Application of menRNA in screening and / or preparing drugs for treating remodeling trabecular meshwork tissue injury

Abstract

The present invention provides the application of menRNA in screening and / or preparing drugs for treating the damage of trabecular meshwork tissue remodeling, and the sequence of the menRNA is shown as SEQ ID NO.1. Through comparison, it is first discovered in the present invention that the expression level of menRNA in iPSC-TM cells is significantly higher than that in pTM cells. Further experiments confirm that overexpression of menRNA has the function of promoting the assembly of paraspeckles, and plays a role in promoting cell proliferation and cell reprogramming, laying a foundation for subsequent research on the diagnosis and treatment methods of primary open-angle glaucoma and exploring the pathogenesis of primary open-angle glaucoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection and treatment, and particularly relates to the application of menRNA in screening and / or preparing drugs for treating trabecular meshwork tissue injury remodeling. Background Art

[0002] Glaucoma is an ophthalmic disease that causes visual loss due to apoptosis of retinal ganglion cells, and is the second leading cause of blindness after cataract (Weinreb RN, Khaw PT. Primary open-angle glaucoma. Lancet. 2004 May 22;363(9422):1711-20. doi: 10.1016 / S0140-6736(04)16257-0. PMID: 15158634.). Glaucoma has become a major public health issue of global concern. As of 2020, the number of glaucoma patients in China reached 21 million, bringing a huge economic burden to Chinese society and the families of patients (Quigley HA, Broman AT. The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 2006 Mar;90(3):262-7. doi: 10.1136 / bjo.2005.081224. PMID: 16488940; PMCID: PMC1856963.). Global epidemiological statistics show that primary open angle glaucoma (POAG) is the main type of glaucoma (Tham YC, Li X, Wong TY, Quigley HA, Aung T, Cheng CY. Global prevalence of glaucoma and projections of glaucoma burden through 2040: a systematic review and meta-analysis. Ophthalmology. 2014 Nov;121(11):2081-90. doi: 10.1016 / j.ophtha.2014.05.013. Epub 2014 Jun 26. PMID: 24974815.). With the development of China's social economy, due to population aging and the improvement of detection accuracy, the proportion of patients with primary open angle glaucoma has been increasing year by year and has become the main type of glaucoma in China.

[0003] Aqueous humor (AH) is produced by the ciliary body, flows into the anterior chamber through the gap between the iris and the lens, and is discharged from the eye through the aqueous humor drainage pathway. The aqueous humor drainage pathway mainly includes the trabecular meshwork (TM) pathway and the uveoscleral pathway. 80-90% of the aqueous humor drainage depends on the TM pathway, mainly concentrated in the sieve plate-like trabecular meshwork tissue and the endothelial cell layer of Schlemm's canal located at the base of the cornea and adjacent to the ciliary body. The maintenance of the trabecular meshwork tissue function plays a crucial role in the aqueous humor circulation and intraocular pressure balance. However, along with the aging process and the development of primary open-angle glaucoma, the trabecular meshwork tissue structure and function are damaged to varying degrees, and the number of trabecular meshwork cells decreases significantly, resulting in reduced AH outflow and increased intraocular pressure (IOP), ultimately leading to cell stress, dysfunction, and death of retinal ganglion cells, thus causing vision loss.

[0004] Among the many pathogenic factors of primary open-angle glaucoma, a key risk factor for TM dysfunction is gene mutation. Therefore, gene therapy brings hope for the treatment of TM dysfunction. Given the physiological and anatomical characteristics of TM tissue, gene therapy has great application prospects: (i) The eye has immune privilege characteristics, (ii) The TM tissue is located at the limbus corneae, and due to the transparency of the cornea, the TM tissue is clearly visible. The above advantages facilitate the possibility of gene therapy to reshape TM tissue. Means such as the regulation of the extracellular matrix, cytoskeleton, and cell volume have all achieved a reduction in intraocular pressure in various glaucoma animal models. Nevertheless, the gene therapy targets for TM tissue remodeling are extremely limited.

[0005] Long non-coding RNA nuclear paraspeckle assembly transcript 1 (NEAT1), as a "structural RNA", is an essential RNA molecule for the formation of nuclear substructures. Human NEAT1 contains two transcriptional isoforms: NEAT1_1 (3.7 kb) and NEAT1_2 (23 kb). Among them, NEAT1_2 is the structural scaffold of nuclear paraspeckles. Nuclear paraspeckles are assembled by NEAT1_2 and the RNA-binding proteins it recruits (including NONO, SFQP, FUS, TDP43, etc.). Nuclear paraspeckles drive liquid-liquid phase separation to form a dynamic, membrane-less, stratified cell nucleus. Research shows that nuclear paraspeckles are involved in the occurrence and development of various diseases such as viral infections, neurodegenerative diseases, autoimmune diseases, inflammatory diseases, and cancers.

[0006] NEAT1_2 matures in the nucleus. Its 3'-end mimics the tRNA-like structure, recruiting RNase P to cleave and generate menRNA. Subsequently, ELAC2 (RNase Z) cleaves the 3'-tail of menRNA, and the CCA-adding enzyme adds a 3'-CCA tail to menRNA. The addition of two rounds of CCACCA recruits exonuclease A, causing the intracellular degradation of menRNA. Although menRNA faces the fate of being rapidly degraded in the nucleus, it has been reported that menRNA escaping into the cytoplasm has unique functions, such as innate immune regulation. However, there is still no research and report on the role of menRNA in primary open-angle glaucoma, especially in the TM tissue, in the prior art. Summary of the Invention

[0007] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide the application of menRNA in screening and / or preparing drugs for treating trabecular meshwork tissue damage. The present invention first discovers by comparison that the expression level of menRNA in iPSC-TM cells is significantly higher than that in pTM cells. Further experiments confirm that the overexpression of menRNA has the function of promoting the assembly of paraspeckles, playing a role in promoting cell proliferation and cell reprogramming, laying a foundation for subsequent research on the diagnosis, treatment methods of primary open-angle glaucoma and exploring the pathogenesis of primary open-angle glaucoma.

[0008] The purpose of the present invention is achieved by the following technical solutions:

[0009] The first aspect of the present invention provides the application of a reagent for detecting the expression level of menRNA in screening drugs for remodeling trabecular meshwork tissue, wherein the sequence of the menRNA is as shown in SEQ ID NO. 1:

[0010] GGCGCUGGUGGUGGCACGUCCAGCACGGCUGGGCCGGGGUUCGAGUCCCCGCAGUGUUG.

[0011] Furthermore, the method for screening drugs for remodeling trabecular meshwork tissue includes:

[0012] 1) Treat a system expressing and / or containing menRNA with a candidate substance; set a parallel control without treating with the candidate substance;

[0013] 2) After completing step 1), detect the expression level of menRNA in the system; compared with the parallel control, if the expression level of menRNA in the system treated with the candidate substance is significantly increased, the candidate substance can be used as a candidate drug for remodeling trabecular meshwork tissue.

[0014] The second aspect of the present invention provides the application of a biomaterial overexpressing menRNA in the preparation of a drug for treating trabecular meshwork tissue injury, wherein the sequence of the menRNA is as shown in SEQ ID NO. 1.

[0015] Furthermore, detect the expression level of menRNA in the biomaterial. When menRNA is overexpressed, it is determined that the biomaterial can be used to prepare a drug for remodeling trabecular meshwork tissue.

[0016] The third aspect of the present invention provides the application of menRNA in the preparation of a drug for treating trabecular meshwork tissue injury, wherein the sequence of the menRNA is as shown in SEQ ID NO. 1.

[0017] Furthermore, the drug is one or more of the following:

[0018] (1) The drug can promote the high expression of menRNA in trabecular meshwork tissue cells;

[0019] (2) The drug can promote the assembly of paraspeckles, and further promote the proliferation and reprogramming of trabecular meshwork tissue cells. [[ID=--]]

[0020] The fourth aspect of the present invention provides a drug for remodeling trabecular meshwork tissue, wherein the drug can promote the expression of menRNA in trabecular meshwork tissue cells.

[0021] Furthermore, the drug includes menRNA and its transcription agent. Preferably, the transcription agent is Lipofectamine TM 3000-menRNA.

[0022] The beneficial effects of the present invention compared with the prior art are as follows:

[0023] 1. For the first time, by constructing Lipofectamine TM 3000-menRNA, it is found that overexpression of menRNA can promote the formation of paraspeckles and the high expression of the proliferation marker protein Ki-67, suggesting the important role of the menRNA-Ki-67 signaling pathway in promoting the proliferation of trabecular meshwork cells. Overexpression of menRNA can promote the proliferation of TM cells and remodel TM tissue, laying a theoretical foundation for screening drugs for remodeling trabecular meshwork tissue.

[0024] 2. For the first time, it is found that Lipofectamine TM 3000-menRNA stimulates the primary TM cells to highly express stem cell and neural crest cell markers, and the cell morphology changes. The rejuvenation of TM cells plays a key role in remodeling trabecular meshwork tissue. Brief Description of the Drawings

[0025] The present invention will be further described below in conjunction with the accompanying drawings and embodiments:

[0026] Figure 1 Immunofluorescence images of ITGA6 and NONO (marking paraspeckles) proteins in iPSC-TM cells and pTM cells described in Example 1, and violin plots of paraspeckle quantification, scale bar: 10 μm;

[0027] Figure 2 Bar graph of menRNA degradation efficiency in iPSC-TM cells and pTM cells;

[0028] Figure 3 Bar graph of the fold change in menRNA mRNA expression levels in pTM cells after transfection with menRNA and control for 12 h, 24 h, 36 h, and 48 h;

[0029] Figure 4 Immunofluorescence images of NONO (marking paraspeckles) protein in pTM cells after transfection with menRNA and control for 12 h and 48 h, and violin plots of paraspeckle quantification, scale bar: 10 μm;

[0030] Figure 5 Immunofluorescence images of pTM cells (DAPI staining for nuclei) after transfection with menRNA and control for 48 h, and bar graph of pTM cell quantification, scale bar: 100 μm;

[0031] Figure 6 Bar graph of the fold change in mRNA expression levels of stem cell markers and cell proliferation markers in pTM cells after transfection with menRNA and control for 12 h, 24 h, 36 h, and 48 h;

[0032] Figure 7 Bar graph of the fold change in mRNA expression levels of stem cell markers and neural crest cell markers in pTM cells after transfection with menRNA and control for 12 h, 24 h, 36 h, and 48 h;

[0033] Figure 8 Morphological change diagrams of pTM cells after transfection with menRNA and control for 12 h and 48 h, scale bar: 100 μm. Detailed implementation manners

[0034] To better understand the present invention, the present invention will be further described in detail below in conjunction with the accompanying drawings, so that those skilled in the art can implement it with reference to the description.

[0035] It should be noted that the experimental methods described in the following specific embodiments are all conventional methods unless otherwise specified, and the reagents and materials described can be obtained from commercial sources unless otherwise specified.

[0036] The main reagents and materials in the following embodiments include:

[0037] NONO antibody: NONO Antibody (NOVUS, NB100-1556);

[0038] ITGA6 antibody: ITGA6 monoclonal antibody (Abcam, ab20142);

[0039] menRNA: Tsingke Biological;

[0040] The basal medium used for cell culture in the examples: MEM-α basic medium.

[0041] Primary TM cells (pTM cells) are TM cells isolated from normal human eye donors and can be purchased commercially. The pTM cells in the examples are from Lion Eye Bank in the United States.

[0042] iPSC-TM cells (TM cells differentiated from induced pluripotent stem cells): The preparation process refers to Zhu W et al., Transplantation of iPSC-TM stimulates division of trabecular meshwork cells in human eyes. Sci Rep. 2020 Feb 19;10(1):2905. doi: 10.1038 / s41598-020-59941-0. PMID: 32076077; PMCID: PMC7031365. This literature evaluated whether transplantation of induced pluripotent stem cell-derived TM-like cells (iPSC-TM cells) could restore the structure and function of human eye TM cells obtained from elderly donors. The study showed that transplantation of iPSC-TM cells could stimulate the proliferation of endogenous TM cells. Example 1

[0043] In this example, the expression levels of paraspeckles in the nuclei of iPSC-TM cells and pTM cells were quantitatively analyzed respectively.

[0044] (1) Experimental method:

[0045] Respectively, 1×10 4iPSC-TM cells and pTM cells were seeded in 14 mm cell culture inserts. 100 μL of MEM-α basic medium containing 10% serum was added to each cell culture insert, and the cells were cultured in an incubator at 37 °C and 5% CO2 for 48 h. The culture media of iPSC-TM cells and pTM cells were taken out from the CO2 incubator, and the cell supernatant was aspirated. The cells were washed 3 times with 1×PBS buffer for 5 min each time; the cells were fixed with 4% paraformaldehyde for 15 min; the cells were washed 3 times with 1×PBS buffer for 5 min each time, and 200 μL of 0.3% Tritonx-100 was added to each cell culture insert and incubated at room temperature for 5 min; the 0.3% Tritonx-100 was aspirated, and 200 μL of blocking solution (1% BSA solution containing 0.3% Tritonx-100) was added to each cell culture insert and incubated at room temperature for 1 h; the primary antibody was diluted with the blocking solution, and 200 μL of the diluted primary antibody was added to each cell culture insert and incubated overnight at 4 °C; the cells were washed 3 times with 1×PBS buffer for 5 min each time, the secondary antibody was diluted with 1×PBS buffer, and 200 μL of the diluted secondary antibody was added to each cell culture insert and incubated in the dark at room temperature for 1 h; the cells were washed 3 times with 1×PBS buffer for 5 min each time, 200 μL of DAPI working solution was added to each cell culture insert and incubated in the dark at room temperature for 15 min; the cells were washed 3 times with 1×PBS buffer for 5 min each time, and the cells were sealed with a mounting medium containing an anti-fluorescence quencher, dried in the dark, and fluorescence photography was performed under a confocal microscope at 100× magnification. The statistical analysis of the paraspeckle quantification results was performed using GraphPad Prism.

[0046] (2)Experimental results:

[0047] The immunofluorescence results and paraspeckle quantification analysis results of ITGA6 and NONO proteins in iPSC-TM cells and pTM cells are as Figure 1 shown. The results show that the number of paraspeckles in iPSC-TM cells is significantly higher than that in pTM cells, and the number of paraspeckles is closely related to cell proliferation, suggesting that paraspeckle assembly is an important factor for iPSC-TM cells to promote the proliferation of pTM cells. Example 2

[0048] In this example, the degradation efficiency of menRNA in iPSC-TM cells and pTM cells was detected respectively.

[0049] (1)Experimental method:

[0050] 1.5×10 6iPSC-TM cells and pTM cells were seeded in 6-cm culture dishes, and 2 mL of MEM-α basic medium containing 10% serum was added to each dish. The cells were cultured in an incubator at 37 °C with 5% CO2 for 48 h. The culture media of iPSC-TM cells and pTM cells were taken out from the CO2 incubator, and the cell pellets and cell supernatants were separated by centrifugation. The cell pellets were washed twice with pre-cooled 1×PBS buffer, and 1 mL / tube of Trizol reagent was added, followed by lysis on ice for 2 min. The samples were transferred to 1.5-mL EP tubes, 200 μL of pre-cooled chloroform was added, and the tubes were shaken vigorously for 15 s and then left standing on ice for 15 min. After centrifugation at 4 °C and 12,000 rpm for 15 min, the samples were separated into three layers. The top layer was a colorless aqueous phase, which was carefully aspirated and transferred to a 1.5-mL EP tube. 500 μL of pre-cooled isopropanol was added, and the tubes were shaken vigorously for 15 s and then left standing on ice for 15 min. After centrifugation at 4 °C and 10,000 rpm for 15 min, the feather-like precipitate at the bottom of the tube was RNA. The supernatant was discarded, 1 mL of 75% ethanol was added to wash the precipitate, and the tubes were centrifuged at 4 °C and 7,500 rpm for 5 min. This step was repeated twice. After drying in the fume hood for 10 min, when the precipitate at the bottom of the tube became transparent, 10 μL of enzyme-free water was added, and the tubes were left standing in an oven at 60 °C for 10 min to dissolve the RNA. 1 μL of the RNA sample was taken, and its quantification was performed using Nanodrop. The purity was judged by A260 / A280, and a ratio between 1.8 and 2.0 indicated good purity. RT-PCR quantitative analysis was completed using a reverse transcription kit and a real-time quantitative kit; the remaining samples were stored at -80 °C. The mRNA expression levels of NEAT1_2 and menRNA in iPSC-TM cells and pTM cells were detected by RT-PCR. 1 - (mRNA expression level of menRNA / mRNA expression level of NEAT1_2) × 100% was the degradation efficiency of menRNA.

[0051] (2)Experimental results:

[0052] The results of the degradation efficiency of menRNA in iPSC-TM cells and pTM cells are as Figure 2 shown. The RT-PCR results showed that menRNA in pTM cells was basically degraded, while there was still some menRNA in iPSC-TM cells, and its expression level was significantly higher than that in pTM cells, further suggesting that menRNA might be a key signal mediating pTM cell division by iPSC-TM cells and playing an important role in promoting pTM cell proliferation. Example 3

[0053] In this example, menRNA and control were transfected into pTM cells to detect the overexpression efficiency of menRNA in pTM cells at different time points.

[0054] (1) Experimental method:

[0055] One day before transfection, 5×10 5 pTM cells were seeded in a 6-well plate culture dish, and 2 mL of MEM-α basic medium containing 10% serum was added to each dish. The cells were cultured in an incubator at 37°C and 5% CO2 to make the cell density reach 70% at the time of transfection. The cell supernatant was aspirated; 3.75 μL of Lipofectamine TM 3000 transfection reagent (shaken well before use) was added and diluted with 125 μL of Opti-MEM™ medium, gently mixed and incubated at room temperature for 5 min; 2.5 μL of RNA (100 μmol / mL) was taken and diluted with 125 μL of Opti-MEM™ medium, and gently mixed evenly; the diluted Lipofectamine TM 3000 transfection reagent was incubated for 5 min and then gently mixed with the diluted RNA, and left standing at room temperature for 15 min to form an RNA-lipid complex; the RNA-lipid complex was added to the culture dish, and 2.25 mL of MEM-α basic medium was supplemented to each dish. The culture dish was gently shaken to mix well, and then cultured in an incubator at 37°C and 5% CO2. After 6 h, the medium was changed to fresh MEM-α basic medium containing 10% serum and continued to be cultured; at 12 h, 24 h, 36 h, and 48 h after transfection, the mRNA expression level of menRNA was detected by RT-PCR. Among them, the RNA used in the experimental group was menRNA, and the control group did not contain RNA, and only Lipofectamine TM 3000 transfection reagent was used as the control.

[0056] The sequence of menRNA is shown in SEQ ID NO. 1:

[0057] GGCGCUGGUGGUGGCACGUCCAGCACGGCUGGGCCGGGGUUCGAGUCCCCGCAGUGUUG.

[0058] (2) Experimental results:

[0059] The expression levels of menRNA mRNA in pTM cells treated with menRNA and control are as Figure 3As shown, RT-PCR results showed that compared with the control group, after treatment with menRNA for 12 h, 24 h, and 36 h, the expression level of menRNA mRNA in pTM cells was upregulated by hundreds of times. However, after treatment with menRNA for 48 h, due to the intracellular degradation mechanism of menRNA, the expression level of menRNA mRNA was significantly decreased compared with that after treatment with menRNA for 12 h. Example 4

[0060] This example explored the effect of menRNA overexpression on the assembly of paraspeckles and the proliferation ability of pTM cells.

[0061] (1) Experimental method:

[0062] One day before transfection, 1×10 4 pTM cells were seeded on 14 mm cell culture slides, and 100 μL of MEM-α basic medium containing 10% serum was added to each cell culture slide. The cells were cultured in an incubator at 37 °C and 5% CO2 for 24 h to ensure that the cell density at the time of transfection reached 70%. The cell supernatant was aspirated; 0.375 μL of Lipofectamine TM 3000 transfection reagent (shaken well before use) was added and diluted with 12.5 μL of Opti-MEM™ medium, gently mixed, and incubated at room temperature for 5 min; 0.25 μL of RNA (100 μmol / mL) was taken and diluted with 12.5 μL of Opti-MEM™ medium, and gently mixed evenly; after the diluted Lipofectamine TM 3000 transfection reagent was incubated for 5 min, it was gently mixed with the diluted RNA and allowed to stand at room temperature for 15 min to form an RNA-lipid complex; the RNA-lipid complex was added to the culture dish, and 225 μL of MEM-α basic medium was added to each slide. The culture dish was gently shaken to mix evenly, and then cultured in an incubator at 37 °C and 5% CO2. After 6 h, the medium was replaced with fresh MEM-α basic medium containing 10% serum and continued to be cultured; immunofluorescence detection was performed 12 h and 48 h after transfection. Among them, the RNA used in the experimental group was menRNA, and the control group contained no RNA, only an equal amount of Lipofectamine TM 3000 transfection reagent as the control.

[0063] (2) Experimental results:

[0064] The immunofluorescence results and paraspeckle quantification results of NONO protein in pTM cells treated with menRNA and the control are as Figure 4As shown, the results showed that compared with the control group, the number of paraspeckles in pTM cells increased significantly after 12 h and 48 h of menRNA treatment, indicating that menRNA promoted the assembly of paraspeckles in pTM cells.

[0065] The immunofluorescence results of pTM cells and the quantitative results of pTM cells after 48 h of menRNA and control treatment are as Figure 5 shown. The results showed that the proliferative ability of pTM cells was also enhanced after 48 h of menRNA overexpression. Example 5

[0066] This example explored the effects of menRNA overexpression on the expression levels of stem cell markers, proliferation markers, and neural crest cell markers in pTM cells and the changes in cell morphology.

[0067] (1) Experimental method:

[0068] The specific experimental methods and steps were the same as those in Example 3, except that: the detection of stem cell markers, proliferation markers, and neural crest cell markers was performed 12 h, 24 h, 36 h, and 48 h after transfection of menRNA and Control.

[0069] (2) Experimental results:

[0070] The expression levels of menRNA mRNA in pTM cells treated with menRNA and control are as Figure 6 , Figure 7 shown. The RT-PCR results showed that compared with the control group, after 12 h, 24 h, 36 h, and 48 h of menRNA treatment, the expression levels of stem cell markers (ZFP42, TBX3, TFAP2C, CER1, DUSP6, NANOG, SOX2), proliferation markers (Ki-67), and neural crest markers (FOXC1, PITX2, SOX10, NES) were up-regulated to varying degrees at different time points, and the cell morphology changed ( Figure 8 ), with long cell processes appearing, indicating that menRNA overexpression can not only promote the proliferation of pTM cells, but also stimulate pTM cells to highly express stem cell and neural crest cell markers, promote the rejuvenation of pTM cells, and play a key role in remodeling the trabecular meshwork tissue.

[0071] Finally, it should be noted that the above is only used to illustrate the technical solution of the present invention and not to limit it. Although the present invention has been described in detail with reference to the preferred arrangement, those of ordinary skill in the art should understand that the technical solution of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. Use of a biomaterial overexpressing menRNA in the preparation of a drug for treating trabecular meshwork tissue injury, characterized in that, The sequence of the menRNA is shown in SEQ ID NO. 1; the biological materials are iPSC-TM cells and pTM cells; The drugs are one or more of the following: (1) The drug can promote the high expression of menRNA in trabecular meshwork tissue cells; (2) The drug can promote the assembly of paranuclear plaques, thereby promoting the proliferation and cell reprogramming of trabecular meshwork tissue cells; The drug includes menRNA and its transcription agent Lipofectamine™ 3000-menRNA.

2. The application according to claim 1, wherein The expression level of menRNA in the biomaterial is detected. When menRNA is overexpressed, it is determined that the biomaterial can be used to prepare a drug for reshaping trabecular meshwork tissue.

3. The application of menRNA in the preparation of a drug for treating trabecular meshwork tissue damage, characterized in that, The sequence of the menRNA is shown in SEQ ID NO. 1; The drugs are one or more of the following: (1) The drug can promote the high expression of menRNA in trabecular meshwork tissue cells; (2) The drug can promote the assembly of paranuclear plaques, thereby promoting the proliferation and cell reprogramming of trabecular meshwork tissue cells; The drug includes menRNA and its transcription agent Lipofectamine™ 3000-menRNA.

Images