Primers for identifying rough strain rm101 of sheep species and method and application thereof
By designing specific primers for the sheep breed rough RM101 strain, and using PCR amplification and sequencing analysis, a rapid and low-cost identification of the RM101 strain was achieved, solving the problem of the lack of effective vaccines and identification methods in existing technologies, and supporting brucellosis prevention and control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING KEMUFENG BIOLOGICAL PHARMA
- Filing Date
- 2025-02-24
- Publication Date
- 2026-06-19
AI Technical Summary
Existing technologies have failed to effectively develop safe and effective brucellosis vaccines, especially for the prevention of brucellosis in cattle and sheep, and there is a lack of methods for rapid identification of the sheep breed rough RM101 strain.
Specific primers were designed to target the SNP sites of the glycosyltransferase genes BMEI0997 and BMEI0998 in the sheep rough RM101 strain, and rapid identification was achieved through PCR amplification and sequencing analysis.
This provides an easy-to-operate, low-cost, and short-cycle method that can identify RM101 strain from other Brucella strains within two days, solving the problem of identifying the rough RM101 strain in sheep and indirectly solving the problem of differential diagnosis after vaccination, thus supporting the promotion and use of Brucellosis control technologies.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, specifically to a primer, method, and application for identifying the rough RM101 strain of sheep. Background Technology
[0002] Brucellosis, also known as undulant fever, Mediterranean fever, or Maltese fever, is a zoonotic infectious disease. There are several species of Brucella, including sheep, cattle, pigs, dogs, sheep epididymis, and sarin rats.
[0003] The World Organisation for Animal Health (WOAH) has reported that brucellosis is one of the most easily overlooked diseases, and in cases of severe brucellosis outbreaks, vaccination is the only effective control option. Since the early 20th century, researchers have never given up on developing suitable vaccines for brucellosis control, but to date, no truly ideal brucellosis vaccine has been found.
[0004] A live brucellosis vaccine made from the sheep rough strain RM101 has shown in preliminary experiments to be 80 times safer than existing vaccines. It effectively prevents brucellosis in cattle and sheep, can be injected into pregnant animals without causing abortion, and does not produce antibodies that interfere with diagnosis. This vaccine has enormous market potential. Therefore, developing a rapid and effective method to identify the sheep rough strain RM101 is an urgent problem to be solved. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides primers for identifying the rough RM101 strain of sheep breeds, the primer sequence of which is:
[0006] Primer 1:
[0007] RM-1-F (SEQ ID NO.1): 5'-ATGAATAAGCTCGGGCGTGTTTA-3';
[0008] RM-1-R (SEQ ID NO.2): 5'-CTAGTCTGCAACAGATTTAA-3';
[0009] and / or
[0010] Primer 2:
[0011] RM-2-F (SEQ ID NO.3): 5'-GCGTAAACCATCTCGCGAAC-3';
[0012] RM-2-R (SEQ ID NO.4): 5'-CGGCACGTACTGCCAATCTA-3';
[0013] The sheep-type Brucella RM101 strain described in this invention was deposited by the China General Microbiological Culture Collection Center on September 16, 2022, with accession number CGMCC No. 25728.
[0014] Furthermore, the PCR amplification sequence of primer 1 is shown in SEQ ID NO.5.
[0015] Furthermore, the PCR amplification sequence of primer 2 is shown in SEQ ID NO.6.
[0016] The present invention also provides a kit containing primers for identifying the rough RM101 strain of sheep.
[0017] The present invention also provides the application of the primers described herein in identifying the rough RM101 strain of sheep breed.
[0018] The present invention also provides the application of the kit in identifying the rough RM101 strain of sheep.
[0019] This invention also provides a method for identifying the rough RM101 strain of sheep breed, comprising the following steps:
[0020] (1) Extract DNA from the rough-type sheep strain RM101;
[0021] (2) Perform PCR amplification using the primers described in claim 1;
[0022] (3) Sequencing and sequence alignment analysis of the PCR products.
[0023] Furthermore, the above PCR amplification system is as follows: Mix 12.5 μl, H2O 8.5 μl, RM-1-F / RM-2-F 1 μl; RM-1-R / RM-2-R 1 μl, DNA template 2 μl.
[0024] Furthermore, the above PCR amplification program is as follows: denaturation at 95 ℃ for 5 min; 30 cycles of 95 ℃ for 30 s, 56 ℃ for 30 s, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.
[0025] The beneficial effects of this invention are:
[0026] The technical solution adopted in this invention is to perform SNP analysis on the whole genome of RM101 strain and the whole genomes of Brucella aurea, veterinary aurea, and bovine aurea. One SNP site was found in each of the BMEI0997 and BMEI0998 glycosyltransferase genes. A pair of primers was designed for each SNP site interval. Then, DNA of the rough RM101 strain from veterinary aurea and DNA of strains including but not limited to veterinary aurea, veterinary aurea, veterinary aurea, and veterinary aurea were extracted and PCR amplified to obtain specific bands of 1560 bp of the BMEI0997 gene and 304 bp of the BMEI0998 gene. Sequence comparison showed that RM101 strain had point mutations at specific sites in the BMEI0997 and BMEI0998 genes compared with other strains, thus distinguishing RM101 strain from other strains.
[0027] The identification method provided by this invention is easy to operate, low in cost, and quick to complete, taking only two days. This invention solves the problem of differentiating the sheep breed rough RM101 strain from other Brucella strains, indirectly addressing the identification and diagnosis problem after RM101 vaccine production, facilitating its wider application and providing support for brucellosis control technology and research. Attached Figure Description
[0028] Figure 1 Electrophoresis image of PCR amplification of BMEI0997 fragment, where M: Marker; 1: RM101 strain; 2: 2308 strain; 3: RM6 / 66 strain; 4: A19 strain; 5: S2 strain; 6: 16M strain; 7: M28 strain.
[0029] Figure 2 Electrophoresis image of PCR amplification of BMEI0998 fragment, where M: Marker; 1: RM101 strain; 2: 2308 strain; 3: RM6 / 66 strain; 4: A19 strain; 5: S2 strain; 6: 16M strain; 7: M28 strain.
[0030] Figure 3 This is a sequence alignment diagram of the glycosyltransferase gene BMEI0997.
[0031] Figure 4 This is a sequence alignment diagram of the glycosyltransferase gene BMEI0998. Detailed Implementation
[0032] The following examples are for further illustration of this patent and do not constitute a limitation thereof. Unless otherwise specified, all reagents used in the examples can be purchased commercially. The sheep strain RM101 is a proprietary strain of our company, which was deposited by the China General Microbiological Culture Collection Center on September 16, 2022, with accession number CGMCC No. 25728. The pig strain S2, cattle strain A19, cattle strain 2308, sheep strain M28, sheep strain 16M, and dog strain RM6 / 66 used were all provided and preserved by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences.
[0033] Example 1: Whole genome sequencing of Brucella aegyptiaca strain RM101.
[0034] Bacteria were streaked onto TSA plates and incubated at 37°C for 72 hours. Single colonies were picked and inoculated into 5 ml of TSB medium, incubated at 37°C for 48 hours, and then inactivated by water bath at 80°C for 1 hour before sequencing. Whole genome sequencing and sequence assembly were performed by Biomarker Biotechnology Co., Ltd. After genome assembly, the results showed that the whole genome length of RM101 was 3361521 bp.
[0035] Example 2: Determination of the target gene
[0036] The whole genome sequences of RM101 strain and three Brucella strains (sheep strain M28, canine strain RM6 / 66, and bovine strain 2308) were aligned using Mummer software. The SNP, INDEL, and SV information for each sample was extracted using Syri software. Sites that were unique to RM101 strain compared to the other three samples were extracted. The target genes were ultimately identified as glycosyltransferases BMEI0997 and BMEI0998. The gene sequence of glycosyltransferase BMEI0997 is shown in SEQ ID NO. 5, and the gene sequence of glycosyltransferase BMEI0998 is shown in SEQ ID NO. 6.
[0037] Example 3 Design of Specific Primers
[0038] Primers were designed at the conserved regions at both ends of the SNPs in the glycosyltransferase genes BMEI0997 and BMEI0998, respectively. The primer sequence designed for the BMEI0997 gene is as follows:
[0039] RM-1-F (SEQ ID NO.1): 5'-ATGAATAAGCTCGGGCGTGTTTA-3'
[0040] RM-1-R (SEQ ID NO.2): 5'-CTAGTCTGCAACAGATTTAA-3'
[0041] The primer sequences designed for the BMEI0998 gene are as follows:
[0042] RM-2-F (SEQ ID NO.3): 5'-GCGTAAACCATCTCGCGAAC-3'
[0043] RM-2-R (SEQ ID NO.4): 5'-CGGCACGTACTGCCAATCTA-3'
[0044] Example 4: Extraction of bacterial DNA
[0045] Take 1 ml of bacterial culture (RM101 strain, S2 strain, A19 strain, 2308 strain, M28 strain, 16M strain, RM6 / 66 strain) into a 1.5 ml centrifuge tube, centrifuge at 13000g for 2 minutes to collect bacterial cells, and discard the supernatant; add 600 μl of nuclear lysis buffer and resuspend; incubate at 80℃ for 5 minutes, then cool to room temperature; add 3 μl of RNase solution to the bacterial lysis buffer and mix by inversion; incubate at 37℃ for 15-60 minutes, then cool to room temperature; add 200 μl of precipitate and shake for 20 seconds to mix thoroughly, incubate on ice for 5 minutes, and centrifuge at 13000g for 3 minutes; transfer the supernatant to a clean 1.5 ml centrifuge tube containing 600 μl of isopropanol and mix by inversion; centrifuge at 13000g for 2 minutes; discard the supernatant, invert the centrifuge tube onto clean absorbent paper, and then add 600 μl of isopropanol... Centrifuge at 13000g for 2 minutes with 70% ethanol; invert the centrifuge tube on clean absorbent paper and let it air dry for 10-15 minutes, then dissolve it in an appropriate amount of deionized water.
[0046] Example 5 PCR Amplification
[0047] DNA extracted from strains RM101, S2, A19, 2308, M28, 16M, and RM6 / 66 was subjected to PCR. The PCR system was as follows: Mix 12.5 μl, H2O 8.5 μl, RM-1-F / RM-2-F 1 μl, RM-1-R / RM-2-R 1 μl, and DNA template 2 μl.
[0048] The PCR program was as follows: denaturation at 95℃ for 5 min; 30 cycles of denaturation at 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 1 min; extension at 72℃ for 10 min.
[0049] Example 6: Electrophoretic analysis of PCR products, followed by sequencing analysis.
[0050] Electrophoresis results showed that all strains amplified a specific band of 1560 bp for the glycosyltransferase BMEI0997, and also a specific band of 304 bp for the BMEI0998 gene. The results are as follows... Figure 1 , Figure 2 As shown.
[0051] PCR products from several strains were sequenced, and the sequences were compared. The sequencing results of the BMEI0997 gene for strains RM101, 16M, M28, 2308, RM6 / 66, A19, and S2 are shown in SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, and SEQ ID NO. 17. The sequencing results of the BMEI0998 gene for strains RM101, 16M, M28, 2308, RM6 / 66, A19, and S2 are shown in SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, and SEQ ID NO. 18.
[0052] The results are as follows Figure 3 , Figure 4 As shown. Figure 3 RM666 refers to RM6 / 66 plants. Figure 4 Zhong 66 is RM6 / 66.
[0053] At position 1104 of the BMEI0997 glycosyltransferase gene, strain RM101 has a C base, strain M28 has a T base, and the rest have G bases. At position 294 of the BMEI0998 glycosyltransferase gene, strain RM101 has a T base, and the rest have a C base.
[0054] The results above show that RM101 strain has mutated bases at position 1104 of the glycosyltransferase BMEI0997 gene and position 294 of the MEI0998 gene. These mutated sites can be used to distinguish RM101 strain from other Brucella strains.
[0055] SEQ ID NO.5 >RM101 strain:
[0056]
[0057] SEQ ID NO.7 > 16M shares:
[0058]
[0059] SEQ ID NO.9 > M28 stock:
[0060]
[0061] SEQ ID NO.11 > 2308 shares:
[0062]
[0063] SEQ ID NO.13 >RM6 / 66 stocks:
[0064]
[0065] SEQ ID NO.15 >A19 strain:
[0066]
[0067] SEQ ID NO.17 > S2 stock:
[0068]
[0069] SEQ ID NO.6 > RM101 strain:
[0070] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCTCGCGCATTAAGAGTAGACACGGGAAATCAGT
[0071] SEQ ID NO.8 > 16M strain:
[0072] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACTTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT
[0073] SEQ ID NO.10 > M28 strain:
[0074] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT
[0075] SEQ ID NO.12 > Strain 2308:
[0076] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT
[0077] SEQ ID NO.14 > Strain RM6 / 66:
[0078] AGTCGCGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT
[0079] SEQ ID NO.16 > A19 strain:
[0080] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT
[0081] SEQ ID NO.18 > S2 strain:
[0082] AGTCACGGTTTTTATAGCCAAGCTCAGGACATTTTGGTTAATGGTCTGATATCACGTGATAATGGCGGAAGGGGGTACGTTGCAGAGGGTTCAGCAGGGTCATCTCTCCTAAATGGGGCCGTTTTCAGAGATAATGTAGCAGGGAATTATTTTACAGGAGGGACAAGCGTAAACCATCTCGCGAACCTCCAACTTCATAACTCTAGCACCGGGGGGAAAACTTTTGTGGCCAATGTCACCACAAATGGGTCTGCATAACGGTCCTTGCCATTTTAACTATAAATGAGCTATTCCCGCGCATTAAGAGTAGACACGGGAAATCAGT。
Claims
1. Use of primers for identifying Ovis aries rough strain RM101 with the preservation number of CGMCC No. 25728 in the preparation of identification reagents, characterized in that, The primers are capable of amplifying the target region containing nucleotide 1104 of the sequence shown in SEQ ID NO:5 and / or the target region containing nucleotide 294 of the sequence shown in SEQ ID NO:
6. The application includes the following steps: (a) extracting DNA from the test strain; (b) performing PCR amplification on the DNA from step (a) using the primers; (c) sequencing the amplification product from step (b); and (d) analyzing the sequencing results to determine whether the 1104th base in the sequence shown in SEQ ID NO:5 is C, and / or whether the 294th base in the sequence shown in SEQ ID NO:6 is T. Specifically, when the 1104th base in the sequence shown in SEQ ID NO:5 is C and / or the 294th base in the sequence shown in SEQ ID NO:6 is T, the tested strain is identified as Brucella ramosis RM101 strain.
2. The application according to claim 1, characterized in that, The reagent is a kit.
3. A method for identifying the rough-type RM101 strain of sheep breed with preservation number CGMCC No. 25728, characterized in that, Includes the following steps: (1) Extract DNA from the rough-type sheep strain RM101; (2) Determine the target detection region, wherein the target detection region is: the target region containing the nucleotide at position 1104 in the sequence shown in SEQ ID NO:5 and / or the target region containing the nucleotide at position 294 in the sequence shown in SEQ ID NO:6; (3) Design or select corresponding primers for the target detection region determined in step (2), and use the primers to perform PCR amplification on the DNA extracted in step (1) to obtain an amplification product containing the target detection region; (4) Sequencing analysis is performed on the amplification product obtained in step (3). By analyzing the sequencing results, it is determined whether the 1104th base of the sequence shown in SEQ ID NO.5 is C, and / or whether the 294th base of the sequence shown in SEQ ID NO.6 is T. If the 1104th base is C, and / or the 294th base is T, then the test strain is determined to be Brucella ramosis RM101 strain with preservation number CGMCC No. 25728.
4. The method according to claim 3, characterized in that, The PCR amplification system consisted of: 12.5 μl Mix, 8.5 μl H2O, 1 μl RM-1-F / RM-2-F, 1 μl RM-1-R / RM-2-R, and 2 μl DNA template.
5. The method according to claim 3, characterized in that, The PCR amplification program was as follows: denaturation at 95 ℃ for 5 min; 30 cycles of denaturation at 95 ℃ for 30 s, 56 ℃ for 30 s, and 72 ℃ for 1 min; extension at 72 ℃ for 10 min.