A nucleic acid detection reagent preservation method and application

Abstract

The present application relates to the technical field of molecular biology, in particular to a nucleic acid detection reagent storage method and application. The present application provides a fully premixed nucleic acid detection reagent, which comprises at least the following components: (a) a buffer, (b) a DNA polymerase or a combination of a DNA polymerase and a reverse transcriptase, and (c) primers for detecting target nucleic acids; the primers comprise upstream primers and downstream primers; wherein the primers have a primer double-stranded structure. The nucleic acid detection reagent provided by the present application can be unaffected by reverse transcriptase and / or Taq enzyme during low-temperature storage, avoiding the generation of non-specific amplification reactions, and can ensure the normal or even efficient subsequent nucleic acid amplification, thereby simplifying the operation of the user end.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a nucleic acid detection reagent preservation method and application. BACKGROUND

[0002] In the field of molecular detection, the main means for nucleic acid amplification is still PCR technology. In nucleic acid detection, for DNA samples, in order to improve the specificity and sensitivity of the system, the polymerase activity of Taq DNA polymerase is usually selected for activity blocking, i.e. hot start (Taq DNA polymerase does not exhibit polymerase activity before thermal activation), so that it does not work before thermal activation, and thus cannot produce primer dimers and other non-specific amplification. When RNA samples are amplified, an additional step of reverse transcription is required, and RNA amplification also requires reverse transcriptase. Reverse transcriptase does not have the same high heat resistance as Taq DNA polymerase, and cannot use the same activity blocking method. Therefore, when nucleic acid detection reagents are stored at low temperatures, the primers in the system will slowly undergo non-specific amplification under the action of Taq DNA polymerase and / or reverse transcriptase, resulting in the production of non-specific fragments (i.e. primer dimers). Primer dimers will also undergo PCR amplification, and their presence will consume the raw materials (such as primers) in the PCR system, leading to a decrease in amplification efficiency. When the original concentration of the target nucleic acid is low, the competitive effect of primer dimers will result in poor amplification results, specifically in poor amplification curve morphology and low fluorescence increment, which will greatly reduce the sensitivity and specificity of the PCR amplification system.

[0003] Therefore, the prior art usually uses chemical modification or antibody modification (i.e. adding Taq enzyme antibodies) to block the activity of Taq enzyme at low temperatures, in an attempt to avoid the production of primer dimers by Taq enzyme at low temperatures. On the one hand, the blocking efficiency of the prior art for Taq enzyme cannot reach 100%, which means that primer non-specific amplification reactions under the action of Taq enzyme cannot be avoided. On the other hand, since the optimal temperature for reverse transcriptase is usually not high (the commonly used reverse transcription temperature is 50°C), reverse transcriptase antibodies are difficult to inactivate at this temperature, which makes it difficult for the prior art to block the activity of reverse transcriptase at low temperatures. The prior art usually starts from the control of reverse transcriptase and / or Taq enzyme, in an attempt to store reverse transcriptase, Taq enzyme and primers in the same reaction system. For example, Chinese patent application CN118813628A discloses a nucleic acid aptamer that specifically binds to reverse transcriptase, and the low-temperature activity of the reverse transcriptase modified by the nucleic acid aptamer can be blocked to a certain extent. Chinese patent application CN118028439A discloses a nucleic acid detection reagent, which separates the primers, Taq enzyme and / or reverse transcriptase by pre-laminating and packaging, in order to avoid non-specific amplification of primers caused by reverse transcriptase and / or Taq enzyme during low-temperature storage.

[0004] As described above, it is difficult for the prior art to place reverse transcriptase and / or Taq enzyme and primers in the same reaction system for long-term stable storage. SUMMARY

[0005] In a first aspect, the present application provides a fully-premixed nucleic acid detection reagent, characterized in that the fully-premixed nucleic acid detection reagent comprises at least the following components: (a) a buffer, (b) a DNA polymerase, or a combination of a DNA polymerase and a reverse transcriptase, and (c) primers for detecting a target nucleic acid; the primers comprise an upstream primer and a downstream primer.

[0006] As used herein, "fully-premixed" means that the DNA polymerase, or the combination of the DNA polymerase and the reverse transcriptase, and the primers for detecting the target nucleic acid are simultaneously present in the buffer and in a mixed state capable of contacting each other.

[0007] In some embodiments, the primers have a primer double-stranded structure.

[0008] In some embodiments, the concentration of the primers comprises 2 - 20 μM.

[0009] In some embodiments, the concentration of the primers is 2 - 10 μM.

[0010] In some embodiments, the primer double-stranded structure comprises a first strand and a second strand, the first strand is used for specific binding to the target nucleic acid, and the second strand is substantially complementary to the first strand.

[0011] As used herein, "complementary" means that in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) pairs with the pyrimidine base cytosine (G). Each base pair comprises one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other. Accordingly, "mismatch" herein means that the bases at the corresponding positions in a double-stranded nucleic acid molecule do not pair in a complementary manner.

[0012] As used herein, "substantially complementary" means that there are no more than 2 base mismatches between the two nucleotide sequences involved.

[0013] In some embodiments, the second strand has a base mismatch with the first strand.

[0014] In some embodiments, the first strand is longer than the second strand.

[0015] In some embodiments, the first strand differs from the second strand by at least 5 bases.

[0016] In some embodiments, the first strand differs from the second strand by 5-15 bases.

[0017] In some embodiments, the second strand has a Tm value of 30-50°C.

[0018] In some embodiments, the 3' end of the second strand is a non-extendable nucleotide.

[0019] In some embodiments, the non-extendable nucleotide can be a dideoxynucleotide or a nucleotide artificially modified to be non-extendable.

[0020] In some embodiments, the artificial modification includes a phosphate, an amino, or a C3 spacer modification.

[0021] Unlike the prior art, which focuses on blocking the activity of reverse transcriptase and / or Taq enzyme in nucleic acid detection reagents, the present application, based on conventional primer design, designs a substantially complementary sequence (also referred to as an "interferon") at the 3' end of the primer, thereby forming a primer double-stranded structure (i.e., an upstream primer-upstream interferon double-stranded structure and a downstream primer-downstream interferon double-stranded structure are formed accordingly), wherein the 3' end of the interferon is also provided with a non-extendable nucleotide. The present application has found that even if Taq enzyme, reverse transcriptase, and the primer double-stranded structure provided by the present application are present in the nucleic acid detection reagent and contact each other, the primer double-stranded structure provided by the present application cannot be extended, thereby not causing the non-specific amplification reaction of the primer that is usually caused by Taq enzyme, reverse transcriptase, and the primer during low-temperature storage.

[0022] Further, the present application has found that although the primer double-stranded structure can control the extension of the primer during low-temperature storage to some extent, the primer itself is relatively difficult to achieve "hot start" due to the structure. For this, the present application controls the position and number of base mismatches (e.g., 1-2 mismatched bases are introduced at the middle position of the primer) and the Tm value (e.g., 30-50°C) of the second strand (i.e., the interferon), thereby improving the dissociation efficiency of the second strand, and cooperatively ensuring that the second strand can fully dissociate from the first strand at 35°C-40°C, thereby completing the opening of the primer extension function (i.e., the hot start of the primer), and ensuring the normal progress of nucleic acid amplification.

[0023] Therefore, the primer double-stranded structure provided by the present application can not be affected by reverse transcriptase and / or Taq enzyme during low-temperature storage, thereby avoiding non-specific amplification reaction, and can ensure that the second strand can be dissociated (or dropped) from the first strand by temperature adjustment (i.e., hot start), without affecting the binding of the first strand to the template, so as to ensure the normal progress of subsequent nucleic acid amplification. Therefore, the primer double-stranded structure provided by the present application can be premixed with reverse transcriptase and / or Taq enzyme, thereby simplifying the operation of the user end.

[0024] In some embodiments, when the target nucleic acid is DNA, the Tm value of the second strand of the primer is 30-50℃; when the target nucleic acid is RNA, the Tm value of the second strand of the primer is 30-40℃; and when the target nucleic acid comprises DNA and RNA, the Tm value of the second strand of the primer is 30-40℃.

[0025] In some embodiments, the second strand is paired with the first strand from the 3' end of the primer.

[0026] In some embodiments, the primer double-stranded structure is formed by annealing the first strand and the second strand. In some embodiments, the method of annealing specifically comprises: mixing the first strand and the second strand in a ratio of 1-2:1, 94℃ for 1-2 minutes, and then placing in an environment of 20-30℃ for 5-30 minutes.

[0027] In some embodiments, the position of the base mismatch is the middle position of the second strand.

[0028] As used herein, the "middle position" refers to a position of a nucleic acid molecule that is not a terminal (i.e., 5' end and 3' end) position. In some embodiments, the mismatched base is at least 2 bases away from the terminal end of the nucleic acid strand.

[0029] In some embodiments, the number of base mismatches is 1-2.

[0030] In some embodiments, the method of introducing the base mismatch comprises: at the corresponding site, selecting the same base as the first strand to introduce the mismatched base, i.e., A-A, T-T, C-C, G-G, U-T.

[0031] In some embodiments, when the target nucleic acid is RNA, or DNA and RNA, the primer does not contain U (Uracil).

[0032] In some embodiments, the fully premixed nucleic acid detection reagent further comprises a probe for detecting the target nucleic acid.

[0033] In some embodiments, the concentration of the probe for detecting the target nucleic acid comprises 1-5 μM.

[0034] In some embodiments, the DNA polymerase is Taq DNA polymerase.

[0035] In some embodiments, the concentration of the DNA polymerase comprises 2-20 U.

[0036] In some embodiments, the concentration of the DNA polymerase comprises 5-20 U.

[0037] In some embodiments, the concentration of the reverse transcriptase comprises 100-300 U.

[0038] In some embodiments, the fully pre-mixed nucleic acid detection reagent further comprises dNTPs.

[0039] In some embodiments, the concentration of the dNTPs comprises 10-50 mM.

[0040] In some embodiments, when the target nucleic acid is adenovirus hexon gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid;

[0041] wherein the primer for detecting the target nucleic acid specifically comprises: a first primer and a second primer; the first primer has a first upstream primer-first upstream interferon double-stranded structure, and the second primer has a first downstream primer-first downstream interferon double-stranded structure; the nucleotide sequence of the first upstream primer is shown as SEQ ID NO: 1, the nucleotide sequence of the first downstream primer is shown as SEQ ID NO: 2, the nucleotide sequence of the first upstream interferon is shown as SEQ ID NO: 4, and the nucleotide sequence of the first downstream interferon is shown as SEQ ID NO: 5; the probe for detecting the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is shown as SEQ ID NO: 3.

[0042] In some embodiments, when the target nucleic acid is influenza A virus M2 gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a combination of DNA polymerase and reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid;

[0043] The primer for detecting the target nucleic acid specifically includes a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10, the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown as SEQ ID NO: 8.

[0044] In some embodiments, when the target nucleic acid is a human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid.

[0045] The primer for detecting the target nucleic acid specifically includes a fifth primer and a sixth primer; the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; the nucleotide sequence of the third upstream primer is shown as SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown as SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown as SEQ ID NO: 14, the nucleotide sequence of the third downstream interferon is shown as SEQ ID NO: 15, the probe for detecting the target nucleic acid is a third probe, and the nucleotide sequence of the third probe is shown as SEQ ID NO: 13.

[0046] In some embodiments, when the target nucleic acid is an influenza A virus M2 gene and a human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a combination of a DNA polymerase and a reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid.

[0047] The primer for detecting the target nucleic acid specifically comprises a third primer, a fourth primer, a fifth primer and a sixth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown in SEQ ID NO: 9, the nucleotide sequence of the second downstream interferon is shown in SEQ ID NO: 10, the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; the nucleotide sequence of the third upstream primer is shown in SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown in SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown in SEQ ID NO: 14, and the nucleotide sequence of the third downstream interferon is shown in SEQ ID NO: 15.

[0048] The probe for detecting the target nucleic acid comprises a second probe and a third probe, the nucleotide sequence of the second probe is shown in SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown in SEQ ID NO: 13.

[0049] In a second aspect, the present application provides a method for nucleic acid amplification based on the above-mentioned nucleic acid detection reagent, characterized in that the method comprises:

[0050] mixing the sample with the nucleic acid detection reagent directly and performing thermal initiation and nucleic acid amplification, wherein the conditions of the thermal initiation comprise 1-10 min at 94-98℃; the conditions of the nucleic acid amplification comprise denaturation for 2-10 s at 94-98℃, annealing and elongation for 20-40 s at 50-65℃, and denaturation, annealing and elongation cycles for 30-50 times.

[0051] In some embodiments, the method further comprises reverse transcription before the thermal initiation, and the conditions of the reverse transcription comprise 5-30 min at 45-60℃.

[0052] In a third aspect, the present application provides a use of a primer double-stranded structure in improving the storage stability of a nucleic acid detection reagent, characterized in that the nucleic acid detection reagent at least comprises the following components: a buffer, a DNA polymerase or a combination of a DNA polymerase and a reverse transcriptase, and a primer for detecting a target nucleic acid; the primer comprises an upstream primer and a downstream primer; and the primer has a primer double-stranded structure.

[0053] In some embodiments, the concentration of the primer comprises 2 - 20 μM.

[0054] In some embodiments, the concentration of the primer comprises 2 - 10 μM.

[0055] In some embodiments, the primer double-stranded structure comprises a first strand and a second strand, the first strand is used to specifically bind to the target nucleic acid, and the second strand is substantially complementary to the first strand.

[0056] In some embodiments, the second strand has a base mismatch with the first strand.

[0057] In some embodiments, the first strand is longer than the second strand.

[0058] In some embodiments, the first strand differs from the second strand by at least 5 bases.

[0059] In some embodiments, the first strand differs from the second strand by 5-15 bases.

[0060] In some embodiments, the second strand has a Tm value of 30-50℃.

[0061] In some embodiments, the 3' end of the second strand is a non-extendable nucleotide.

[0062] In some embodiments, the non-extendable nucleotide can be a dideoxynucleotide or a nucleotide artificially modified to be non-extendable.

[0063] In some embodiments, the artificial modification comprises a phosphate, an amino, or a C3 spacer modification.

[0064] In some embodiments, when the target nucleic acid is DNA, the second strand of the primer has a Tm value of 30-50℃; when the target nucleic acid is RNA, the second strand of the primer has a Tm value of 30-40℃; when the target nucleic acid comprises DNA and RNA, the second strand of the primer has a Tm value of 30-40℃.

[0065] In some embodiments, the second strand pairs with the first strand from the 3' end of the primer.

[0066] In some embodiments, the primer double-stranded structure is formed by annealing the first strand and the second strand. In some embodiments, the method of annealing specifically comprises: mixing the first strand and the second strand in a ratio of 1-2:1, 94℃ for 1-2 minutes, and then placing in an environment of 20-30℃ for 5-30 minutes.

[0067] In some embodiments, the position of the base mismatch is the middle position of the second strand.

[0068] In some embodiments, the number of base mismatches is 1-2.

[0069] In some embodiments, the method of introducing the base mismatches comprises selecting the same base as the first strand to introduce a mismatched base, i.e., A-A, T-T, C-C, G-G, U-T, at the corresponding site.

[0070] In some embodiments, when the target nucleic acid is RNA or DNA and RNA, the second strand of the primer does not contain U (Uracil).

[0071] In some embodiments, the nucleic acid detection reagent further comprises a probe for detecting the target nucleic acid.

[0072] In some embodiments, the concentration of the probe for detecting the target nucleic acid comprises 1-5 μM.

[0073] In some embodiments, the DNA polymerase is Taq DNA polymerase.

[0074] In some embodiments, the concentration of the DNA polymerase comprises 2-20 U.

[0075] In some embodiments, the concentration of the DNA polymerase is 5-20 U.

[0076] In some embodiments, the concentration of the reverse transcriptase comprises 100-300 U.

[0077] In some embodiments, the nucleic acid detection reagent further comprises dNTPs.

[0078] In some embodiments, the concentration of the dNTPs comprises 10-50 mM.

[0079] In some embodiments, the storage comprises storing the nucleic acid detection reagent at -20°C for at least 12 months.

[0080] In some embodiments, when the target nucleic acid is adenovirus hexon gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid.

[0081] The primer for detecting the target nucleic acid specifically includes a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, and the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown as SEQ ID NO: 8.

[0082] In some embodiments, when the target nucleic acid is a human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid.

[0083] The primer for detecting the target nucleic acid specifically includes a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, and the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown as SEQ ID NO: 8.

[0084] In some embodiments, when the target nucleic acid is a human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid.

[0085] The primer for detecting the target nucleic acid specifically includes a fifth primer and a sixth primer; the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; wherein the nucleotide sequence of the third upstream primer is shown as SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown as SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown as SEQ ID NO: 14, and the nucleotide sequence of the third downstream interferon is shown as SEQ ID NO: 15; the probe for detecting the target nucleic acid is a third probe, and the nucleotide sequence of the third probe is shown as SEQ ID NO: 13.

[0086] In some embodiments, when the target nucleic acid is the influenza A virus M2 gene and the human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a combination of DNA polymerase and reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid.

[0087] The primer for detecting the target nucleic acid specifically includes a third primer, a fourth primer, a fifth primer and a sixth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, and the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10; the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; wherein the nucleotide sequence of the third upstream primer is shown as SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown as SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown as SEQ ID NO: 14, and the nucleotide sequence of the third downstream interferon is shown as SEQ ID NO: 15.

[0088] The probe for detecting the target nucleic acid includes a second probe and a third probe, the nucleotide sequence of the second probe is shown as SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown as SEQ ID NO: 13.

[0089] Fourthly, the present invention provides an adenovirus nucleic acid detection kit, characterized in that the kit includes a nucleic acid detection reagent, the nucleic acid detection reagent including at least primers for detecting a target nucleic acid and probes for detecting the target nucleic acid; the target nucleic acid is an adenovirus hexon gene;

[0090] The primers used to detect the target nucleic acid specifically include: a first primer and a second primer; the first primer has a first upstream primer-first upstream interferon double-stranded structure, and the second primer has a first downstream primer-first downstream interferon double-stranded structure; the nucleotide sequence of the first upstream primer is shown in SEQ ID NO:1, the nucleotide sequence of the first downstream primer is shown in SEQ ID NO:2, the nucleotide sequence of the first upstream interferon is shown in SEQ ID NO:4, and the nucleotide sequence of the first downstream interferon is shown in SEQ ID NO:5; the probe used to detect the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is shown in SEQ ID NO:3.

[0091] In some embodiments, the nucleic acid detection reagent further includes a buffer solution and / or DNA polymerase.

[0092] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0093] Fifthly, the present invention provides a nucleic acid detection kit for influenza A virus, characterized in that the kit includes a nucleic acid detection reagent, wherein the nucleic acid detection reagent includes at least primers for detecting a target nucleic acid and probes for detecting the target nucleic acid; the target nucleic acid is the influenza A virus M2 gene;

[0094] Specifically, the primers used to detect the target nucleic acid include a third primer and a fourth primer; the third primer has a double-stranded structure of a second upstream primer and a second upstream interferon, and the fourth primer has a double-stranded structure of a second downstream primer and a second downstream interferon; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferon is shown in SEQ ID NO:9, and the nucleotide sequence of the second downstream interferon is shown in SEQ ID NO:10; the probe used to detect the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown in SEQ ID NO:8.

[0095] In some embodiments, the nucleic acid detection reagent further includes a buffer and / or a combination of DNA polymerase and reverse transcriptase.

[0096] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0097] In a sixth aspect, the present invention provides a human β-action nucleic acid detection kit, characterized in that the kit comprises a nucleic acid detection reagent, the nucleic acid detection reagent comprising at least primers for detecting a target nucleic acid and probes for detecting the target nucleic acid; the target nucleic acid is a human β-action gene;

[0098] Specifically, the primers used to detect the target nucleic acid include a fifth primer and a sixth primer; the fifth primer has a double-stranded structure of a third upstream primer and a third upstream interferon, and the sixth primer has a double-stranded structure of a third downstream primer and a third downstream interferon; wherein the nucleotide sequence of the third upstream primer is shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferon is shown in SEQ ID NO:14, the nucleotide sequence of the third downstream interferon is shown in SEQ ID NO:15, and the probe used to detect the target nucleic acid is a third probe, the nucleotide sequence of which is shown in SEQ ID NO:13.

[0099] In some embodiments, the nucleic acid detection reagent further includes a buffer solution and / or DNA polymerase.

[0100] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0101] In a seventh aspect, the present invention provides a nucleic acid detection kit for influenza A virus, characterized in that the kit includes a nucleic acid detection reagent, wherein the nucleic acid detection reagent includes at least primers for detecting a target nucleic acid and probes for detecting the target nucleic acid; the target nucleic acid is influenza A virus M2 gene and human β-action gene;

[0102] The primers for detecting the target nucleic acid specifically include a third primer, a fourth primer, a fifth primer and a sixth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10, the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; the nucleotide sequence of the third upstream primer is shown as SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown as SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown as SEQ ID NO: 14, and the nucleotide sequence of the third downstream interferon is shown as SEQ ID NO: 15.

[0103] The probe for detecting the target nucleic acid includes a second probe and a third probe, the nucleotide sequence of the second probe is shown as SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown as SEQ ID NO: 13.

[0104] In some embodiments, the nucleic acid detection reagent further includes a combination of a buffer and / or a DNA polymerase and a reverse transcriptase.

[0105] In some embodiments, the nucleic acid detection reagent is a full-premixed nucleic acid detection reagent.

[0106] Compared with the prior art, the present application has at least the following beneficial effects:

[0107] The existing technical solution focuses on blocking the activity of reverse transcriptase and / or Taq enzyme in the nucleic acid detection reagent. Unlike the idea of the prior art, the present application designs a substantially complementary sequence (also known as "interferon") for the 3' end of the primer on the basis of conventional primer design, thereby forming a primer double-stranded structure (i.e. corresponding to the upstream primer-upstream interferon double-stranded structure and the downstream primer-downstream interferon double-stranded structure), wherein the 3' end of the interferon is also provided with non-extendable nucleotides. The present application finds that even if the Taq enzyme, reverse transcriptase and the primer double-stranded structure provided by the present application coexist in the nucleic acid detection reagent and contact each other, the primer double-stranded structure provided by the present application cannot be extended, thereby not causing the non-specific amplification reaction of the primer usually caused by the Taq enzyme, reverse transcriptase and primer during low-temperature storage. The experiment of the present application proves that the nucleic acid detection reagent provided by the present application (i.e. the primer double-stranded structure, Taq enzyme and reverse transcriptase provided by the present application) can still maintain stability at-20℃ for 13 months, and the amplification efficiency is equivalent to that of the nucleic acid detection reagent stored for 0 months, which is obviously superior to the control group (i.e. conventional primer design).

[0108] In other words, the primer double-stranded structure provided by the present application can not be affected by reverse transcriptase and / or Taq enzyme during low-temperature storage, avoiding the generation of non-specific amplification reaction, and can ensure that the second strand can be dissociated (or shed) from the first strand through temperature regulation (i.e. heat activation), without affecting the binding of the first strand to the template, so as to ensure the normal or even efficient performance of subsequent nucleic acid amplification. Therefore, the primer double-stranded structure provided by the present application can be premixed with reverse transcriptase and / or Taq enzyme to form a fully premixed nucleic acid detection reagent, thereby simplifying the operation of the user end. BRIEF DESCRIPTION OF DRAWINGS

[0109] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual proportion. Obviously, the drawings described below are some embodiments of the present application, and those skilled in the art can obtain other drawings from these drawings without creative labor.

[0110] Figure 1 Amplification diagram for DNA target detection in singleplex system;

[0111] Figure 2 Amplification diagram for RNA target detection in singleplex system;

[0112] Figure 3 Amplification diagram for DNA target detection in duplex system;

[0113] Figure 4 Amplification scheme for RNA target detection in duplex system. DETAILED DESCRIPTION

[0114] In order to make the objects, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are some but not all of the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0115] In this document, the terms "upper", "lower", "inner", "outer", "front", "back", "one end", "the other end" and the like indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present application and simplifying the description, and do not indicate or imply that the device or element referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore cannot be understood as a limitation on the present application. In addition, the terms "first", "second" are only for the purpose of description, and cannot be understood as indicating or implying relative importance.

[0116] In this document, "and / or" includes any and all combinations of one or more of the associated items.

[0117] In this document, "a plurality of" means two or more, that is, it includes two, three, four, five, etc.

[0118] It should be noted that in this document, the terms "comprising", "including", or any other variant thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or other elements inherent to such a process, method, article or device. Without more limitations, the element defined by the statement "including a" does not exclude the presence of additional identical elements in the process, method, article or device including the element.

[0119] As used in this specification, the term "about", when used in reference to a value, typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0120] In this specification, certain embodiments can be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and is to be interpreted flexibly to describe all the specifically recited and / or specifically implied values, sub-ranges, etc. of the range. As only a limited number of ranges are explicitly recited, it is understood that all sub-ranges and combinations of ranges are also explicitly recited. For example, a range of 1 to 6 is to be interpreted to include the whole range, all sub-ranges, and individual numbers within the range, e.g., 1 to 6, 1 to 3, 1 to 4, 1 to 5, 1 to 2, 2 to 6, 2 to 4, 2 to 3, 3 to 6, 3 to 4, 4 to 6, 4 to 5, 5 to 6, 1, 2, 3, 4, 5, and 6. The same applies to ranges reciting only end values. For example, a range of 1 to 6 is to be interpreted to include the whole range, all sub-ranges, and individual numbers within the range, e.g., 1 to 6, 1 to 3, 1 to 4, 1 to 5, 1 to 2, 2 to 6, 2 to 4, 2 to 3, 3 to 6, 3 to 4, 4 to 6, 4 to 5, 5 to 6, 1, 2, 3, 4, 5, and 6.

[0121] Example One: Detection of a DNA target

[0122] DNA target: Adenovirus hexon gene

[0123] Upstream primer sequence: CCCTTAAACCAGCTACCAACATG (SEQ ID NO: 1)

[0124] Downstream primer sequence: CTGGTTCCTCAGTTTCAACCCC (SEQ ID NO: 2)

[0125] Probe sequence: CCATGCTACGGGTCTTTTGCAAGACC (SEQ ID NO: 3)

[0126] Upstream interferon sequence: CATGT A G C TAGCTGG-C3 (SEQ ID NO: 4, Tm value: 49.7°C)

[0127] Downstream interferon sequence: GGG C TTGAAAC-C3 (SEQ ID NO: 5, Tm value: 32.1°C)

[0128] wherein the italicized bases represent mismatched bases (i.e., the 6thand 8thbases from the 5’ end to the 3’ end of the nucleotide sequence indicated by SEQ ID NO: 4, the 4thbase from the 5’ end to the 3’ end of the nucleotide sequence indicated by SEQ ID NO: 4), and C3 represents a C3 spacer modification.

[0129] The upstream primer, the upstream interferon, the downstream primer, and the downstream interferon described above were respectively prepared into a concentration of 200 μM with primer diluent (10 mM Tris-HCl (pH 8.8), 150 mM KCl). Then, the upstream primer and the upstream interferon, and the downstream primer and the downstream interferon were mixed in a ratio of 1:1, and then after 1 minute at 94°C, they were left in an environment of 30°C for 20 minutes to obtain the upstream primer-upstream interferon double-stranded structure and the downstream primer-downstream interferon double-stranded structure, and finally stored in a refrigerator at -20°C.

[0130] DNA nucleic acid amplification system (total reaction volume 25 μL):

[0131] upstream primer-upstream interferon double-stranded structure, final concentration: 2 μM;

[0132] downstream primer-downstream interferon double-stranded structure, final concentration: 2 μM;

[0133] probe (diluted with DEPC water), final concentration: 2 μM;

[0134] PCR Buffer: prepared into a concentration of 5x, final concentration 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 2.5 mM MgCl2, 1% Triton-X-100;

[0135] dNTPs: 10 mM;

[0136] DNA polymerase: 5 U;

[0137] DNA template: 5 μL.

[0138] DNA detection amplification conditions:

[0139] Hot start temperature: 94°C, hot start time: 2 min;

[0140] Denaturation temperature: 94°C, denaturation time: 2 s;

[0141] Annealing extension temperature: 53°C, annealing extension time: 20 s.

[0142] In this embodiment, the interference subunit is introduced in the experimental group (i.e. the upstream primer-upstream interference subunit double-stranded structure and the downstream primer-downstream interference subunit double-stranded structure are formed accordingly), and the interference subunit is not introduced in the control group (i.e. only the upstream primer and the downstream primer are used). After the DNA nucleic acid amplification system is prepared as described above, the nucleic acid detection reagents of the experimental group and the control group are placed at 2-8°C for 15 days, and the stability investigation results of the nucleic acid detection reagents of the two groups placed for 0 days and 15 days are compared (in this embodiment, the stability of the nucleic acid detection reagents is evaluated by investigating the Ct value of the positive amplification curve detected by using the corresponding nucleic acid detection reagents).

[0143] The experimental results are shown in Table 2. Figure 1 As shown in Table 2, the CT value of the nucleic acid detection reagent of the control group placed for 0 days for detecting the adenovirus hexon gene DNA target is 27.82, the CT value of the nucleic acid detection reagent of the experimental group placed for 0 days for detecting the adenovirus hexon gene DNA target is 27.57, the CT value of the nucleic acid detection reagent of the control group placed for 15 days for detecting the adenovirus hexon gene DNA target is 31.81, and the CT value of the nucleic acid detection reagent of the experimental group placed for 15 days for detecting the adenovirus hexon gene DNA target is 28.23. It can be seen that the nucleic acid detection reagent prepared by introducing the interference subunit is obviously more stable than the control group without introducing the interference subunit for detecting the DNA target at 2-8°C for 15 days.

[0144] Example Two: Detection of RNA Target

[0145] RNA Target: Influenza A Virus M2 gene

[0146] Upstream primer sequence: TCTTTCTATCATCCCATCAGGCC (SEQ ID NO: 6)

[0147] Downstream primer sequence: GAGGTGACAGGATCGGTCTT (SEQ ID NO: 7)

[0148] Probe sequence: CCTCAAAGCCGAGATCGCGCAGAGAC (SEQ ID NO: 8)

[0149] Upstream interference subunit sequence: GGC GA GATGGG-C3 (SEQ ID NO: 9, Tm value: 39.6°C)

[0150] Downstream interference subunit sequence: AAG U CCGATC-C3 (SEQ ID NO: 10, Tm value: 31.1°C)

[0151] wherein, italic indicates mismatched bases (i.e., 4th, 5thbases from 5' end to 3' end of the nucleotide sequence indicated by SEQ ID NO: 9, 4thbase from 5' end to 3' end of the nucleotide sequence indicated by SEQ ID NO: 10), C3 indicates C3 spacer modification.

[0152] The above upstream primer, upstream interferon, downstream primer, and downstream interferon were each prepared into a concentration of 200 μM with primer diluent (10 mM Tris-HCl (pH 8.8), 150 mM KCl). Then, the upstream primer and the upstream interferon, and the downstream primer and the downstream interferon were mixed in a ratio of 2:1, respectively, and then, after 1 minute at 94°C, they were left in an environment of 20°C for 30 minutes to obtain the upstream primer-upstream interferon double-stranded structure and the downstream primer-downstream interferon double-stranded structure, and finally, they were stored in a -20°C refrigerator.

[0153] RNA nucleic acid amplification system (total reaction volume 25 μL):

[0154] Upstream primer-upstream interferon double-stranded structure, final concentration: 5 μM;

[0155] Downstream primer-downstream interferon double-stranded structure, final concentration: 5 μM;

[0156] Probe (diluted with DEPC water), final concentration: 3 μM;

[0157] PCR Buffer: prepared into a concentration of 5x, final concentration 75 mM Tris-HCl (pH 8.8), 30 mM (NH4)2SO4, 3.0 mM MgCl2, 0.1% Tween 20;

[0158] dNTPs: 30 mM;

[0159] DNA polymerase: 20 U;

[0160] Reverse transcriptase: 100 U;

[0161] RNA template: 5 μL.

[0162] RNA detection amplification conditions:

[0163] Reverse transcription temperature: 48°C, reverse transcription time: 5 min;

[0164] Hot start temperature: 98°C, hot start time: 5 min;

[0165] Denaturation temperature: 98°C, denaturation time: 5 s;

[0166] Annealing extension temperature: 60°C, annealing extension time: 30 s.

[0167] In this example, the interference subunit was introduced in the experimental group (i.e. the upstream primer-upstream interference subunit double-stranded structure and the downstream primer-downstream interference subunit double-stranded structure were formed accordingly), and the interference subunit was not introduced in the control group (i.e. only the upstream primer and the downstream primer were used). After the preparation of the RNA nucleic acid amplification system as described above, the nucleic acid detection reagents of the experimental group and the control group were placed at 2-8°C for 15 days, and the stability investigation results of the nucleic acid detection reagents of the two groups placed for 0 days and 15 days were compared (in this example, the stability of the nucleic acid detection reagents was evaluated by investigating the Ct value of the positive amplification curve detected by using the corresponding nucleic acid detection reagents).

[0168] The experimental results are shown in Table 1. Figure 2 As shown in Table 1, the CT value of the nucleic acid detection reagent of the control group placed for 0 days for detecting the influenza A virus M2 gene RNA target was 27.84, the CT value of the nucleic acid detection reagent of the experimental group placed for 0 days for detecting the influenza A virus M2 gene RNA target was 27.45, the CT value of the nucleic acid detection reagent of the control group placed for 15 days for detecting the influenza A virus M2 gene RNA target was 34.19, and the CT value of the nucleic acid detection reagent of the experimental group placed for 15 days for detecting the influenza A virus M2 gene RNA target was 28.39. It can be seen that the nucleic acid detection reagent prepared by introducing the interference subunit is obviously more stable than the control group without introducing the interference subunit for detecting the RNA target at 2-8°C for 15 days.

[0169] Example Three: Simultaneous detection of DNA target and RNA target

[0170] Double detection of DNA target and RNA target: influenza A virus M2 gene and human β-action gene

[0171] RNA target: influenza A virus M2 gene

[0172] Upstream primer sequence: TCTTTCTATCATCCCATCAGGCC (SEQ ID NO: 6)

[0173] Downstream primer sequence: GAGGTGACAGGATCGGTCTT (SEQ ID NO: 7)

[0174] Probe sequence: CCTCAAAGCCGAGATCGCGCAGAGAC (SEQ ID NO: 8)

[0175] Upstream interference subunit sequence: GGC GA GATGGG-C3 (SEQ ID NO: 9, Tm value: 39.6°C)

[0176] Downstream interferon sequence: AAG U CCGATC-C3 (SEQ ID NO: 10, Tm value: 31.1°C)

[0177] wherein, italicized indicates a mismatched base (i.e., 4th and 5th bases from the 5' end to the 3' end of the nucleotide sequence indicated by SEQ ID NO: 9, 4th base from the 5' end to the 3' end of the nucleotide sequence indicated by SEQ ID NO: 10), and C3 indicates a C3 spacer modification.

[0178] DNA target: human β-action gene

[0179] Upstream primer sequence: AACGAGCGGTTCCGCTGT (SEQ ID NO: 11)

[0180] Downstream primer sequence: TGGATGCCACAGGACTCC (SEQ ID NO: 12)

[0181] Probe: TCTTCCAGCCTTCCTTCCTGGGCAA (SEQ ID NO: 13)

[0182] Upstream interferon: ACA CG GGAAC-C3 (SEQ ID NO: 14, Tm value: 30.3°C)

[0183] Downstream interferon: GGAG A CCTGTGG-C3 (SEQ ID NO: 15, Tm value: 39.8°C)

[0184] wherein, italicized indicates a mismatched base (i.e., 4th and 5th bases from the 5' end to the 3' end of the nucleotide sequence indicated by SEQ ID NO: 14, 5th base from the 5' end to the 3' end of the nucleotide sequence indicated by SEQ ID NO: 15), and C3 indicates a C3 spacer modification.

[0185] The upstream primer, upstream interferon, downstream primer, and downstream interferon corresponding to the influenza A virus M2 gene and human β-action gene were each prepared to a concentration of 200 μΜ using primer diluent (10 mM Tris-HCl (pH 8.8), 150 mM KCl). Then, the upstream primer and the upstream interferon, and the downstream primer and the downstream interferon were each mixed in a 1:2 ratio by weight, and then, after 2 minutes at 94°C, were left to stand in an environment of 20°C for 30 minutes, to obtain a double-stranded structure of the upstream primer-upstream interferon and a double-stranded structure of the downstream primer-downstream interferon, and were finally stored in a -20°C refrigerator.

[0186] Nucleic acid amplification system (total reaction volume 25 μL):

[0187] Upstream primer-upstream interferon double-stranded structure, final concentration: 10 μM;

[0188] Downstream primer-downstream interferon double-stranded structure, final concentration: 10 μM;

[0189] Probe (diluted with DEPC water), final concentration: 5 μM;

[0190] PCR Buffer: prepared as 5x concentration, final concentration 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 5 mM (NH4)2SO4, 2.0 mM MgCl2;

[0191] dNTPs: 50 mM;

[0192] DNA polymerase: 20 U;

[0193] Reverse transcriptase: 300 U;

[0194] Total template: 5 μL.

[0195] DNA target and RNA target detection amplification conditions:

[0196] Reverse transcription temperature: 55℃, reverse transcription time: 30 min;

[0197] Hot start temperature: 94℃, hot start time: 10 min;

[0198] Denaturation temperature: 94℃, denaturation time: 10 s;

[0199] Annealing extension temperature: 60℃, annealing extension time: 40 s.

[0200] In this embodiment, the interferon is introduced in the experimental group (i.e. the upstream primer-upstream interferon double-stranded structure and the downstream primer-downstream interferon double-stranded structure are formed accordingly), and the control group does not introduce the interferon (i.e. only the upstream primer and the downstream primer are used). After preparing the nucleic acid amplification system as described above, the nucleic acid detection reagents of the experimental group and the control group are placed at -20℃ for 13 months, and the stability investigation results of the nucleic acid detection reagents placed for 0 months and 13 months are compared (in this embodiment, the stability of the nucleic acid detection reagent is evaluated by investigating the Ct value of the positive amplification curve detected by using the corresponding nucleic acid detection reagent).

[0201] The experimental results are as follows: Figure 3 and Figure 4As shown, the CT value of the nucleic acid detection reagent of the control group placed for 0 month for detecting the human β-action gene DNA target is 28.01, the CT value of the nucleic acid detection reagent of the experimental group placed for 0 month for detecting the human β-action gene DNA target is 27.72, the CT value of the nucleic acid detection reagent of the control group placed for 13 months for detecting the human β-action gene DNA target is 35.58, and the CT value of the nucleic acid detection reagent of the experimental group placed for 13 months for detecting the human β-action gene DNA target is 28.58. The CT value of the nucleic acid detection reagent of the control group placed for 0 month for detecting the influenza A virus M2 gene RNA target is 28.61, the CT value of the nucleic acid detection reagent of the experimental group placed for 0 month for detecting the influenza A virus M2 gene RNA target is 28.29, the CT value of the nucleic acid detection reagent of the control group placed for 13 months for detecting the influenza A virus M2 gene RNA target is 37.93, and the CT value of the nucleic acid detection reagent of the experimental group placed for 13 months for detecting the influenza A virus M2 gene RNA target is 28.84. Thus, it can be seen that the nucleic acid detection reagent prepared by introducing the interference substance is obviously more stable than the control group without introducing the interference substance for detecting the DNA target and the RNA target at -20℃ for 13 months.

[0202] The embodiments of the present application are described above in combination with the drawings, but the present application is not limited to the above-described specific embodiments, and the above-described specific embodiments are merely illustrative but not restrictive. Those skilled in the art can make many forms under the inspiration of the present application without departing from the purpose of the present application and the scope protected by the claims, and these are all within the protection of the present application.

Claims

1. A fully pre-mixed nucleic acid detection reagent, characterized by, The full premix nucleic acid detection reagent at least comprises the following components: (a) a buffer; (b) a combination of DNA polymerase and reverse transcriptase; (c) a primer for detecting a target nucleic acid, the primer comprising an upstream primer and a downstream primer; (d) a probe for detecting the target nucleic acid; wherein the target nucleic acid is an influenza A virus M2 gene; the primer has a primer double-stranded structure; the primer double-stranded structure comprises a first strand and a second strand, the first strand is used for specific binding with the target nucleic acid, the second strand is substantially complementary to the first strand, the second strand has a base mismatch with the first strand; the first strand is longer than the second strand, the first strand and the second strand differ by at least 5 bases, and the second strand has a Tm value of 30-40℃; the 3' end of the second strand is a non-extendable nucleotide; The primer for detecting the target nucleic acid specifically comprises: a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, and the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown as SEQ ID NO:

8.

2. The nucleic acid detection reagent of claim 1, wherein The target nucleic acid is an influenza A virus M2 gene and a human β-action gene; The primer for detecting the target nucleic acid specifically comprises: a third primer, a fourth primer, a fifth primer, and a sixth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, and the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10; the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; the nucleotide sequence of the third upstream primer is shown as SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown as SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown as SEQ ID NO: 14, and the nucleotide sequence of the third downstream interferon is shown as SEQ ID NO: 15; The probe for detecting the target nucleic acid comprises a second probe and a third probe, the nucleotide sequence of the second probe is shown as SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown as SEQ ID NO:

13.

3. Use of a primer duplex structure in improving the storage stability of a nucleic acid detection reagent, characterized in that, The nucleic acid detection reagent at least comprises the following components: (a) a buffer; (b) a combination of DNA polymerase and reverse transcriptase; (c) primers for detecting the target nucleic acid, the primers comprising an upstream primer and a downstream primer; (d) a probe for detecting the target nucleic acid; wherein the target nucleic acid is an influenza A virus M2 gene; the primers have a primer double-stranded structure; the primer double-stranded structure comprises a first strand and a second strand, the first strand is used for specific binding with the target nucleic acid, the second strand is substantially complementary to the first strand, the second strand has base mismatches with the first strand; the first strand is longer than the second strand, the first strand and the second strand differ by at least 5 bases, the Tm value of the second strand is 30-40℃; the 3' end of the second strand is a non-extendable nucleotide; The primers for detecting the target nucleic acid specifically comprise a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10, and the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown as SEQ ID NO:

8.

4. Use according to claim 3, characterized in that, The target nucleic acid is an influenza A virus M2 gene and a human beta-action gene; The third primer has a second upstream primer-second upstream interferon double-stranded structure, the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second downstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream interferon is shown as SEQ ID NO: 9, the nucleotide sequence of the second downstream interferon is shown as SEQ ID NO: 10, the fifth primer has a third upstream primer-third upstream interferon double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferon double-stranded structure; wherein the nucleotide sequence of the third upstream primer is shown as SEQ ID NO: 11, the nucleotide sequence of the third downstream primer is shown as SEQ ID NO: 12, the nucleotide sequence of the third upstream interferon is shown as SEQ ID NO: 14, and the nucleotide sequence of the third downstream interferon is shown as SEQ ID NO: 15; The probe for detecting the target nucleic acid comprises a second probe and a third probe, the nucleotide sequence of the second probe is shown as SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown as SEQ ID NO: 13.

Images