUpf1-3765R BamHI (the specific sequence is shown in Table 1), AtUpf1 was amplified with Arabidopsis cDNA as the template; the PCR amplification system was 1 μL of each primer (10 μmol / L), 10 μL of 2*Magic Green TaqSuperMix, and supplemented with ddH 2O was supplemented to 20 μL. The amplification program was pre-denaturation at 94°C for 5 min, followed by denaturation at 94°C for 60 s, annealing at 56°C for 30 s, extension at 72°C for 90 s, with 35 cycles, and finally thorough extension at 72°C for 10 min. The PCR product was double-digested with SfiI and BamHI and then ligated to the large fragment of pGBKT recovered by the same double digestion. After the positive clone was identified as correct by PCR and sequencing, it was named BD-AtUpf1.

[0036] (9)Construction of PVX-AC4 vector Referring to the reported SLACMV AC4 sequence (GenBank: KT861468.1), the target fragment AC4-SmaII with sequences flanking the SmaII restriction endonuclease sites added at both ends was artificially synthesized by Shanghai Sangon Biological Engineering Co., Ltd. (the specific sequence is shown in Table 2). The seamless cloning technology was used to ligate the target fragment AC4-SmaII to the pgR107 vector. After the ligation product was transformed into Escherichia coli, the positive clone was identified as correct by PCR and sequencing and named PVX-AC4.

[0037] (10)Construction of PVX-AC4Δ 1-18 vector Referring to the reported SLACMV AC4 sequence (GenBank: KT861468.1), the target fragment AC4Δ 1-18 -SmaII with sequences flanking the SmaII restriction endonuclease sites added at both ends was artificially synthesized by Shanghai Sangon Biological Engineering Co., Ltd. (the specific sequence is shown in Table 2). The seamless cloning technology was used to ligate the target fragment AC4Δ 1-18 -SmaII to the pgR107 vector. After the ligation product was transformed into Escherichia coli, the positive clone was identified as correct by PCR and sequencing and named PVX-AC4Δ 1-18 。

[0038] Table 1 Primers used Primer name Sequence MeUpf1-1F SfiI ATGGATTCGGAGCAGAGCAAC MeUpf1-3813R BamHI TCAACCATTGTAGTGGATTTTC AtUpf1-1F SfiI ATGGATTCTCAACAGAGCGATCT AtUpf1-3765R BamHI TCAGCCATTGTAAGGATGTTTTG qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT Note: Italic and bold letters are restriction enzyme sites Table 2 Target fragment sequences

[0039] Note: Italic and bold letters are restriction enzyme sites

[0040] 2.2 Detection of the function of AC4 in inhibiting mRNA degradation

[0041] 2.2.1 AC4 inhibits the degradation of the mRNA decay substrate with GFP as the reporter gene Single-stranded green fluorescent protein expression vector pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166), pF1300 vector (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology , 116 (3), 744–755.), and the expression vector pZP-p19 containing the silencing suppressor p19 that does not interfere with mRNA decay (Qu, F., Ren, T., & Morris, T. J. (2003). The coat protein of turnip crinkle virus suppresses posttranscriptional gene silencing at an early initiation step. Journal of virology , 77 (1), 511–522.) are all stored in our laboratory.

[0042] (1) Transformation of recombinant plasmids into Agrobacterium (GV3101) competent cells Refer to the product manual of GV3101 Chemically Competent Cell to transform the plant expression vectors pG1300, pG1300-PTC, p1300-AC4-Flag, p1300-AC4 Δ1-18- The competent cells of Agrobacterium tumefaciens GV3101 were transformed with Flag and pZP-p19 respectively. After transformation, the resuspended bacterial pellets were evenly spread on LB plates containing the corresponding antibiotics. pG1300, pG1300-PTC, p1300-AC4-Flag, and p1300-AC4 Δ1-18 -Flag were spread on LB plates containing Kan and Rif resistances, while pZP-p19 was spread on LB plates containing Spec and Rif resistances), and they were inverted and cultured in an incubator at 28 °C for 72 - 90 h. After 2 - 3 days when 2 - 3 mm Agrobacterium colonies grew, single colonies were selected for PCR identification.

[0043] (2)Infiltrate wild-type Nicotiana benthamiana The resuspended bacterial solutions of the recombinant vectors were mixed and injected into the leaves of transgenic wild-type Nicotiana benthamiana. The operation steps are as follows: (a)Use a pipette tip to pick a single colony identified as positive by colony PCR into 5 ml of LB liquid medium containing the corresponding antibiotics, and place it in a constant temperature shaker at 28 °C and 200 r / min for overnight shaking culture.

[0044] (b)After centrifuging the bacterial solution at 7000 rmp / min for 15 min, discard the supernatant.

[0045] (c)Prepare the injection buffer: Take 2 mL of 1 mol / L MgCl 2 , 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up the volume to 200 mL with ultrapure water.

[0046] (d)Resuspend the bacterial pellet with 5 mL of injection buffer, vortex thoroughly to mix evenly, measure the OD600 value of the bacterial solution, and dilute and adjust the bacterial concentration to OD600 = 0.5.

[0047] (e)After the diluted bacterial solution is placed at room temperature for 2 - 3 h, mix it evenly in equal volumes according to the required mixing system (the specific combinations are shown in Table 3).

[0048] (f)Select wild-type Nicotiana benthamiana at the 5 - 7 leaf stage with good growth, and use a 1 mL syringe to inject about 2 cm 2 range. Inject the combinations of the same reporter gene with the empty vector or AC4 or AC4 Δ1-18 as shown Figure 1 on the same leaf. Inject 10 leaves, and keep the injected Nicotiana benthamiana in the dark overnight and then culture it under normal conditions.

[0049] (g)On the 5th day after injection, total RNA of tobacco was extracted with reference to the instruction manual of "TRNzol Universal Total RNA Extraction Reagent" of Tiangen Biotech (Beijing) Co., Ltd., and then reverse transcribed using the two-step method with reference to the instruction manual of the reverse transcription kit; using the obtained cDNA sample as a template, qNbActin-128F and qNbActin-256R as internal reference primers, and qsGFP-306F and qsGFP-519R as GFP detection primers for real-time fluorescence quantitative (qRT-PCR) detection.

[0050] The results were as Figure 2 shown. When AC4 was co-expressed with the GFP expression vector pG1300-PTC containing a premature termination codon, the GFP expression level increased, while there was no obvious effect on the GFP expression vector pG1300 without a premature termination codon. The transient expression results indicated that AC4 inhibited the degradation of the mRNA decay substrate with GFP as the reporter gene, suggesting that SLCMV AC4 has the function of inhibiting host mRNA decay. The GFP expression vector pG1300-PTC containing a premature termination codon or the GFP expression vector pG1300 without a premature termination codon was co-expressed with AC4 Δ1-18 deleted the 1st - 18th bases. There was no significant difference in the GFP expression level compared with the co-expression of the empty vector. These results indicated that the 1st - 18th bases were very important for the function of AC4 to inhibit host mRNA decay.

[0051] Table 3 Combinations of Agrobacterium tumefaciens injected with different plasmids into wild-type Nicotiana benthamiana

[0052] To further confirm the inhibition of AC4 on host mRNA decay, the expression vector p1300-AC4-GFP was transformed into wild-type Arabidopsis thaliana by the pollen tube pathway method to obtain transgenic Arabidopsis thaliana overexpressing AC4-GFP, named AC4oe. Four-week-old seedlings, including AC4oe, Col-0 (wild-type Col-0 as the control WT), and the mutant upfi-5 with partial loss of function of the key mRNA decay gene UPF1, were used to extract RNA and perform real-time quantitative PCR (RT-qPCR) to study the effect of overexpressing AC4 on the expression levels of NMD substrates and mRNAs containing AU-rich instability elements (ARE) in transgenic plants.

[0053] The phenotypes of four-week-old Arabidopsis thaliana seedlings were as Figure 3 shown in a of upf1-5 which. The mutant showed characteristic long leaves, and the AC4oe lines all showed dwarfism and leaf curling.

[0054] Using wild-type Col-0 as a control, the mRNA levels of four core NMD components (AtUPF1, AtPARN, AtDCP2, AtXRN4) in AC4oe plants were quantified by RT-PCR (Kurosaki, T., Popp, M. W., & Maquat, L. E. (2019). Quality and quantity control of gene expression by nonsense-mediated mRNA decay. Nature reviews. Molecular cell biology, 20(7), 406–420). RT-qPCR analysis showed that all four genes were significantly upregulated in AC4oe plants compared with the WT ( Figure 3 in b), indicating that SLCMV AC4 activates the mRNA decay pathway at the transcriptional level.

[0055] Analysis of the transcripts of 8 known NMD targets in three major categories using RT-qPCR (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology, 116(3), 744–755.): (A) AT1G0106020 containing a premature termination codon (Gloggnitzer, J., Akimcheva, S., Srinivasan, A., Kusenda, B., Riehs, N., Stampfl, H. et al. (2014) Nonsense-mediated mRNA decay modulates immune receptor levels to regulate plant antibacterial defense. Cell Host & Microbe, 16(3), 376–390.), RPS6 (Garcia, D., Garcia, S. & Voinnet, O. (2014) Nonsense-mediated decay serves as a general viral restriction mechanism in plants. Cell Host & Microbe, 16(3), 391–402.) or SMG7 with a long 3'UTR (Kerényi, Z., Mérai, Z., Hiripi, L., Benkovics, A., Gyula, P., Lacomme, C. et al. (2008) Inter-kingdom conservation of mechanism of nonsense-mediated mRNA decay. The EMBO Journal, 27(11), 1585–1595.); (B) AT5G35490, AT5G64430, AT1G36730 with an upstream open reading frame (uORF) (Rayson, S., Arciga-Reyes, L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) A role for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.) and (C) two mRNAs of AT4G3900 and AT5G22570 carrying unknown NMD cis-elements (Rayson, S., Arciga-Reyes, L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) A role for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.). The two target transcripts containing AU instability elements (AT1G72450 and AT2G400) were detected and analyzed by RT-qPCR (Gutierrez, R.A., Ewing, R.M., Cherry, J.M. & Green, P.J. (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is associated with a group of touch- and specific clock-controlled genes. Proceedings of the National Academy of Sciences of the United States of America, 99(17), 11513–11518.). The results are as follows. Figure 3As shown in c-f in [reference], compared with Col-0 plants, the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570 were all significantly increased in AC4 overexpressing plants, more than 2-fold higher in AC4 plants than in wild type, and even exceeded upf1- 5 the levels in mutants. The two Upf1-dependent / ARE-mediated degradation targets (At1G72450, At2G40000) were upf1-5 increased by 3.5-fold in [reference], but decreased by 30% in AC4oe (p<0.05, t-test). This indicates that AC4 can inhibit the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis without affecting ARE-dependent turnover, and has the function of an mRNA decay inhibitor.

[0056] 2.2.3 SLCMV AC4 enhances the pathogenicity of PVX through its N-terminal domain To evaluate the effect of AC4 on pathogenicity, two PVX (Potato virus X) recombinant viruses were constructed: PVX-AC4 (expressing the complete SLCMV AC4 protein) and PVX-AC4Δ 1-18 (expressing an AC4 mutant lacking the N-terminal 1-18 nucleotides), and Mock was the control of inoculating wild-type Nicotiana benthamiana with buffer.

[0057] Plasmids PVX-AC4, PVX-AC4Δ1-18, and PVX-mAC4F were transformed into competent GV3101 cells. Twelve well-growing Nicotiana benthamiana plants were selected and marked. After the agrobacteria containing PVX-AC4, PVX-AC4Δ1-18, and PVX-mAC4F plasmids were cultured and expanded, they were centrifuged at 7000 rpm for 15 min, and the mixed solution was adjusted to OD = 0.5 with the resuspension solution. After standing at room temperature for 2 h, the bacterial solution was injected into the leaves with a 1 ml syringe without a needle. After injecting PVX-AC4, PVX-AC4Δ1-18, PVX-mAC4F, and the resuspension solution Buffer into tobacco, the symptoms of tobacco leaves were observed at 7 days, 12 days, and 18 days respectively, and RNA and proteins were extracted for fluorescence quantitative PCR, Northern Blot, and Western Blot experiments to detect the expression level of PVX-CP at the mRNA and protein levels.

[0058] The results are as Figure 4 shown. At 7 days post-agroinfiltration (dpa), no obvious phenotypic differences were observed in the plants infected with the two viruses ( Figure 4In aⅠ). By 12 days post inoculation (dpa), compared with Mock, PVX-AC4-infected plants showed systemic severe symptoms (leaf curling, plant dwarfing) ( Figure 4 in aⅡ-Ⅲ), while PVX-AC4 Δ1-18 infected plants only showed mild mottling symptoms, which were significantly weaker than those of wild-type AC4 ( Figure 4 in aⅡ-Ⅲ). Quantitative analysis showed that the level of PVX coat protein (CP) mRNA in PVX-AC4 plants was 4.2-fold higher than that in PVX-AC4 Δ1-8 (p < 0.001; Figure 5 in b). This indicates that intact AC4 significantly promotes viral gene expression. Western blot confirmed that the viral CP protein in PVX-AC4-infected plants was significantly higher than that in the mutant ( Figure 5 in c), further supporting the enhancing effect of AC4 on virus replication, and the N-terminal 1-18 amino acids of AC4 are the key domains for enhancing viral pathogenicity. SLCMV AC4 enhances virus pathogenesis through its N-terminal myristoylation motif.

[0059] 2.2.4 Yeast two-hybrid assay to identify the interaction between AC4 and MeUpf1 / AtUpf1 For ease of description, during the co-transformation process, the "pGADT7" vector was abbreviated as "AD", and the "pGBKT7" vector was abbreviated as "BD". Yeast expression vectors pGADT7, pGBKT7 (BD-lam), AD-T (pGADT7-T), BD-53 (pGBKT7-53), and AD-AC4 (pGADT7-AC4) (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between AC4 protein of cassava mosaic virus and AtPARN [J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.), AD-AC4 Δ1-18 and BD-MeUpf1, BD-AtUpf1 were all preserved in this laboratory.

[0060] Yeast vectors According to Table 4, different yeast expression vectors were co-transformed into yeast competent cells. Positive monoclonal colonies identified by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. The suspension was serially diluted 10-fold, 100-fold, and 1000-fold with sterile water. 2 μL of each dilution was inoculated into SD / -Leu / -Trp (SD-LW) auxotrophic medium, SD / -Leu / -Trp / -His / -Ade (SD-LWHA) auxotrophic medium, and SD-LWHA medium supplemented with 7.5 mM of the self-activation inhibitor 3-AT. Yeast co-transformed with AD-T and BD-Lam and yeast co-transformed with AD-T and BD-53 were used as negative and positive controls, respectively. The yeast cell suspensions transformed with the target plasmids were also inoculated into solid media. The plates were incubated upside down in a constant temperature incubator at 28°C for 3 days to observe and record the growth conditions, and to determine the interaction relationship between the proteins.

[0061] Table 4 Pairing combinations of yeast bait plasmids and prey plasmids

[0062] The results of the yeast two-hybrid study are shown as Figure 5 follows. All co-transformed yeast could grow normally in the SD-LW auxotrophic medium, but only the yeast positive control, yeast co-transformed with AD-AC4 and BD-MeUpf1, and yeast co-transformed with AD-AC4 and BD-AtUpf1 could grow normally in the SD-LWHA auxotrophic medium supplemented with 7.5 mM 3-AT. The negative control and yeast co-transformed with AD-AC4 Δ1-18 and BD-AtUpf1 could not grow normally. The results indicate that there is an interaction between AD-AC4 and BD-MeUpf1, and between AD-AC4 and BD-AtUpf1, suggesting that full-length AC4 interacts with both AtUPF1 and MeUpf1. Sequence alignment shows 87% identity between MeUPF1 and AtUPF1. However, there is no interaction between the AC4 Δ1-18 mutant lacking the N-terminal myristoylation motif and AtUpf1. This result indicates that bases 1-18 are the key region for the interaction between AC4 and Upf1, a key gene in the Arabidopsis mRNA degradation signaling pathway.

[0063] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to this application are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in increasing the expression of GFP and / or inhibiting the degradation of mRNA attenuation substrates using GFP as a reporter gene; wherein, The nucleotide sequence of the AC4 gene is shown in SEQ ID NO:

1.

2. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA attenuation NMD substrates in Arabidopsis thaliana without affecting ARE-dependent turnover; wherein, The nucleotide sequence of the AC4 gene is shown in SEQ ID NO:

1.

3. The use according to claim 2, characterized in that: The genes related to endogenous nonsense-mediated mRNA decay in Arabidopsis are AtUPF1, and / or AtPARN, and / or AtDCP2, and / or AtXRN4, and / or AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and the ARE-mediated degradation target genes are At1G72450 and / or At2G40000.

4. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in regulating the mRNA expression of AtUPF1, and / or AtPARN, and / or AtDCP2, and / or AtXRN4, and / or AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein: The nucleotide sequence of the AC4 gene is shown in SEQ ID NO:

1.

5. The use according to claim 4, characterized in that: The AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacteria containing the AC4 gene coding region increase the mRNA expression levels of AtUPF1, AtPARN, AtDCP2, and AtXRN4; the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacteria containing the AC4 gene coding region increase the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570; the AC4 gene, or the protein encoded by the AC4 gene, or the recombinant vector or host bacteria containing the AC4 gene coding region reduce the expression levels of AT1G72450 and AT2G400.

6. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in causing dwarfing and / or leaf curling of Arabidopsis seedlings.

7. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in enhancing the pathogenicity of PVX.

8. Use of the AC4 gene, or the protein encoded by the AC4 gene, or a recombinant vector or host bacteria containing the AC4 gene coding region in the interaction with MeUpf1 and / or AtUpf1; wherein, The nucleotide sequence of the AC4 gene is shown in SEQ ID NO: 1; the nucleotide sequence of the gene corresponding to MeUpf1 is shown in SEQ ID NO: 2; and the nucleotide sequence of the gene corresponding to AtUpf1 is shown in SEQ ID NO: 3.

Images