Methods of treating neonates using IGF-1 complexes

Abstract

The present disclosure relates to the treatment of neonatal subpopulations to reduce the risk of IVH and / or severe IVH, such as Grade 3 or Grade 4 IVH, by administering a therapeutic amount of a composition comprising IGF-1 and an IGF binding protein, such as IGFBP-3, for example in a complex, in a dose of 200-500 [mu] g / Kg / day. In another aspect, stabilization of life function and / or prevention of circulatory failure when hyperosmosis occurs is also provided.

Description

Technical Field

[0001] The present disclosure relates to treating a neonatal subgroup to reduce the risk of IVH and / or severe IVH, such as grade 3 or 4 IVH. In another aspect, stabilization of life functions and / or prevention of circulatory failure is provided when hyperosmolarity occurs. Background Art

[0002] Preterm infants, as a patient population, are among the most delicate, vulnerable, and difficult-to-treat patient populations.

[0003] Some of these infants have only 4 tablespoons of blood in their entire bodies. This results in large variations in measured parameters such as blood pressure in this population. Conducting clinical trials in this patient population is also very difficult. For example, sampling and administration are not easy, and even saline infusion can potentially cause cerebral hemorrhage because these infants cannot self-regulate.

[0004] Many drugs are not licensed for use in these infants, and dosages have not been fully determined. Moreover, because of the variability between individual patients, achieving static significance is not simple.

[0005] Fluctuations in blood flow and blood pressure are common. Low blood pressure can cause constriction of vital organs such as the kidneys. Increased cerebral blood flow can lead to intraventricular hemorrhage (IVH) and death. Unfortunately, the latter is quite common in preterm infants, especially those born prematurely, i.e., infants born at 23 - 27 weeks of gestation.

[0006] Newborns with a low gestational age (especially those born at 23, 24, 25, and 26 weeks of gestation) and those with a low APGAR score (a measure used to evaluate the neonatal stress / trauma condition) are particularly susceptible to IVH.

[0007] APGAR score: Activity (muscle tone), in the range of 0 - 2; Pulse, in the range of 0 - 2; Grimace (reflex reactivity), in the range of 0 - 2; Appearance (skin color), in the range of 0 - 2; and Respiration, in the range of 0 - 2, see Figure 1 .. A total score in the range of 7 - 10 means the infant is in excellent condition. A total score in the range of 4 - 6 means the infant is moderately depressed. A total score in the range of 0 - 3 means the infant is severely depressed.

[0008] Unstable blood pressure and / or respiratory problems and renal function problems seem to prompt body stress, which may in turn lead to an increased risk of IVH. This can explain why newborns with a low APGAR are more likely to develop IVH.

[0009] In addition, medical interventions used to treat these severely ill newborns can also cause problems. For example, as mentioned above, saline infusions have the potential to cause IVH because these infants are unable to self-regulate. Resuscitation can also have a negative impact on IVH, especially when the infant is over-treated and has a pink complexion, which may increase the risk of IVH. In fact, it has been found that gentle resuscitation is better. Inadequate urine excretion may require treatment with vasopressors and / or diuretics to raise blood pressure. These treatments may inadvertently cause IVH.

[0010] It would be useful to gain a more detailed understanding of the mechanisms associated with IVH in this patient population and translate them into beneficial treatments to minimize the incidence or severity of IVH, as this does not currently exist.

[0011] Rodent studies have shown that systemic insulin-like growth factor 1 (IGF-1) can bind to the choroid plexus (CP) and translocate into the cerebrospinal fluid through it. However, previous studies have inferred that the transfer of systemic IGF-1 across the blood-brain barrier is limited, which may limit the beneficial therapeutic effects in the brain.

[0012] The inventors' detailed characterization shows that IGF-1 / IGF binding protein 3 (IGF-1 / IGFBP-3) activates the IGF-1 receptor (IGF-1R) and downstream signaling pathways at the CP in the immature brains of premature rabbit pups. This convinces us that IGF-1 can act at the sites where it is needed.

[0013] The inventors' more detailed analysis of human neonatal clinical data shows that in low gestational age infants, prevention of IVH can be achieved in up to 60% of newborns receiving IGF-1 / IGFBP-3. Compared to infants receiving only standard care, there may be up to 22% more infants without IVH in the treated group. In other cases, the severity of IVH is reduced in the treated group, i.e., the cases of grade 3 and 4 IVH are reduced.

[0014] In addition, the treated infants are stronger, for example, blood pressure is stable, the ability to excrete urine is stable (e.g., no need to administer vasopressors and / or diuretics), and respiratory parameters are improved, for example, as confirmed by measuring respiratory gases. This may in turn contribute to a lower tendency for IVH.

[0015] Therefore, newborns with a low APGAR score and an increased risk of IVH will also benefit from IGF-1 / IGFBP-3 treatment because it helps to stabilize the suppressed functions.

[0016] Among these infants, abnormalities in glucose homeostasis, including insulin resistance, are also common. This can lead to changes in plasma osmolality, which may be sudden, resulting in systemic effects and dysfunction in premature infants such as circulatory failure and / or IVH.

[0017] The inventors conducted studies in a premature animal model to determine the mechanisms involved in circulatory failure or acute metabolic syndrome and IVH.

[0018] One animal model the inventors used for this purpose was the rabbit pup model, in which 50% glycerol was administered systemically in premature animals to create a hyperosmotic state. This in turn led to disturbances in the metabolic system, changes in blood glucose levels, and significant changes in blood flow, including mean arterial pressure (particularly greater changes and / or higher pressures), and an increase in cerebral blood flow was observed, which subsequently led to bleeding in the brain. Thus, this model mimics circulatory failure and IVH.

[0019] The rabbit pup glycerol-induced IVH model disclosed herein, according to Figure 4B the schedule shown, received treatment (using IGF-1 / IGFBP-3) 3 hours after birth (continuing the every 12-hour regimen until the end of the experiment), and glycerol was administered at 6 hours.

[0020] Compared with untreated pups, in the case of induced IVH, the mortality of premature rabbit pups treated with IGF-1 / IGFBP-3 was reduced by more than 50%, as shown in Figure 5 .

[0021] Interestingly, 10% of untreated animals died of systemic effects without IVH, which may be attributed to vascular collapse or acute metabolic syndrome. In contrast, none of the animals treated with IGF-1 / IGFBP-1 died without IVH.

[0022] Thus, IGF-1 / IGFBP-3 appears to play a role in regulating blood flow and / or blood pressure. The observed mortality benefit may result from the ability of treated animals to stabilize in response to sudden changes in plasma osmolality.

[0023] At 24 hours, a small prevention of induced IVH was seen in the group treated with IGF-1 / IGFBP-3, 21% compared with 25.6% in the untreated group, as shown in Table 3 below.

[0024] The inventors have learned from other studies (not shown) that the effects of administering IGF-1 / IGFBP-3 take about 24 hours to become effective. Thus, the 6-hour glycerol challenge induces IVH before the treatment is truly effective. It is hypothesized that when the glycerol challenge is administered later (e.g., at 18 hours), a more pronounced prevention of induced IVH can be provided, as no further IVH occurred in the treated group at 48 hours. In contrast, the IVH in untreated rabbit pups increased from 25.6% at 24 hours to 28.2% at 48 hours, as shown in Table 3 in Example 2.

[0025] Generally speaking, the present inventors have demonstrated that IGF-1 can stimulate signal transduction across the blood-brain barrier after systemic administration, and IGF-1 in the brain can reduce the incidence and / or severity of IVH in extremely premature infants, especially premature infants with a low gestational age (such as 23 to 27 weeks, especially 23 to 26 weeks, particularly 23 to 25 and / or 26 weeks). The treatment may also treat infants with low birth weight, and infants with low APGAR scores, as well as combinations of these patient groups.

[0026] The treatment also seems to help stabilize fluctuations in osmotic pressure.

[0027] The treatment can also help the infant with self-regulation.

[0028] Surprisingly, IGF-1 penetrates the immature brain, especially in the absence of the use of IGF-1R.

[0029] The inventors also hypothesize that IGF-1 / IGFBP-3 is beneficial to one or more of the following: brain plasticity, ion channel regulation, membrane permeability, and / or fluid "absorption". This may be beneficial for premature infants to minimize the damage caused by IVH. SUMMARY OF THE INVENTION

[0030] 1. A method for preventing intraventricular hemorrhage (IVH) in premature infants born at a low gestational age (e.g., 23, 24, 25, or 26 weeks, such as 23, 24, or 25 weeks, i.e., 23 to 25 weeks), which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF-binding protein (such as IGFBP-3) in a complex within 3 hours after birth, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450, or 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, and wherein more than 50% of the treated infants do not have IVH after excluding the baseline assessment time point.

[0031] 2. A composition for preventing intraventricular hemorrhage (IVH) in premature infants born at low gestational age (e.g., 23, 24, 25, or 26 weeks, such as 23, 24, or 25 weeks, i.e., 23 to 25 weeks), which comprises, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in a complex, wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450, or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during treatment, and wherein more than 50% of the treated infants do not have IVH after excluding the baseline assessment time point.

[0032] 3. Use of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in a complex, in the manufacture of a medicament for preventing intraventricular hemorrhage (IVH) in premature infants born at low gestational age (e.g., 23, 24, 25, or 26 weeks, such as 23, 24, or 25 weeks, i.e., 23 to 25 weeks), wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450, or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during treatment, and wherein more than 50% of the treated infants do not have IVH after excluding the baseline assessment time point.

[0033] 4. The method, composition or use according to any one of paragraphs 1 to 3, wherein 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65% or more of the treated patient population do not have IVH.

[0034] 5. The method, composition or use according to any one of paragraphs 1 to 4, wherein at least 70% of the treated population, such as 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% or more of the treated population, is below grade 2 (i.e., 0 or 1) on the IVH scale, for example, by the VOLPE method and / or the maximum score method.

[0035] 6. The method according to any one of paragraphs 1 to 5, wherein at least 85% of the treated population, such as 85%, 86%, 87%, 87.5% or more of the treated population, is below grade 3 (i.e., 0, 1, or 2) on the IVH scale, for example, by the VOLPE method and / or the maximum score method.

[0036] 7. A method for preventing grade 3 or 4 intraventricular hemorrhage (IVH) in premature infants born at low gestational age (e.g., 23, 24, 25, or 26 weeks, such as 26 weeks), which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form within 3 hours of birth, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450, or 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, wherein after excluding the baseline time point, 15% or less of the treated infants have grade 3 or 4 IVH, such as 12.5%, 12%, 11%, 10%, 9%, 8%, 7%, 6.5%, 6.25% or less, particularly 10% or less.

[0037] 8. A composition for use in preventing grade 3 or 4 intraventricular hemorrhage (IVH) in premature infants born at low gestational age (e.g., 23, 24, 25, or 26 weeks, such as 26 weeks), which comprises, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form, wherein the composition is administered within 3 hours of birth at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450, or 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, wherein after excluding the baseline time point, 15% or less of the treated infants have grade 3 or 4 IVH, such as 12.5%, 12%, 11%, 10%, 9%, 8%, 7%, 6.5%, 6.25% or less, particularly 10% or less.

[0038] 9. Use of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in the form of a complex in the preparation of a medicament for preventing grade 3 or 4 intraventricular hemorrhage (IVH) in premature infants born at a low gestational age (such as 23, 24, 25 or 26 weeks, such as 26 weeks), wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, and wherein after excluding the baseline time point, 15% or less of the treated infants have grade 3 or 4 IVH, such as 12.5%, 12%, 11%, 10%, 9%, 8%, 7%, 6.5%, 6.25% or less, especially 10% or less.

[0039] 10. A method for preventing intraventricular hemorrhage (IVH) or grade 3 or 4 IVH in premature infants with an APGAR score of less than 7, which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in the form of a complex at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, and wherein after excluding the baseline assessment time point, a higher percentage of the treated infants do not have IVH or do not have grade 3 or 4 IVH compared to comparable untreated premature infants.

[0040] 11. A composition for use in preventing intraventricular hemorrhage (IVH) or grade 3 or 4 IVH in premature infants with an APGAR score of less than 7, which comprises IGF-1 and an IGF binding protein (such as IGFBP-3) in the form of a complex, wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, and wherein after excluding the baseline assessment time point, a higher percentage of the treated infants do not have IVH or do not have grade 3 or 4 IVH compared to comparable untreated premature infants.

[0041] 12. Use of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form in the preparation of a medicament for preventing intraventricular hemorrhage (IVH) in premature infants with an APGAR score of less than 7 or for preventing grade 3 or 4 IVH thereof, wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, and wherein after excluding the baseline assessment time point, a higher percentage of the treated infants do not have IVH or do not have grade 3 or 4 IVH compared to comparable untreated premature infants.

[0042] 13. A method for stabilizing pathological fluctuations in blood osmolality in premature infants (such as very low gestational age premature infants), which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form within 3 hours of birth at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment.

[0043] 14. A composition for use in stabilizing pathological fluctuations in blood osmolality in premature infants (such as very low gestational age premature infants), which comprises, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form, wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment.

[0044] 15. Use of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form in the preparation of a medicament for stabilizing pathological fluctuations in blood osmolality in premature infants (such as very low gestational age premature infants), wherein the composition is administered at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day) within 3 hours of birth for a period of at least 7 days such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment.

[0045] 16. A method, composition or use according to any of the preceding paragraphs, wherein the incidence of IVH appearance and / or progression is improved within a time period of 24 hours to 168 hours, such as 24 hours to 120 hours, including a time period of 48 to 120 hours, after the start of treatment.

[0046] 17. A method, composition or use according to any of the preceding paragraphs, wherein the treated premature infants have a mortality benefit.

[0047] 18. A method, composition or use according to any of the preceding paragraphs, wherein the risk of IVH is reduced by at least 10%, such as 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18% or more, until 48 hours (and longer, such as at least 50, 60 or 72 hours).

[0048] 19. A method, composition or use according to any of the preceding paragraphs, wherein the severity of IVH is reduced, such as the incidence of grade 3 and / or 4 is reduced.

[0049] 20. A method, composition or use according to any of the preceding paragraphs, wherein the severity of grade 2 IVH is reduced.

[0050] 21. A method, composition or use according to any of the preceding paragraphs, wherein the treatment starts within 24 hours after birth, such as within 30 minutes to 3 hours after birth.

[0051] 22. A method, composition or use according to any of the preceding paragraphs, wherein the treatment is administered subcutaneously and / or by infusion (such as intermittent or continuous infusion).

[0052] 23. A method, composition or use according to any of the preceding paragraphs, wherein the premature infants are treated for at least 5 days, such as at least 1 week, such as 2 to 6 weeks, such as 2, 3, 4, 5 or 6 weeks.

[0053] 24. A method, composition or use according to any of the preceding paragraphs, wherein the treatment continues until a gestational age of 32, 33 or 34 weeks.

[0054] 25. A method, composition or use according to any of the preceding paragraphs, wherein the serum IGF-1 level is maintained within the range of 28 to 109 ng / mL.

[0055] In one embodiment, germinal matrix hemorrhage (GMH) is reduced in the treated patient population compared to the untreated patient population.

[0056] In one embodiment, periventricular hemorrhagic infarction (PVH) is reduced in a treated patient population compared to an untreated patient population.

[0057] In one embodiment, posthemorrhagic ventricular dilation (PHVD) and / or white matter injury (WMI) is reduced (or minimized) in a treated patient population compared to an untreated patient population.

[0058] Thus, in one embodiment, the incidence of all levels of IVH, including severe IVH, is reduced in treated neonates born in the range of 23 to 25 weeks.

[0059] In one embodiment, treated neonates born at 26 weeks prevent the incidence of severe IVH (such as grade 3 and / or grade 4).

[0060] In a separate aspect, stabilization of life functions (such as respiration, heart rate, and blood pressure) in the presence of high osmotic pressure is provided, which is carried out by administering, for example, IGF-1 and IGF binding protein (such as IGFBP-3) in a complex, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450, or 500 μg / Kg / day, particularly 350 - 500 μg / Kg / day), as described elsewhere herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 A schematic diagram showing the APGAR scoring system is presented.

[0062] Figure 2 The plasma osmotic pressure of premature rabbit pups administered glycerol is shown.

[0063] Figure 3 The effects of glycerol administration on the heart rate, oxygen saturation, and respiratory rate of premature rabbit pups are shown.

[0064] Figure 4A A schematic diagram showing a protocol for evaluating which time points are suitable for administering a glycerol challenge is presented.

[0065] Figure 4B A schematic diagram showing a protocol for administering IGF-1 / IGFBP-3 treatment in combination with a glycerol challenge at 6 hours is presented.

[0066] Figure 5 Shows according to Figure 4B The percentage of mortality (all causes) of premature rabbit pups treated according to the protocol shown in

[0067] Figure 6 A shows the brain of a premature rabbit pup without IVH.

[0068] Figure 6 Panel B shows the brain of a premature rabbit pup with IVH.

[0069] Figure 7A Serum IGF-1 levels up to 48 hours are shown.

[0070] Figure 7B Serum IGF-1 levels in premature rabbit pups without IVH and with IVH at 48 hours are shown.

[0071] Figure 7C Recombinant human IGF-1 and IGFBP-3 levels in premature rabbit pups are shown.

[0072] Figure 8 Representative light-sheet microscopy 3D images of Alexa Fluor-647-labeled IGF-1 / IGFBP-3 (yellow) in the brain of a premature rabbit at 5 hours after subcutaneous administration of Alexa Flour-647-labeled IGF-1 / IGFBP-3 are shown. For visualization, autofluorescence (shown in red) is included.

[0073] Figure 9 Representative light-sheet microscopy 2D images of Alexa Fluor-647-labeled IGF-1 / IGFBP-3 (yellow) in the brain of a premature rabbit at 5 hours after subcutaneous administration of Alexa are shown.

[0074] Figure 10 Representative confocal and transmission electron microscopy images of immunolabeling for IGF-1 / IGFBP-3 in the brain of a premature rabbit at 5 hours after subcutaneous administration are shown. The choroid plexus (left) and subfornical organ (middle) are indicated by red arrows, and the choroid plexus (right) is indicated by white and gray arrows.

[0075] Figure 11 Western blots of p.ERK and p.PKB in the choroid plexus of the brain of a premature rabbit at 5 hours after subcutaneous administration of IGF-1 / IGFBP-3.

[0076] Figure 12A. Schematic overview of in vitro study. B. Representative confocal microscopy images showing the labeling of TTR (green, B, leftmost and rightmost), IGF-1 (magenta, B, mid-left and rightmost), and CD63 (yellow, B, mid-right and rightmost) in neonatal primary murine ChPE cells cultured in a transwell system. The co-localization of IGF-1 with the late endosomal marker CD63 is shown by white arrows in the merged image (B, rightmost). Scale bar represents 20 μm and represents all images in B. C-H. Representative TEM images of immunogold labeling of flotillin-2 (C) and IGF-1 (D-H) in neonatal primary murine ChPE cells cultured in a transwell system. White arrows show immunogold labeling in membrane-enclosed vesicles. Scale bars in C-H represent 100 nm. Confocal microscopy and TEM images were collected from 3 independent experiments.

[0077] Figure 13 A and B show representative TEM images of EVs derived from purified neonatal primary murine CPE cells, immunogold-labeled with flotillin-2 (A) and IGF-1 (B).

[0078] Figure 13 C and D show the NTA quantification (C) and size distribution (D) of EVs secreted into the apical supernatant of ChPE cells after exposure to hIGF-1 (40, 100, and 250 ng / ml) for 24 hours. Data are from four independent experiments, with N = 4 - 6 for the corresponding experiments. Data are presented as mean ± SD. Differences between 40, 100, and 250 ng / ml hIGF-1 versus the control group were analyzed for multiple comparisons of means using one-way ANOVA with post hoc Tukey test, *P ≤ 0.01.

[0079] Figures 14A and B show A. Volcano plot of the proteome in EVs derived from IGF-1-exposed (40 ng / ml) ChPE cells compared to control cells. B. Significant changes in protein abundances identified in EVs derived from ChPE cells after stimulation with hIGF-1 (40 ng / ml), with significance criteria of fold change ≥ 1.5 and ≤ -1.5, and adjusted p-value, Benjamini-Hochberg corrected p-value ≤ 0.05.

[0080] Figures 14C and D show GO biological process terms based on the analysis shown for individual proteins. Metascape analysis of enriched (C) and inhibited (D) proteins identified in EVs derived from ChPE cells after stimulation with hIGF-1 (40 ng / ml), with significance criteria of log fold change ≥ 1 and ≤ -1, and p-value ≤ 0.05.

[0081] Figures 15A - C show A. a volcano plot of the proteome of CSF - derived EVs from preterm piglets exposed to hIGF - 1 compared to piglets infused with vehicle. B. Metascape analysis of inhibitory proteins identified in EVs derived from preterm piglet CSF after IGF - 1 treatment, with significance criteria of log fold - change ≥1 and ≤ - 1, and p - value ≤0.05. C. A Venn diagram showing the overlap of proteins derived from ChPE cell supernatant EVs (purple, N = 12) or preterm piglet CSF EVs (green, N = 16).

[0082] Figure 15D The reactome gene set is shown.

[0083] Figure 16 A - E show A. a schematic diagram of the experimental outline. B - D. Representative confocal microscopy images showing the presence of ChPE cell - derived EVs stained with the dye PKH26 (red) in the hippocampus of preterm rabbit pups' brains after i.c.v. injection. B and C. Representative confocal microscopy images of EVs outside the ependymal layer in the polymorph layer. D. Representative confocal microscopy images of EVs in the deep structures of the CA2 - CA3 regions of the proper hippocampus in the pyramidal layer and further in the molecular layer. Representative images were collected from N = 8. E. The scale bars in B - D represent 50 μm. GAP - 43 - labeled rat hippocampal neurons (red) were incubated with ChPE cell - derived EVs stained with PKH27 (green). The scale bar in E represents 25 μm.

[0084] Figure 16 F shows the quantification of the green signal of the number of nuclei per cell in hippocampal neurons exposed to EVs derived from hIGF - 1 - stimulated ChPE cells. Data are presented as mean ± SD (N = 12). Student's t - test was used to analyze differences between groups. E, ependymal layer; poly, polymorphic layer; pyr, pyramidal layer; M, molecular layer; LV, lateral ventricle.

[0085] Figure 17 A schematic diagrammatic illustration of the proposed IGF - 1 transport model is shown. The ChP forms a barrier between the periphery of the brain and the CSF. This highly secretory organ increases the secretion of EVs after blood - borne IGF - 1 stimulation. Blood - borne IGF - 1 is transported across the blood - CSF barrier, encapsulated in EVs secreted from the ChP, and ultimately reaches the hippocampus of the immature brain.

[0086] Figure 18Shows the characterization of a neonatal primary murine ChPE transwell cell culture model. A - D. Representative confocal microscopy images showing the expression of TTR (grey area, A, C, D, left), ZO - 1 (grey line, B, right), S100A4 (grey area, C, right), and Hsp47 (grey area, D, right). Scale bar in D represents 100 μm and is representative of A - D. E. TEER measurements of ChPE cell cultures in the transwell system. Representative data are presented as mean ± SD (N = 4 - 5 / group). Differences in TEER measurements compared to day 3 were analyzed by one - way ANOVA with post - hoc Tukey's test for multiple comparisons of means, ***P ≤ 0.001. F. Transcytosis assay of ChPE cells in the transwell system on day 8 of culture. Representative data are presented as mean ± SD (N = 3 - 4 / group). Differences compared to the control group were analyzed by Student's t - test, ***P ≤ 0.001.

[0087] Figure 19 Shows the localization of IGF - 1R in neonatal primary murine ChPE cells. Representative confocal microscopy images showing the labeling of IGF - 1R (grey dots, left and right) and CD63 (white dots, middle and right) in neonatal primary murine CPE cells cultured in the transwell system. Co - localization is shown by white arrows in the merged image (right). Scale bar represents 20 μm and is representative of all images.

[0088] Figure 20 Shows ultrasound - guided i.c.v. injection. EVs prepared in vitro from hIGF - 1 - stimulated or control neonatal primary murine ChPE cells were stained with PKH26 and then i.c.v. injected (ultrasound - guided) into the lateral ventricles of un - sedated premature rabbit pups. A. The injection needle is in the lateral ventricle. B. The liquid is injected into the lateral ventricle. C. The needle is withdrawn. LV, lateral ventricle.

[0089] Figure 21 Shows the uptake of PKH27 dye in the area of interest. A and B. Representative confocal microscopy images showing the i.c.v. - injected PKH26 dye (indicated by arrows) in the area of interest of the premature rabbit brain.

[0090] Figure 22 Shows the uptake of PKH67 dye by hippocampal neurons in vitro. A and B. Representative confocal microscopy images showing the visualization of PKH67 (white area, A) and GAP - 43 (light grey area, A - B) in hippocampal neurons in vitro. Hippocampal neurons were incubated with PKH67 dye (A) or PBS (B). Scale bar in B shows 50 μm and is representative of A and B. Detailed Description

[0091] As used herein, the treatment period is the period when the protein IGF-1 / IGFBP (such as IGFBP-3) begins to be effective after administration. This may be the period when the circulating IGF-1 level is within the therapeutic range (e.g., 28 μg / L to 109 μg / L in human preterm infants). It may take about 24 to 48 hours after administration of the first dose to fully reach the treatment period.

[0092] Advantageously, a dose of at least 350 μg / Kg / day ensures that the circulating IGF-1 level in most treated neonates is within the therapeutic range (28 to 109 ng / mL).

[0093] As used herein, a very low gestational age preterm infant refers to an infant with a gestational age of 27 weeks or less, such as 26 weeks or less, 25 weeks or less, 24 weeks or less, such as 26, 25, 24, and 23 weeks, especially 23 to 25 weeks or 23 to 26 weeks.

[0094] As used herein, 'after excluding the baseline assessment time point' is intended to exclude neonates with IVH at the zero time point.

[0095] "Comprising" is intended to mean "including" in the context of this specification. Where technically appropriate, the embodiments of the present invention may be combined.

[0096] Embodiments are described herein as comprising certain features / elements. The present disclosure also extends to independent embodiments consisting of or consisting essentially of the said features / elements.

[0097] Technical references such as patents and applications are incorporated herein by reference.

[0098] Any embodiment specifically and expressly recited herein may be used alone or in combination with one or more additional embodiments to form the basis of a disclaimer.

[0099] Values in examples (such as numerical values and / or variables, such as R1, etc.) may be extracted from specific examples and combined with the disclosure in the specification (such as general disclosure), without including other features of the examples.

[0100] This specification claims priority to US63 / 378,267 filed on October 4, 2022 and GB2315046.9 filed on September 29, 2023, both of which are incorporated herein by reference. These specifications may be used as a basis for correction in this specification.

[0101] The background contains useful technical information and may be used as a basis for correction.

[0102] The present invention will now be described with reference to the following embodiments, which are illustrative only and should not be construed as limiting the scope of the invention.

[0103] Example

[0104] Findings from a Phase II study of neonates with IVH

[0105] A Phase II trial in which infants less than 28 weeks of gestational age were randomized to rhIGF-1 / rhIGFBP-3 (50 μg / ml solution) or standard of care (SOC). A series of cranial ultrasounds were performed between birth and term-equivalent age. The presence of germinal matrix hemorrhage and intraventricular hemorrhage (GMH-IVH), periventricular hemorrhagic infarction (PHI), posthemorrhagic ventricular dilation (PHVD), and white matter injury (WMI) were scored by two independent masked readers.

[0106] Eligible infants had a gestational age (GA) at birth in the range of 23 weeks + 0 days to 27 weeks + 6 days. Exclusion criteria included detectable severe malformations, known or suspected chromosomal abnormalities, clinically significant neurological diseases, grade II or III GMH-IVH or PHI (including infants with grade I GMH-IVH).

[0107] Infants in the active treatment group received a standard dose of 250 μg / kg per day of rhIGF-1 / rhIGFBP-3 via continuous intravenous infusion in addition to SOC starting at 24 hours of age until postmenstrual age (PMA) 29 weeks + 6 days.

[0108] Infants in the control group received SOC based on their individual medical needs and according to the local protocol.

[0109] A post hoc analysis was performed to further explore the Phase II study findings regarding IVH.

[0110] Table 1 is the analysis of infants treated within the range of required treatment

[0111] Treatment IGF-1 / IGFBP-3*

[0112] Control i.e., standard care

[0113]

[0114]

[0115]

[0116] For treated infants, no IVH and grade 1. For untreated infants, no IVH and grade 1

[0117] = 78% = 59.7%

[0118] Grade 3 and PHI = 12.5% Grade 3 and PHI = 19%

[0119] Table 2

[0120] Treatment IGF-1 / IGFBP-3*

[0121] Control, i.e., standard care

[0122]

[0123]

[0124] For treated infants, no IVH and grade 1. For untreated infants, no IVH and grade 1

[0125] = 87.5% = 73.3%

[0126] Grade 3 and PHI = 6.25% Grade 3 and PHI = 19.9%

[0127] This data shows that treatment of infants with a low gestational age of 23 to 25 weeks is more preventive of the incidence of IVH compared to those infants receiving only standard care, 60% versus 38.7% respectively, and the incidence of grades 2, 3, and 4 IVH in the patient population is also reduced.

[0128] By treating with IGF-1 / IGFBP-3, the incidence of grades 3 and 4 IVH is prevented in infants born at 26 weeks (6.25% versus 19.9%).

[0129] GMH-IVH graded according to the Volpe method

[0130] Severity description

[0131] Grade I GMH, no or with minimal IVH (< 10% of the ventricular area on the parasagittal view)

[0132] Grade II IVH, in 10 - 50% of the ventricular area on the parasagittal view

[0133] Grade III IVH; in > 50% of the ventricular area on the parasagittal view; usually causes dilation of the lateral ventricles

[0134] Grade IV (IVH and PHI) IVH combined with hemorrhagic venous infarction of the periventricular white matter

[0135] Summary of Example 2

[0136] Treatment of Premature Rabbit Pups with IGF-1 / IGFBP-3

[0137] Premature rabbit pups were born by cesarean section at E29 (term 32 days). Intraventricular hemorrhage (IVH) was induced by i.p. administration of 50% glycerol solution 6 - 24 hours postpartum and verified by high-frequency ultrasound (HFU) at 24 hours. At 6 hours postpartum, a high osmotic pressure that initiated IVH was induced by i.p. administration of 50% glycerol. Starting at 3 hours of age and every 12 hours, IGF-1 / IGFBP-3 (8 mg / kg) (n = 38) or vehicle (n = 39) was administered s.c., see Figure 4B . At 48 hours, the degree of any hemorrhage was scored in vivo by HFU and postmortem assessment was performed by histopathological examination.

[0138] The incidence of induced IVH was highest (66%) at 6 hours after birth and decreased at 12 - 24 hours, which is why it was chosen, see Table 4.

[0139] The increase in plasma osmotic pressure in the absence of treatment is shown in Figure 2 . The plasma osmotic pressure increased from 275 (±9.6) to 364 (±10.2) mOsm / kg, peaked at 2 hours, and decreased to baseline (dashed line) between 12 - 24 hours.

[0140] Data on heart rate, oxygen saturation, and respiratory rate in the absence of treatment are shown in Figure 3 .

[0141] However, after initiation of treatment, it may take up to 48 hours to become effective, and this model only provides treatment 3 hours before glycerol injury. Nevertheless, IGF-1 / IGFBP-3 treatment implies a great benefit in preventing death. See Figure 5 .

[0142] Data on IVH showed a data trend that treatment could prevent IVH at approximately 48 hours after initiation of glycerol administration, see Fig. 3.

[0143] Table 3

[0144]

[0145] Materials and Methods

[0146] Animals

[0147] Animal studies were conducted in accordance with and approved by the Swedish Animal Ethics Committee in Lund, Sweden. The reporting followed the ARRIVE guidelines. As previously described, a well-established premature rabbit model was used, which used crossbred rabbits between New Zealand white rabbits and lop-eared rabbits ( Sweden), with glycerol-induced intraventricular hemorrhage (IVH).

[0148] Briefly, the experiment was conducted on a total of 139 rabbit pups from 20 litters. These rabbit pups were born via cesarean section (c.s.) after anesthetizing the female rabbits with i.v. propofol (5 mg / kg, Primen Pharmaceuticals Oy, Helsinki, Finland) at day 29 (full term = 31 - 32 days). After birth, the pups were cared for, fed, and nursed by experienced animal laboratory staff. The pups were dried and placed in an infant incubator set at a temperature of 30 °C and a humidity of 60%.

[0149] Experimental setup:

[0150] After preterm birth, the animals were marked and randomly and equally assigned to experimental groups, treatment regimens, and sacrifice time points based on their body weight and litter. The experimental setups for experiments (A) and (B) are shown in detail in Figure 4.

[0151] A. Investigation of the IVH induction window

[0152] In experiment A, the animals were injected subcutaneously (s.c.) with a single bolus (100 μL) of sterile isotonic saline (0.9% NaCl, B Braun, Melsungen, Germany) after birth. Approximately 5 hours after birth, the animals were monitored using high-frequency ultrasound (HFU, Vevo 2100, VisualSonics Inc., Toronto, ON, Canada) with an MS-550D 40 MHz transducer to scan for any spontaneous cranial hemorrhage, as described previously. According to the assigned experimental group, all non-hemorrhagic animals received a single bolus of 50% (v / v) sterile glycerol solution (6.5 g / kg, Teknova, Hollister, US) administered intraperitoneally (i.p.) at 6, 12, 18, or 24 hours after birth. Two consecutive ultrasound scans were performed 12 and 24 hours after glycerol administration. The animals were sacrificed 24 hours after glycerol administration, corresponding to a postnatal age of 30 hours (6-hour glycerol administration group), 36 hours (12-hour glycerol administration group), 42 hours (18-hour glycerol administration group), or 48 hours (24-hour glycerol administration group), respectively.

[0153] B. Preventive effect of rhIGF-1 / rhIGFBP-3 on glycerol-induced IVH

[0154] In Experiment B, animals were s.c. administered 8 mg / kg recombinant human (rh) IGF-1 / rhIGFBP-3 (supplied, formulated, and prepared in vehicle solution by Takeda Pharmaceutical Company Ltd, Boston, MA, USA) or saline vehicle (0.9% NaCl, B Braun) at approximately 3 hours of age and were thereafter administered (a total of 5 administrations) every 12 hours at 4 additional consecutive time points. Three hours after the first rhIGF-1 / rhIGFBP-3 administration, at 6 hours of age, a single bolus of 50% glycerol solution (6.5 g / kg) was administered i.p. HFU scans were performed every 24 hours as described above to monitor the severity of IVH. Litters with severe IVH at the time of ultrasound were assigned to the IVH group ( Figure 6 B), and litters in which no IVH was detected at all time points were used as controls ( Figure 6 A). The reproducibility and accuracy of ventricular measurements in this animal model using HFU have been previously described. The determination of the degree of hemorrhage was scored according to a simplified version of the Volpe standardized scale. Figure 6 Representative ultrasound images of rabbit litters without and with IVH are shown. All examinations were performed without the operator's knowledge. At 54 hours of postnatal age, 48 hours after glycerol administration, the animals were euthanized. Postmortem ultrasounds were performed on animals that were euthanized due to poor health or died prior to the scheduled euthanasia.

[0155] Tissue collection and processing

[0156] Animals were euthanized by decapitation at the corresponding endpoints as determined for the experimental groups. Blood was collected by gravity into Li-heparin and serum tubes (Microvette, Sarstedt, Germany), centrifuged and the plasma and serum were then immediately frozen and stored at -80 °C. Ear biopsy samples (for sex determination) were collected, snap frozen and stored at -80 °C.

[0157] After sacrifice, the brain was removed from the skull and immersed in freshly prepared 4% paraformaldehyde solution (PFA, 0.1 M phosphate buffer, pH 7.4) for 24 hours of immersion fixation. After 3 - 6 hours, the PFA was replaced with fresh PFA, and the brain was immersed for a total of 24 hours at 4 °C. Then, the brain was cryoprotected by sequentially immersing it in 15% sucrose (diluted in phosphate buffered saline, PBS, 0.1 M, pH 7.4) for 6 hours and then in 25% sucrose (diluted in PBS) for another 6 hours. The brain was embedded in TissueTec (Sakura Finetek, Torrance, CA, USA) and frozen in a freezing mold on dry ice in isopentane (2 - methylbutane, Sigma - Aldrich, St. Louis, MO, USA) (at approximately - 60 °C). Sections (12 μm) were cut on a cryostat (Microm, HM500OM, Microm Laborgeraete GmbH, Walldorf, Germany). The sections were collected on SuperFrostplus slides (Menzel, Braunschweig, Germany). The brain cryosections were cut into three blocks (forebrain, midbrain, and hindbrain) by coronal dissection and stored at - 20 °C.

[0158] Hematoxylin - eosin

[0159] To define the cranial nerve anatomy and thereby enable macroscopic evaluation, the sections were stained with hematoxylin - eosin (HE). The HE staining procedure was as follows: The sections were air - dried at room temperature (RT) or 37 °C for 20 - 30 minutes, rinsed in PBS, 2 x 5 minutes, and then rinsed in dH 2 O for 1 minute. The sections were immersed in Mayer's hematoxylin (Histolab, Gothenburg, Sweden) for 2 minutes and then quickly rinsed three times in dH 2 O, 1 minute each time. Then the sections were immersed in sodium bicarbonate (0.1%) for 1 minute and then in dH 2 O, 2 x 1 minute. The sections were immersed in 70% ethanol for 2 minutes, immersed in eosin (Histolab, 0.2% diluted in 70% ethanol, acidified with glacial acetic acid) for 3 minutes. The sections were dehydrated in alcohol (96% x 2 and 100% x 2, 3 minutes in each solution) and dehydrated in xylene (100%, for > 10 minutes). The sections were mounted in Pertex (Histolab) and covered with a coverslip.

[0160] Peroxidase histochemistry

[0161] To detect peroxidase (PO) activity and its increase due to Hb, and to be able to determine its distribution in the brains of all animal groups, we performed an adapted protocol for enhanced frozen section peroxidase reaction. Briefly, the sections were air-dried at RT or 37 °C for 20 - 30 min and then rinsed in PBS 2x10 min. The peroxidase reaction was carried out for 10 min at RT in a solution containing 3,3'-diaminobenzidine (DAB, 0.5 mg / ml diluted in PBS, Sigma-Adrich) containing 0.015% H 2 O 2 (Merck, USA). The sections were then rinsed in PBS 3x5 min and rinsed in H 2 O for 1 min. Counterstaining was performed using hematoxylin (HTX, Mayers, Histolab) by immersing the sections in HTX for 2 min and rinsing in dH 2 O 3x1 min. The sections were then dehydrated in alcohol (70% for 1 min, 96% for 2x5 min and 100% for 2x7 min) and dehydrated in xylene (100% for 2x5 min). The sections were mounted in Pertex (Histolab) and covered with a coverslip.

[0162] Histological evaluation

[0163] Histological evaluation of the degree of IVH was performed to compare and validate HFU examination. The evaluation was carried out in three steps. First, overall image analysis was initiated and a macroscopic morphological assessment of any bleeding location was made. Then, a visual evaluation of the whole brain was performed within the range of bleeding located in any arachnoid, parenchyma, ventricle, cerebellum or brainstem. Subsequently, the degree of ventricular dilation, any findings of tissue atrophy or necrosis and the overall bleeding score in three blocks were evaluated. Next, different sections were stained with hematoxylin / eosin to determine hemoglobin (Hb) leakage of red blood cells and free Hb content, and then immunohistochemical labeling of PO was performed to quantify Hb in adjacent sections. Image analysis and scoring were performed without the operator's knowledge.

[0164] Serum IGF-1 levels

[0165] Serum IGF-1 concentration was determined using a human IGF-1 ELISA kit (Mediagnost, Reutlingen, Germany). The analysis was performed according to the manufacturer's instructions, which state that the assay is suitable for rabbit serum samples.

[0166] Sex determination

[0167] The sex of rabbits was determined by visual confirmation of the presence of the sex-determining region Y gene (Gene ID: 100328958) in the rabbit genome using PCR and gel electrophoresis, as previously described (1). Briefly, DNA was extracted using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. One (1) μl of DNA was used in the corresponding PCR reaction (30 cycles, 57 °C) with the following primers: forward: TGCAATACAGGAGGAACACG, reverse: AGCAAACTGTCGCTCTTCTG. The presence of a band at approximately 299 bp was determined as male, and correspondingly, the absence of a visible band was determined as female.

[0168] Statistical power determination and data analysis

[0169] Based on the prevalence of IVH in Experiment A, a power estimate was conducted to calculate the group sizes for Experiment B. The aim was to obtain a 50% treatment effect, and the calculation was based on the numbers reported in the randomized controlled clinical trials reported by Ley et al. (6). Calculations were performed using power (1-β = 0.80) and type I error (α = 0.05) to obtain the number of subjects and group sizes (see sample sizes in the results).

[0170] One-way analysis of variance with correction for multiple comparisons (Bonferroni) or mixed-effects analysis with two-way analysis of variance using Dunnett's multiple comparison test was used to calculate statistical significance. The Student's t-test was used to evaluate the comparison between the treatment and control groups. Fisher's exact test with p-values was used for categorical outcome analysis of contingency table data, and the difference between proportions was the attributable risk in percentage (%). Animals that died or were euthanized before the planned sacrifice were also included in the statistical analysis when possible. A p-value < 0.05 was considered significant. Statistical analysis was performed using GraphPad Prism (GraphPad Prism 9; GraphPad, San Diego, US).

[0171] Results

[0172] IVH induction rate

[0173] In Experiment A, when administered 6 hours after birth, the incidence of developing IVH was highest in premature rabbit pups after i.p. administration of a 50% glycerol solution, reaching an incidence of 66% (n = 4 / 6, see Table 4). At the later time points of induction (18 and 24 hours), the incidence decreased linearly (33%, n = 2 / 6; and 14%, n = 1 / 7, see Table 4). In this experiment, no animals (0%, n = 0 / 5, see Table 4) developed IVH in the group receiving glycerol at 12 hours of age. Based on these results, the time point of administering glycerol 6 hours after birth was used as the time point for inducing IVH in Experiment B.

[0174] Table 4

[0175]

[0176] Incidence of IVH (%) in Experiment A (n = 5 - 7). At 6, 12, 18, or 24 hours after birth, a bolus of 50% glycerol (6.5 g / kg) was administered i.p. to the animals. At 24 hours after glycerol administration, the degree of hemorrhage was evaluated by high-frequency ultrasound. Cerebral hemorrhage was scored as severe IVH or no IVH. i.p., intraperitoneal; IVH, intraventricular hemorrhage.

[0177] IVH incidence and sex distribution.

[0178] In Experiment B, at 48 hours, a numerical trend of decreased incidence of severe IVH was observed in the rhIGF-1 / rhIGFBP-3 group compared to the vehicle control group (21% vs. 28.2%, p-value 0.598). Notably, when comparing 48 hours to 24 hours, an increased difference in the incidence of severe IVH was observed between the rhIGF-1 / IGFBP-3 group and the vehicle group (7.2% vs. 4.6% respectively) (Table 3). The sex distribution was found to be uniform in the rhIGF-1 / IGFBP-3 group, while the sex distribution was slightly uneven in the vehicle group with a decreased number of males (Table 5).

[0179] Table 5

[0180]

[0181] Group size, IVH incidence (%), and sex distribution at 24 and 48 hours after glycerol administration in animals in Experiment B receiving 8 mg / kg rhIGF-1 / rhIGFBP-3 (n = 38) or vehicle (n = 39). p-values are from Fisher's exact test. rhIGF-1, recombinant human (rh) insulin-like growth factor-1 / rh insulin-like growth factor binding protein-3; IVH, intraventricular hemorrhage.

[0182] Histological analysis confirmed the ultrasound evaluation

[0183] To verify ultrasound examination in detecting the presence of IVH or other intracerebral hemorrhages, brain tissues were evaluated by histological analysis. Macroscopic tissue morphological evaluation showed that there was no hemorrhage in animals scored as having no IVH in ultrasound examination, as Figure 6 illustrated in Figure 6 A. In addition, all animals scored as having IVH in ultrasound were confirmed to have hemorrhage (as

[0184] illustrated in

[0185] B). PO staining further confirmed the results of ultrasound and morphological examinations. Figure 5 Survival at 48 hours after IVH was observed to be approximately 63.6% (n = 7 / 11) in the group administered with vehicle, and 87.5% (n = 7 / 8) in the group administered with rhIGF-1 / rhIGFBP-3 ( Figure 5 , Table 6). In animals without IVH, survival of animals administered with vehicle was 93.1% (n = 27 / 29), compared with 100% (30 / 30) in animals administered with rhIGF-1 / rhIGFBP-3 ( Figure 5 , Table 6). Overall survival, i.e., regardless of whether IVH developed, survival in animals administered with vehicle was 87.2% (n = 34 / 39), compared with 97.4% (37 / 38) in animals administered with rhIGF-1 / rhIGFBP-3 (

[0186] Table 6

[0187]

[0188] Serum IGF-1 levels

[0189] In Experiment A, the circulating levels of endogenous IGF-1 in premature rabbit pups showed a significant decrease in concentration ( Figure 7A ), from 78 ng / ml at 30 hours after birth to 57 ng / ml at 48 hours after birth (p = 0.020). Serum IGF-1 levels in animals developing IVH (70 ± 12) were not significantly different from those in animals without IVH (63 ± 13) (p = 0.539, Figure 7B ). These results showed good correspondence with previous experimental results, where the serum levels of rabbit pups of the same age ranged from 69 ng / ml at 24 hours after birth to 45 mg / ml at 48 hours after birth.

[0190] In Experiment B, compared to animals administered vehicle (no IVH, 39±16, n = 27; IVH, 48±15, n = 7), serum IGF-1 levels increased significantly (p<0.001) after rhIGF-1 / rhIGFBP-3 administration in animals without IVH (149±42; n = 29) and IVH animals (179±41; n = 7)( Figure 7C ). After administration of rhIGF-1 / rhIGFBP-3, there were no statistically significant differences in serum IGF-1 levels between animals developing IVH and those without IVH (p = 0.18 and 0.30).

[0191] Endogenous serum IGF-1 levels in premature rabbit pups (A) of Experiment A after administration of 50% glycerol. Blood was collected by decapitation 30, 36, 42, or 48 hours after C-section. n = 2 - 5. Box plots have minimum and maximum values. *p<0.05.

[0192] Serum IGF-1 levels in premature rabbit pups (B) with (n = 9) or without (n = 4) IVH 30 - 48 hours after C-section. Box plots have minimum and maximum values. (C) Serum IGF-1 levels 54 hours after birth after administration of rhIGF-1 / rhIGFBP-3 (8 mg / kg) or vehicle in Experiment B. Box plots have minimum and maximum values. Unpaired t-test ***p<0,001. Comparing the two treatment groups, there were no significant differences (p = 0.30 and 0.18; rhIGF-1 / rhIGFBP-3 group and vehicle group, respectively). C-section, cesarean section; IVH, intraventricular hemorrhage; IGF-1, insulin-like growth factor-1. rhIGF-1 / rhIGFBP-3, recombinant human (rh) insulin-like growth factor-1 / rh insulin-like growth factor binding protein-3.

[0193] Example 3

[0194] Premature rabbit pups (E29) were administered labeled (FITC, biotin, or Alexa Fluor-647) or unlabeled IGF-1 / IGFBP-3 (8 mg / kg) subcutaneously and followed for 5 hours and 24 hours. The brain was perfused and the presence of IGF-1 and its interaction with IGF-1R were studied using confocal microscopy, electron microscopy, and light sheet microscopy. In addition, the CP was collected and IGF-1R activation was analyzed using Western blotting.

[0195] Five hours after administration, IGF-1 / IGFBP-3 conjugated to Alexa Fluor-647 or biotin was detected in the CP, subfornical organ, and subarachnoid space( Figure 8, 9 and 10). Immunolabeling of FITC-conjugated IGF-1 in electron microscopy revealed the translocation of IGF-1 / IGFBP-3 through the CP ( Figure 10 bright area).

[0196] Western blot analysis showed an increase in the activation (i.e., phosphorylation) of the MAP kinase (as shown by p.ERK) and PI3-kinase (as shown by p.PKB) downstream of the IGF-1R after exposure to IGF-1 / IGFBP-3 ( Figure 11 ).

[0197] Blood-borne IGF-1 / IGFBP-3 binds to and translocates through the CP and activates its IGF-1 receptor in the premature rabbit brain.

[0198] This suggests that systemic administration of IGF-1 / IGFBP-3 has potential effects on the development of the immature brain.

[0199] Example 4 Choroid plexus extracellular vesicles transport blood-borne insulin-like growth factor 1 to the hippocampus of the immature brain

[0200] Materials and Methods

[0201] Premature rabbit pups

[0202] The animal protocol was approved by the Swedish Animal Ethics Committee in Lund (Dnr: 5.8.18-06020 / 2019). We used a well-established preterm rabbit pup model as previously described (42). New Zealand white rabbits (Egle Kergiene, Lundsbrunn, Sweden) were used. Briefly, the experiment was performed on a total of 9 rabbit pups (4 females and 4 males) from 7 litters, which were born by cesarean section (c.s.) after the female rabbits were anesthetized with intravenous propofol (Propofol-Lipuro) (20 mg / ml i.v., B. Braun Melsungen AG, Melsungen, Germany) at day 29 (full term 31-32 days). After birth, the pups were cared for and nursed by animal laboratory staff. The pups were dried and placed in an incubator for infants set at 30 °C and 60% humidity. At approximately 1-2 hours of age, the pups were weighed, marked, and hand-fed colostrum (100 ml / kg / day, Biodane Pharma, Gesten, Denmark) using a 4 French feeding tube (Vygon, Ecouven, France). At 12 hours of age, the pups received a mixture of colostrum and Fox Valley 30 / 50 (Melk voor Dieren, Rotterdam, the Netherlands) (1:1, v / v). From 24 hours onwards, the pups received only Fox Valley 30 / 50. The dosage of Fox Valley 30 / 50 was increased by 10 ml / kg / day every 24 hours. The feeding amounts at 12, 36, and 60 hours of age were reduced to half of the previous corresponding doses, i.e., 50 ml / kg at 12 hours of age (corresponding to half of 100 ml / kg at birth), etc. The pups were gently cleaned once or twice a day as needed to maintain hygiene.

[0203] Preterm piglets

[0204] All animal procedures were carried out in accordance with the Danish National Committee on Animal Experimentation (permit no. 2014-15-0201-00418). Preterm piglets were born by cesarean section at gestational day 106 (full term = 117 days), placed in individual incubators, and reared to 5 days (P5) or 9 days (P9) as previously described by L.I. Christiansen et al., Insulin-Like Growth Factor-1 Supplementation Promotes Brain Maturation in Preterm Pigs. eNeuro 10(2023). Animals were treated with vehicle (control group) or recombinant human (rh) IGF-1 / rhIGFBP-3 complex (2.25 mg / kg / d; mecasermin rinfabate, Takeda), given as a continuous systemic infusion via an arterial catheter until P5 and then three times daily until P9. The detailed feeding protocol and the physiological, behavioral, and clinical responses to IGF-1 treatment, including brain, gut, metabolic, and immune effects, are reported in separate articles (Christiansen et al. above, and K. Holgersen et al., Clinical outcome and gut development after insulin-like growth factor-1 supplementation to preterm pigs. Front Pediatr 10, 868911(2022)).

[0205] P9 pigs (used in this study) were anesthetized and then euthanized by intracardiac injection of sodium pentobarbital, and CSF was immediately collected by suboccipital puncture. CSF was centrifuged at 2500 x g for 10 min at 4°C, visually inspected for stick bleeding (to exclude blood contamination), and stored at -80°C.

[0206] Primary ChPE cell culture

[0207] The animal protocol was approved by the Swedish Animal Ethics Committee in Lund, Sweden (Dnr: 5.8.18-12930 / 2019). Primary murine ChPE cell cultures were performed as previously described (17). Briefly, brains were isolated from pups (C57Bl / 6Ncrl, Scanbur, Karlslunde, Denmark) 3-8 days old. The ChP was isolated from the lateral and fourth ventricles under a dissecting microscope (Nikon SMZ800N Stereomicroscope, Tokyo, Minato, Japan). Cells were further dissociated by enzymatic reaction with 2 mg / ml pronase (isolated from Streptomyces griseus, Merck, Burlington, MA, USA). The reaction was terminated by adding an excess of complete DMEM-F12 cell culture medium (Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS, Gibco) and 1% antibiotic-antimycotic (Gibco). The cells were then centrifuged at 1000 x g for 2 minutes, resuspended in DMEM-F12 medium, and plated (105 cells / well) on a 12-well transwell system (CLS3460-48EA, Sigma). The cells were incubated at 37 °C, 5% CO2 for 8-9 days. To eliminate fibroblast contamination, the cell culture medium was changed to complete DMEM-F12 medium containing cytosine arabinoside (Ara-C, Merck) 48 hours later. Thereafter, the complete DMEM-F12 medium was changed every 48 hours. The functional characteristics of ChPE cells were determined by positive labeling for TTR and ZO-1, negative labeling for fibroblast markers (S100A4 and Hsp47), and an increase in TEER during culture (described in detail in "Trans-epithelial electrical resistance (TEER)").

[0208] Trans-epithelial electrical resistance (TEER)

[0209] TEER analysis was performed to ensure that ChPE cells retained / established blood-brain barrier function and was performed using an EVOM2 (World Precision Instruments, Sarasota, FL, USA). The probe was sterilized by incubation in 70% ethanol for 15 seconds to 1 minute and washed with phosphate-buffered saline (PBS, pH 7.4). The same sterilization step was performed between each TEER measurement. The TEER measurement of wells containing only complete DMEM-F12 cell culture medium was used as a blank, and the obtained readings were subtracted from all measurements. The filter membrane diameter was multiplied by all measurements minus the blank, and the resistance was expressed as Ω.cm2.

[0210] IGF-1 exposure in ChPE cell culture

[0211] After culturing ChPE cells for 8 - 10 days, the cell resistance readings reached 80 - 110 Ω.cm2 and were considered ready for experimental exposure (14). The cell medium was changed to complete DMEM-F12 containing 10% exosome-depleted FBS (Gibco) and maintained for 24 hours. Thereafter, 4 hours before IGF-1 exposure, the cell medium was changed to DMEM-F12 containing 2% exosome-depleted FBS. Human IGF-1 (R&D systems, 291-G1, Minneapolis, MN, USA) at 40, 100, or 250 ng / ml was added to the basolateral region (corresponding to the circulation / blood compartment), and the ChPE cell cultures were exposed for 24 hours. Subsequently, the apical supernatant (corresponding to the CSF compartment) and the basolateral supernatant were collected and stored at -80 °C until subsequent EV preparation and analysis (see "EV preparation" for additional details).

[0212] Diffusion assay

[0213] ChPE cell cultures were prepared as described in "Primary ChPE cell culture". Next, the transwell was transferred to a new multi-well plate, and 800 μl of phenol red-free MEM (Gibco) was added to the basolateral compartment. The cell medium (MEM) in the apical compartment was replaced with 250 μl of a 1 mg / ml 20 kDa FITC-dextran solution (Merck). The ChPE cells were incubated in the dark at room temperature for 20 minutes. Subsequently, the basolateral medium was collected, and 100 μl aliquots were transferred to a 96-well microtiter plate in triplicate and read on a VICTOR3 plate reader (Perkin Elmer, Waltham, MA, USA) at 490 nm (excitation) and 520 nm (emission).

[0214] EV preparation

[0215] To prepare EVs from the ChPE cell culture supernatant, the miRCURY exosome kit (Qiagen, Hilden, North Rhine-Westphalia, Germany) was used according to the manufacturer's instructions. Briefly, the samples were centrifuged at 3000 x g for 8 minutes to remove debris. Precipitation medium (0.4x) was added to the supernatant and incubated overnight at 4 °C. The precipitation solution was centrifuged at 10000 x g at 20 °C, and the supernatant was carefully aspirated and stored at -80 °C. The EV pellet was resuspended in 40 - 100 μl of the provided resuspension medium and stored at -80 °C or further prepared for NTA. For subsequent MS analysis, the pellet was directly stored at -80 °C.

[0216] EV Quantity and Size Measurement

[0217] To determine the EV size and concentration, NTA was used. Briefly, EVs were prepared as described above, diluted 1 / 10 in PBS, and injected into a NanoSight (LM14C, Malvern Panalytical, Malvern, U.K.). All samples were recorded for 90 seconds at a camera level of 15 and a detection threshold of 5, in triplicate. The absolute numbers were calculated using acquisition software (NTA version 3.3, MalvernPanalytical).

[0218] Immunofluorescence Microscopy and Image Analysis

[0219] Primary ChPE cells were fixed in 4% buffered paraformaldehyde (PFA prepared in PBS, pH 7.4) for 15 minutes and washed three times with PBS. The cells were then permeabilized with 0.1% Triton X-100 (0.1% in PBS, Invitrogen, Waltham, MA, USA) for 10 minutes, followed by blocking with 10% FBS for 1 hour, and incubated overnight and for 1 hour at 4°C and room temperature, respectively, with primary and secondary antibodies (described below). The following primary antibodies were used: Hsp47 (1:200, rabbit anti-mouse, ab109117, Abcam, Cambridge, UK), S100A4 (1:250, rabbit anti-mouse; ab197896, Abcam), IGF-1 (1:100, rabbit anti-mouse, bs-0014R, Bioss, Woburn, MA, USA), IGF-1 (1:100, goat anti-mouse, AF791, R&D systems), IGF-1R (1:20, goat anti-mouse, AF-305-NA, R&D systems), ZO-1 (1:50, rabbit anti-mouse, 61-7300, Thermo Fisher Scientific, Waltham, MA, USA), donkey anti-goat 647 (1:500, A-21447, Thermo Fisher Scientific), TTR (1:50, sheep anti-mouse, ab9015, Abcam), CD63 (1:100, rabbit anti-mouse, ab217345, Abcam). The following secondary antibodies were used together with the corresponding primary antibodies: donkey anti-goat 488 (1:500, A-11015, Thermo Fisher Scientific), goat anti-rabbit 488 (1:500, ab150077, Abcam), goat anti-rabbit 568 (1:500, ab175471, Abcam), and donkey anti-sheep 488 (1:400, A-11015, Thermo Fisher Scientific). The membranes were counterstained with Hoechst (1:10,000 in DMSO, H1398, Invitrogen) for 5 minutes at room temperature and mounted using a mounting medium (Merck). To visualize the samples, a Nikon Confocal A1RHD confocal microscope (Nikon, Minato, Tokyo Japan) was used.

[0220] Electron microscope

[0221] Prepare ChPE-derived EVs as described in "EV preparation". Fix 30 μl of the EV preparation with 30 μl of 4% PFA for 30 minutes at room temperature. Place a drop (about 5 μl) of the fixed EV suspension on a Formvar-carbon-coated electron microscopy grid and air-dry for 20 minutes at room temperature. Next, to wash the sample, place the grid above a drop of 100 μl of PBS on the surface of a clean paraffin film. All subsequent steps are carried out in the same manner.

[0222] Block the grid with 1% bovine serum albumin (BSA, diluted in PBS) and incubate with primary antibodies against IGF-1 (1:100, rabbit anti-mouse, bs-0014R, Bioss) and Flotillin2 (5 μg / ml, rabbit anti-mouse, ab96507, Abcam) for 120 minutes at room temperature. Incubate the goat anti-rabbit IgG (H+L) 10 nm gold conjugate (17010-1, Ted Pella, Redding, CA, USA) with the secondary antibody for 60 minutes at room temperature.

[0223] The ChPE cells cultured as described in "Primary ChPE Cell Culture" were pre-fixed with 4% PFA for 1 hour and then rinsed several times with Sorensen phosphate buffer (0.1M). The cells were then dehydrated in a 6-step series with acetone in distilled water, with the acetone concentration increasing in each step (30 - 100%). The time for each step was 5 - 10 minutes. The cells were then soaked overnight in a 1 / 1 mixture of acetone and Epon (Agar Scientific Ltd, Stansted, Essex England). Next, the cells were embedded in Epon and then polymerized in Epon at 60 °C for 48 hours and ultrathin sectioned into 60 nm thick sections. Subsequently, they were blocked with 1% BSA in distilled water for 1 hour and then the cells were incubated overnight at 4 °C with primary antibodies against IGF-1 (1:100, goat anti-mouse, AF791, R&D systems) (1:100, goat anti-human, AF291, R&D systems) and Flotillin2 (10 μg / ml, rabbit anti-mouse, ab96507, Abcam). The rabbit anti-goat IgG (H+L) 10 nm gold conjugate (1 / 20, 17410-1, Ted Pella, Redding, CA, USA) and the goat anti-rabbit IgG (H+L) 10 nm gold conjugate (1 / 20, 17010-1, Ted Pella, Redding, CA, USA) were incubated with the secondary antibodies for 60 minutes at room temperature. The sections were stained with uranyl acetate (4%, Agar scientific) at 38 °C for 20 minutes. All samples (including EV and ChPE cells) were examined in a FEI Technai Biotwin 120kv TEM operating at an accelerating voltage of 100 kV. Images were recorded with a side-mounted Olympus Veleta camera at a resolution of 2048 × 2048 pixels (FEI, Hillsboro, OR, USA).

[0224] Liquid chromatography - mass spectrometry

[0225] 100 μL of Ripa buffer (R0278, Sigma - Aldrich) was added to the sample prepared as described in "EV Preparation", and then sonicated using a Bioruptor (Diagenode) for 40 cycles (15 s on, 15 s off). The sample was reduced with dithiothreitol to a final concentration of 10 mM and heated at 56 °C for 30 min, then alkylated with iodoacetamide at room temperature in the dark to a final 20 mM for 30 min. The sample was precipitated overnight at -20 °C with ice - cold ethanol (final concentration of ethanol 90%), then centrifuged at 14000 x g for 10 min. The pellet was air - dried and resuspended in 50 μL of 100 mM ammonium bicarbonate and sonicated using a Bioruptor (Diagenode) for 40 cycles (15 s on, 15 s off). Protein concentration was measured at 280 nm using a NanoDrop (DeNovix DS - 11, DeNovix Inc; Wilmington, DE, USA). Digestion was performed by adding trypsin (sequencing grade modified trypsin, Part No. V511A, Promega) at a ratio of 1:50 to the sample and incubating overnight at 37 °C. Digestion was stopped with 5 μL of 10% trifluoroacetic acid. The sample was concentrated (Speed Vac) to dryness and dissolved in 2% ACN, 0.1%. The extracted peptides were analyzed on an Exploris 480 mass spectrometer (Thermo Fischer Scientific) coupled to a Vanquish Neo UHPLC system (Thermo Fischer Scientific). A dual - column setup was used on the HPLC system, and the peptides were loaded onto an Acclaim PepMap 100 C18 preparative column (75 μm x 2 cm, Thermo Scientific, Waltham, MA), then separated at a flow rate of 300 nL / min on an EASY spray column (75 μm x 25 cm, C18, 2 μm, ES902). The column temperature was set at 45 °C. A 90 - min non - linear gradient was obtained using solvent A (water containing 0.1% FA) and solvent B (80% ACN containing 0.1% FA), from 5% to 25% solvent B for 75 min, then increased to 32% for 9 min, and increased to 45% for 6 min to elute the peptides.

[0226] The sample was analyzed in positive mode using data - dependent acquisition (DDA). Full mass spectrum Figure 1(MS1) The resolution was set to 120,000, m / z 200, and the normalized AGC target was set to 300%, with a maximum injection time of 45 ms. The full mass range was set to 375 - 1500 m / z. The precursor was separated using a 1.3 m / z isolation window and fragmented using normalized collision energy 30 by HCD. Full MS Figure 2 (MS2) Detection was performed in the Orbitrap with a resolution of 15,000. The normalized AGC target and maximum injection time were set to 100% and custom, respectively. The intensity threshold for precursor selection was set to 1e4, and 40 s of dynamic exclusion was applied.

[0227] Data analysis of mass spectrometry data

[0228] The raw DDA data was analyzed using Proteome Discoverer TM 2.5 software (Thermo Scientific, Waltham, Massachusetts, USA) and peptides were identified using SEQUEST HT against the UniProtKB Mouse canonical database (UP000000589) and the fasta file of human IGF1 (P05019). The search was performed using the following applied parameters: carbamidomethylation of cysteine as a static modification; and N-terminal acetylation and methionine oxidation as dynamic modifications. The precursor tolerance was set to 10 ppm and the fragment tolerance was set to 0.02 ppm. Up to 2 missed cleavages were allowed and Percolator was used for peptide validation with a q-value of maximum 0.01. The extracted peptides were used for identification and quantification by label-free relative quantification. The extracted chromatographic intensities were used to compare the peptide abundances between samples.

[0229] The protein abundances were submitted to the online tool Proteomill (https: / / proteomill.com)(44). The missing values were set such that each protein had at least four 6 values in each group. Enrichment analysis was performed by searching the Reactome pathways and GO terms in the GO, David, and Metascape databases (24 - 26,45).

[0230] Intracerebroventricular injection in vivo

[0231] The EVs prepared as described in "IGF-1 exposure of CPE cell cultures" and "EV preparation" were stained with the PKH26 Red Fluorescent Cell Linker Mini Kit (for general cell membrane labeling) (Merck, MINI26) as per the manufacturer's description. Briefly, 400 μl of ChPE supernatant was mixed with PBS and PKH26 (1:200) to a total volume of 800 μl and then incubated at room temperature for 20 minutes. After that, exosome isolation was performed as described in "EV preparation" and the pellet was resuspended in 50 μl of PBS. Under the guidance of high-resolution ultrasound RU (Vevo 2100, VisualSonics Inc., ON, Canada) with an MS-550D 40 MHz transducer, 25 μl of the stained EVs were injected i.c.v. into unsedated premature rabbit pups at 24 hours postnatal age using a BD Microfine + 0.3 ml (30 gauge). The premature rabbit pups were followed for 4.5 hours and anesthetized by a combination of intramuscular (i.m.) injection of Ketaminol vet. (50 mg / ml, Intervet AB, Stockholm, Sweden) and Rompun vet. (20 mg / ml, Bayer Animal Health, Leverkusen, Germany) with isoflurane inhalation (Attane vet, 1000 mg / g, VM Pharma AB, Stockholm, Sweden). After sedation, the rabbits were perfused transcardially with freshly prepared PBS (containing 1000 IU / ml heparin), followed by perfusion with freshly prepared 4% paraformaldehyde (PFA, VWR Chemicals, Leuven, Belgium, buffered with PBS, pH 7.4). After fixation, the brains were removed from the skulls and post-fixed by immersion in 4% PFA. The PFA was changed to fresh after 6 - 8 hours and then the brains were immersed in PFA at 4 °C for a total of 24 hours and transferred to PBS for further processing as described in "Histological detection of EVs administered in rabbit pups' brains" below.

[0232] Histological detection of EVs administered in rabbit pups' brains

[0233] The brain was removed and immersed entirely in PFA (4% in PBS, pH 7.4; PFA) at 4 °C for 16 h. Subsequently, the brain was sectioned coronally into two pieces in the midbrain (near the subfornical organ) and incubated in PFA at room temperature for 4 h. Next, the brain was rinsed in PBS (pH 7.4) at 4 °C for 8 h, embedded in OCT cryomount (Histolab, Sweden) and frozen in isopentane on dry ice (at approximately -60 °C). Sections (10 μm thickness) were cut through the midbrain using a cryostat and sections containing the lateral and central ventricles, choroid plexus and hippocampus were collected on SuperFrost Plus slides (Thermo Scientific / Gerhard Menzel B.V. & Co., Braunschweig, Germany). After rinsing in PBS (2 x 5 min), the sections (3 - 6 per animal) were incubated in 4',6-diamidino-2-phenylindole (DAPI) for 15 min at room temperature and then mounted and coverslipped in Fluoroshield (Abcam) anti-fade mounting medium. Analysis was performed using a confocal laser scanning microscope (Zeiss LSM 800, ZEIZZ, Oberkochen, Germany). Detection of PKH26 (stained vesicles) was performed with an excitation maximum set at 551 nm and an emission maximum set at 567 nm. Sequential scans of PKH26 and DAPI were performed in order to analyze the distribution and location of PKH26 fluorescence, mainly in the ChP, ventricular ependyma and hippocampal parenchyma. Both hemispheres were analyzed. A threshold detection level of PKH26 in brain sections from animals receiving only the dye (without vesicles) was set. Representative images were captured and converted to TIFF format for illustration.

[0234] In vitro EV uptake experiments using hippocampal neurons

[0235] Wistar rats were obtained from Charles River (Sulzfeld, Germany) and handled according to the Danish Animal Welfare Act approved by the Department of Experimental Medicine, University of Copenhagen (Copenhagen, Denmark).

[0236] According to (46), primary hippocampal neurons were isolated from Wistar rat embryos at embryonic day 19. The dissected hippocampi were minced in ice-cold Krebs-Ringer buffer (KRB, Invitrogen) and treated with 0.1% (w / v) trypsin for 6 - 7 minutes at 37 °C, followed by incubation with 0.052% (v / w) trypsin inhibitor and 0.008% (v / w) DNase I diluted in KRB. The undissociated tissue was pelleted by centrifugation and the neurons were resuspended in KRB (Invitrogen) containing 0.13 mM Ca2+ and 2.4 mM Mg2+. The cells were pelleted by centrifugation and resuspended in NeurobasalTM medium supplemented with 2% (v / v) B27, 100 U / ml penicillin, and 100 μg / ml streptomycin (all from Invitrogen). The neurons were then plated at a density of 5×104 cells / cm2 in eight-well LabTek Permanox chamber slides (Nunc, Roskilde, Denmark) pre-coated with 20 μg / ml poly-L-lysine and cultured in vitro for 8 - 10 days, with half of the medium changed on the second and seventh days.

[0237] For the uptake experiment, ChPE-derived EVs were stained with the PKH67 Green Fluorescent Cell Linker Mini Kit (Merck, MINI67) for general cell membrane labeling as described by the manufacturer. Briefly, 400 μl of ChPE supernatant was mixed with PBS and PKH67 (1:200) to a total volume of 800 μl and then incubated at room temperature for 20 minutes. Exosome isolation and resuspension of the pellet in 300 μl of PBS were then performed as described in "EV preparation". Subsequently, the neurons were stimulated with PKH67-stained EVs for 2 hours. For each slide, the wells with unstimulated cells were used as controls and the wells with only PKH67-stained supernatant without cells were used as negative controls.

[0238] The cells were then washed with PBS, fixed with 4% PFA for 20 minutes, blocked with 5% BSA, and labeled overnight at 4 °C with polyclonal rabbit anti-rat growth-associated protein 43 (GAP-43) antibody (1:1000; Millipore), and then incubated with secondary antibody goat anti-mouse Alexa Fluor 546 conjugated antibody (1:1000; Invitrogen). For visualization of nuclear morphology, the cells were counterstained with Hoechst 33258 (1:1000; Invitrogen) and mounted with anti-fade mounting medium (Dako, Glostrup, Denmark). Images were recorded in a series of fields of view of the system over the entire area of the well using a ZEIZZ confocal laser scanning microscope (ZEIZZ LSM800, ZEIZZ, Oberkochen, Germany).

[0239] For PKHK67 fluorescence analysis, since the plastic membrane could not be scanned, the slides had to be scanned manually. The focus was set manually for each desired image. To obtain digital images, a wide-field epifluorescence microscope (Olympus IX70, Tokyo, Japan) equipped with a digital detector (DP80, Olympus) was used under fixed illumination conditions, and the regions of interest (ROIs) were annotated manually. The images were exported as TIFF and imported into Fiji. The green signal (PHKH67) for each number of nuclei was quantified to determine the fluorescence. The number of nuclei was calculated using Fiji by the default auto threshold segmentation method and watershed separation after primary smoothing, or counted manually if cell separation was not achieved. Small objects that did not belong to the size of the nuclear body were removed.

[0240] Sex determination

[0241] As in A. As described by [authors] in "Insulin-like growth factor 1 has multisystem effects on foetal and preterm infant development. Acta Paediatr 105, 576-586 (2016)", rabbit gender was determined by using PCR and gel electrophoresis visualization to identify the presence of the sex-determining region Y gene (Gene ID: 100,328,958) in the rabbit genome. Briefly, DNA was extracted from ear biopsies using the DNeasy Blood and Tissue kit (Qiagen) according to the manufacturer's instructions. 1 μl of DNA (range: 100-200 ng / μl) was used in the PCR reaction (30 cycles, 57 °C) with the following primers: forward: TGCAATAC AGGAGGAACACG, reverse: AGCAAACTGTCGCTCTTCTG. The presence of a band at approximately 299 bp determined the animal to be male, and the absence of a corresponding band determined the animal to be female.

[0242] Statistical results

[0243] Statistical significance was calculated using one-way ANOVA, where multiple comparisons of the means were made using post hoc Tukey, or paired comparisons were made using the Student's t-test. A P-value < 0.05 was considered significant. Data are presented as mean ± SD. All statistical analyses were performed using R version 4.3.1.

[0244] Results

[0245] Table 7 Top 20 out of the top 100 proteins frequently identified in EVs

[0246] (http: / / microvesicles.org / index.html)

[0247]

[0248]

[0249] IGF-1 is located in the intracellular vesicles of the primary murine ChPE transwell cell culture model of neonatal mice

[0250] To characterize how circulating human IGF-1 (hIGF-1) affects EV secretion and its content in neonatal ChPE cells, we established a transwell in vitro cell culture system using primary murine ChPE cells from 3-8 days after birth. In this system, exposure to circulation can be mimicked from the basolateral side, while the CSF side is represented by the apical side, see Figure 12ASchematic diagram in. As previously described (T.R. Menheniott, M. Charalambous, A. Ward, Derivation of primary choroid plexus epithelial cells from the mouse. Methods Mol Biol 633, 207-220 (2010)), cells were cultured and the model was characterized by verifying the positive expression of the ChPE markers transthyretin (TTR, green) and zonula occludens-1 (ZO-1, red) (Table 7, respectively Figure 12A and B) (I. Kratzer, J. Ek, H. Stolp, The molecular anatomy and functions of the choroid plexus in healthy and diseased brain. Biochimica et Biophysica Acta (BBA)-Biomembranes 1862, 183430 (2020)). In addition, the absence of fibroblast contamination was confirmed by labeling with S100A4 and heat shock protein (Hsp) 47 (Table 7, Fig. 12C and D) (183430 (2020). F. Strutz et al., Identification and characterization of a fibroblast marker: FSP1. J Cell Biol 130, 393-405 (1995), T. Miyamura et al., Small molecule inhibitor of HSP47 prevents pro-fibrotic mechanisms of fibroblasts in vitro. Biochemical and Biophysical Research Communications 530, 561-565 (2020)). In addition, the formation of the blood-CSF barrier was confirmed by trans-epithelial electrical resistance (TEER) measurements and by performing transcytosis assays (Table 7, Fig. S12E and F) (B. Srinivasan et al., TEER measurement techniques for in vitro barrier model systems. J Lab Autom 20, 107-126 (2015)). After 24 hours of basolateral exposure to 40 ng / ml hIGF-1, the presence of IGF-1 was observed within cultured ChPE cells using confocal optical microscopy (Figure 12B (middle left). Additionally, labeling against IGF-1R also showed positive signals within ChPE cells (S1 Appendix, Figure 19 ). Interestingly, co-labeling with the late endosomal marker CD63 (characteristic of multivesicular bodies) (Z. Andreu, M. -Mó, Tetraspanins in extracellular vesicle formation and function. Front Immunol 5, 442 (2014)) showed co-localization with IGF-1, IGF-1R, and TTR, indicating the intracellular vesicular localization of IGF-1, its receptor, and TTR ( Figure 12B far right and Table 7, Figure 19 ). Additionally, TEM immunogold labeling of the exosome marker flotillin-2 showed the presence of intracellular membrane-enclosed vesicles (Figure 12C, white arrows), indicating the production of EVs (20). Additionally, immunogold labeling against IGF-1 revealed its accumulation within intracellular membrane-enclosed vesicles (Figure 12D and E, white arrows). The accumulation of IGF-1 was also visible in ChPE mitochondria (Figure 12F), and TEM analysis revealed the presence of IGF-1 in membrane budding in ChPE cells (Figure 12G), and indicated the release of IGF-1-positive vesicles into the extracellular space (Figure 12G and H, white arrows). Notably, since the antibody used detects two epitopes, it was not possible to determine whether the IGF-1 retained within the vesicles was hIGF-1 or murine IGF-1.

[0251] ChPE cells secrete IGF-1-positive EVs after hIGF-1 stimulation

[0252] Next, our aim was to evaluate whether hIGF-1 is transported from intracellular vesicles in ChPE cells to the extracellular space. Neonatal primary murine ChPE cells were exposed basolaterally to hIGF-1 (40, 100, and 250 ng / ml) for 24 hours, and the apical supernatant was collected for subsequent EV preparation and analysis. Successful EV preparation was verified by TEM analysis, and the presence of exosomes was confirmed by showing positive labeling of the exosome marker flotillin-2 in the ChPE cell secretory supernatant ( Figure 13 A). TEM analysis of IGF-1 using immunogold labeling showed the presence on / in purified vesicles (larger and smaller vesicles) ( Figure 13B). Notably, since the antibody used detects two epitopes, hIGF-1 and murine IGF-1 cannot be separated. Subsequently, we analyzed the amount of EVs released into the apical supernatant after exposing ChPE cells to 40 - 250 ng / ml hIGF-1, which was measured by nanoparticle tracking analysis (NTA). Compared to the control group, exposure to 40 ng / ml hIGF-1 (but not 100 and 250 ng / ml) showed a significant increase in EVs released by ChPE cells ( Figure 13 C and D). Based on these results, 40 ng / ml hIGF-1 was used in subsequent experiments.

[0253] Proteomics analysis revealed the presence of hIGF-1 in ChPE-derived EVs after hIGF-1 stimulation

[0254] Next, we asked whether the proteome of EVs purified from the ChPE cell supernatant (obtained by mass spectrometry (MS) analysis) would change after hIGF-1 exposure. Overall, when the significance criterion was set to an adjusted p-value (Benjamini-Hochberg corrected p-value ≤ 0.05), hIGF-1 induced marginal effects (Figure 14A). Interestingly, hIGF-1 was significantly enriched with transmembrane P24 trafficking protein 2 (Tmed2) (important for intrauterine embryonic development) (R. Aber, W. Chan, S. Mugisha, L. A. Jerome-Majewska, Transmembrane emp24 domain proteins in development and disease. Genet Res (Camb) 101, e14 (2019)) (Figure 14A, yellow dots, and B). Next, we submitted proteins with less stringent significance criteria (log fold change ≥ 1 and ≤ -1, and p-value ≤ 0.05) (Figure 14A, red and blue dots) to Metascape. The top 4 outputs showed enrichment of pathways involved in the cellular response to amyloid-β, translational regulation, regulation of postsynaptic organization, and regulation of cell morphogenesis after hIGF-1 stimulation (Figure 14C). After hIGF-1 stimulation, the inhibitory pathways in ChPE cell-derived EVs were the formation of the cornified envelope and intermediate filament organization (Figure 14D).

[0255] The EV proteome in the ChPE supernatant is similar to that in the CSF of premature piglets

[0256] To expand our understanding of the effects of systemic hIGF-1 on EVs secreted by the ChP, we investigated whether the EV proteome derived from hIGF-1-exposed ChPE cells was similar to that of EVs derived from the CSF of preterm piglets. Preterm piglets born at gestational age 106 days (term = 117 days) by cesarean section were exposed to recombinant hIGF-1 (complexed with IGF-1 binding protein 3 and hereafter referred to as hIGF-1, 2.25 mg / kg / day, via continuous infusion) or the corresponding vehicle solution (control group) for 9 days, and CSF was collected at the time of sacrifice. Proteomic analysis (using MS analysis, with the significance criterion set as adjusted p-value (Benjamini-Hochberg corrected p-value ≤ 0.05)) showed a pattern similar to that of EVs derived from ChPE cells, with only minor changes in the proteome after hIGF-1 exposure (Fig. 15A). Consistent with EVs derived from ChPE cells, submitting proteins with a less stringent significance criterion (log fold change ≥ 1 and ≤ -1, and p-value ≤ 0.05) to Metascape identified additional pathways, including the inhibition of intermediate filament organization after exposure to hIGF-1 (Fig. 15B), further supporting the similarity between the two proteomic datasets. Notably, no enriched pathways were found in EVs derived from the CSF of preterm piglets after IGF-1 treatment. Examining the total proteome of all conditions and comparing the proteins identified in EVs derived from the ChPE cell supernatant (1396 unique proteins) and EVs derived from the CSF of preterm piglets (1759 unique proteins), we observed 50 - 60% overlap between the proteomes (Fig. 4C). To identify the pathways enriched in the proteome of EV samples, we performed pathway analysis using Metascape (Y. Zhou et al., Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10, 1523 (2019)).Among the top 20 enriched pathways, comparing the two datasets, 5 in the Reactome gene set (M. Gillespie et al., The reactome pathway knowledgebase 2022. Nucleic Acids Research 50, D687-D692 (2021)) and 2 in the GO biological process (M. Ashburner et al., Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25-29 (2000)) were similarly enriched (Figure 4D). One of the top-enriched Reactome pathways in both datasets was vesicle-mediated transport (Figure 4D and 3B), and 17-18 of the top 20 most common EV markers (published on the Vesiclepedia website (http: / / microvesicles.org / index.html)) (H. Kalra et al., Vesiclepedia: a compendium for extracellular vesicles with continuous community annotation. PLoS Biol 10, e1001450 (2012); and M. Pathan et al., Vesiclepedia 2019: a compendium of RNA, proteins, lipids and metabolites in extracellular vesicles. Nucleic Acids Res 47, D516-d519 (2019)) were identified in both datasets ( Figure 18 , Table 7), indicating successful preparation of EVs from ChPE supernatant and preterm piglet CSF.

[0257] ChPE-derived EVs penetrated into the hippocampus of the preterm rabbit brain

[0258] Our aim was to investigate whether hIGF-1-stimulated ChPE-derived EVs could be delivered to the target subcortical structures. Therefore, using a preterm rabbit pup model, we studied the distribution of purified and labeled ChPE cell-derived EVs in the immature brain after intracerebroventricular (i.c.v.) injection. EVs prepared in vitro from hIGF-1-stimulated or control neonatal primary murine ChPE cells were stained with PKH26 and subsequently i.c.v. injected (ultrasound-guided) into the lateral ventricles of unanesthetized preterm rabbit pups (Table 7, Figure 20)。After 4.5 hours, the pups were sacrificed, and the brains were collected and analyzed using a confocal microscope. A schematic diagram of the experimental outline is presented in Figure 16 A. Analysis revealed the presence of vesicles or organelle-like structures corresponding to EVs outside the inner layer of the hippocampal ependyma ( Figure 16 B and C). In addition, it has been shown that EVs penetrate deeper into the hippocampus, reaching the pyramidal and molecular levels of the hippocampal cornu ammonis (CA) 2-CA3 regions ( Figure 16 D). No difference in EV uptake was found compared to EVs derived from hIGF-1-stimulated ChPE cells or control cells (data not shown). Injection of only the PKH26 dye resulted in negligible signal in the study area (Table 7, Figure 21 ).

[0259] EVs derived from ChPE cells are internalized by hippocampal neurons in vitro

[0260] To further characterize the interaction between the ChP and the hippocampus mediated by EVs, we performed EV uptake experiments in vitro. Primary rat hippocampal neurons were incubated with purified EVs derived from neonatal primary murine ChPE cells, which were labeled with the membrane label PKH67 (green). After two hours of exposure, the neurons were fixed, labeled with GAP-43 (red), and analyzed using a confocal microscope, as shown in Figure 16 A. Interestingly, it was observed that EVs were readily taken up in the cytoplasm and neurites ( Figure 16 E). In addition, when we compared the exposure of neurons to EVs from hIGF-1-stimulated ChPE cells with that from unstimulated control ChPE cells, we observed a trend towards increased uptake after hIGF-1 stimulation (p = 0.07) ( Figure 16 F). Hippocampal neurons exposed only to the PKH67 dye showed dye uptake, but were very different from neurons exposed to stained EVs (Table 7, Figure 22 A), and no PKH67 signal was detected in neurons exposed to PBS (Table 7, Figure 22 B).

[0261] Discussion

[0262] The ChP is regarded as the gateway to the brain. Here, we describe the ChP as a channel for blood-borne IGF-1 to enter the deep parts of the developing brain parenchyma, including the hippocampus. We demonstrated that the transport of IGF-1 seems to occur via EVs derived from ChPE. In addition, our experiments showed that IGF-1 affects the secretion of EVs derived from ChPE, increasing the number of secreted EVs and the amount of cargo they carry.

[0263] The growth factor IGF-1 receptor is abundantly expressed in the ChP, providing a possible ligand-receptor interaction for IGF-1 at the blood-CSF barrier, thus enabling interaction between the CSF and blood sides. Interestingly, Pulford et al. demonstrated that the uptake of IGF-1 from the circulation is independent of GF-1R or binding proteins, and we observed a large amount of IGF-1R on the CSF-facing side rather than the blood side of the ChP. Therefore, we hypothesized that the transport of IGF-1 from the circulation to the immature brain might involve the endocytic uptake of IGF-1 via the ChP, and subsequent EV secretion into the CSF. The transport of IGF-1 from the blood to the brain via interaction with the ChP has been previously studied. For example, Carro et al. demonstrated that in an adult mouse exercise model, the ChP is the major route for uptake from the blood to the parenchyma. However, to our knowledge, our study is the first to investigate the effect of IGF-1 on EV formation and secretion from the ChP in the context of the immature brain. By stimulating ChPE cells in our transwell in vitro model with IGF-1 at the basolateral side (i.e., corresponding to the blood side), we observed the uptake and accumulation of IGF-1 in membrane-bound vesicles in ChPE cells. We further observed that IGF-1 translocated to the apical supernatant via intracellular vesicles through the ChPE, after which IGF-1-positive EVs were secreted into the apical medium, i.e., corresponding to the CSF. Interestingly, we also observed that the intracellular vesicles carrying IGF-1 showed positive immunolabeling for IGF-1R, indicating that the packaging of IGF-1 might occur together with its receptor. To investigate the relevance of the in vitro EV-IGF-1 transport findings, we characterized the proteomic content of EVs derived from ChPE cells and compared it with the proteomic content of EVs derived from the CSF of preterm piglets after systemic exposure to hIGF-1. Encouragingly, the analysis showed a high degree of similarity between the two datasets, including 60% of the proteome being identical, and the vesicle-mediated transport pathways being enriched in both datasets. Although globally, we only observed minor differences in the proteomes of the two datasets, one major finding when comparing hIGF-1 stimulation with non-stimulation was that hIGF-1 was enriched in EVs derived from hIGF-1-stimulated ChPE cells, thus further demonstrating the transport of IGF-1 in EVs across the blood-CSF barrier.

[0264] Based on the observation that IGF-1-enveloped EVs are secreted into the apical supernatant, i.e., into the compartment corresponding to the CSF, we hypothesized that they are destined to transport IGF-1 to receptor cells outside the ventricular ependyma. In fact, previous studies have demonstrated that ChP-derived EVs penetrate the inner lining of the ependyma of the cerebral ventricles and are subsequently taken up in astrocytes and microglia. For example, Grapp et al. and Balusu et al. demonstrated that in the adult mouse brain, ChPE secretes EVs into the CSF, which then penetrate the ependymal protective cells of the parenchyma and are thus able to deliver molecules from the ChP to the brain. Grapp et al. further demonstrated how EVs secreted from ChPE into the CNS supply nutrients in the blood to the CNS. In addition, Balusu et al. demonstrated that certain systemic stimuli (such as inflammation) enhance the formation and secretion of EVs from ChPE. However, to our knowledge, the potential distribution of ChPE-derived EVs to specific subcortical structures has not been studied. Importantly, to our knowledge, previous studies have utilized adult mouse models to study the penetration of ChP-derived EVs into the brain parenchyma. In addition, previous studies on the distribution of intraventricularly injected EVs used sedated animals. However, it is well known that sedation significantly affects the circulation and perfusion of the brain. Therefore, in this study, we injected ChPE-derived EVs i.c.v. under ultrasound guidance in non-sedated premature rabbit pups, which is a model very suitable and widely used for the study of the immature brain. Surprisingly, we found that EVs were present deep in the hippocampus and, to some extent, in the deep layers of the pyramidal and molecular layers of the CA2-CA3 region. To further confirm and characterize this finding, we investigated the ability of primary hippocampal neurons to take up purified ChPE-derived EVs in an in vitro environment. Interestingly, hippocampal neurons showed extensive uptake of EVs purified from ChPE cells, and EVs were observed both in the cytoplasm and in neurites. Altogether, this may suggest that ChP-derived EVs are targeted to the hippocampus of the immature brain. The effect of this delivery has not been studied, but, considering the changes in the proteome of ChP-derived EVs after IGF-1 exposure, it can be speculated that it induces enhanced hippocampal neurodevelopment. In fact, Christiansen et al. recently observed that premature piglets exposed to systemic IGF-1 showed increased hippocampal neurodevelopment. In addition, prematurity results in delayed maturation of the hippocampus in premature rabbit pups. This clearly requires further studies on the effects and relevance of IGF-1-mediated communication between the ChP and the developing brain.

[0265] Generally speaking, this study proposes a mechanism by which EV-enveloped IGF-1 passes through the blood-CSF barrier and crosses the inner lining of the ependyma to enter the hippocampus of the developing brain, as Figure 17(depicted). The function of EV-mediated communication from the ChP to the surrounding parenchyma requires further investigation, as this messenger system may provide new therapeutic opportunities to support postnatal neurodevelopment of EPT.

Claims

1. A method for preventing intraventricular hemorrhage (IVH) in premature infants born at a low gestational age (e.g., 23, 24, 25 or 26 weeks, such as 23, 24 or 25 weeks), which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form within 3 hours of birth, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day, particularly 350 to 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of, for example, 28 μg / L to 109 μg / L during the treatment, and wherein more than 50% of the treated infants do not have IVH after excluding the baseline assessment time point.

2. The method according to claim 1, wherein 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65% or more of the treated patient population do not have IVH.

3. The method according to claim 1 or 2, wherein at least 70% of the treated population, such as 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% or more of the treated population, is below grade 2 (i.e., 0 or 1) on the IVH scale, for example, by the VOLPE method and / or the maximum score method.

4. The method according to any one of claims 1 to 3, wherein at least 85% of the treated population, such as 85%, 86%, 87%, 87.5% or more of the treated population, is below grade 3 (i.e., 0, 1 or 2) on the IVH scale, for example, by the VOLPE method and / or the maximum score method.

5. A method for preventing grade 3 or 4 intraventricular hemorrhage (IVH) in premature infants born at a low gestational age (e.g., 23, 24, 25 or 26 weeks, such as 26 weeks), which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF binding protein (such as IGFBP-3) in complex form within 3 hours of birth, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day, particularly 350 to 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, wherein after excluding the baseline time point, 15% or less of the treated infants have grade 3 or 4 IVH, such as 12.5%, 12%, 11%, 10%, 9%, 8%, 7%, 6.5%, 6.25% or less, particularly 10% or less.

6. A method for preventing intraventricular hemorrhage (IVH) in premature infants with an APGAR score of less than 7 or for preventing grade 3 or 4 IVH in said premature infants, which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF-binding protein (such as IGFBP-3) in complex form within 3 hours of birth, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day, especially 350 to 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment, and wherein after excluding the baseline assessment time point, a higher percentage of the treated infants do not have IVH or do not have grade 3 or 4 IVH compared to comparable untreated premature infants.

7. A method for stabilizing pathological fluctuations in the blood osmolality of premature infants (such as premature infants with a low gestational age), which is carried out by administering a therapeutically effective amount of a composition comprising, for example, IGF-1 and an IGF-binding protein (such as IGFBP-3) in complex form within 3 hours of birth, at a dose of 200 - 500 μg / Kg / day (such as 250, 300, 350, 400, 450 or 500 μg / Kg / day, especially 350 to 500 μg / Kg / day) for a period of at least 7 days, such that the plasma IGF-1 level is maintained within a therapeutic range of 28 μg / L to 109 μg / L during the treatment.

8. The method according to any one of the preceding claims, wherein the incidence of the occurrence and / or progression of IVH is improved within a period of 24 hours to 168 hours, such as 24 hours to 120 hours, including a period of 48 to 120 hours, after the start of treatment.

9. The method according to any one of the preceding claims, wherein the treated premature infants have a mortality benefit.

10. The method according to any one of the preceding claims, wherein at 48 hours (such as at least 50, 60 or 72 hours), the risk of intraventricular hemorrhage (IVH) is reduced by at least 10%, such as 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18% or more.

11. The method according to any one of the preceding claims, wherein the severity of intraventricular hemorrhage (IVH) is reduced, such as the incidence of grade 3 and / or 4 is reduced.

12. The method according to any one of the preceding claims, wherein the severity of grade 2 IVH is reduced.

13. The method according to any one of the preceding claims, wherein the treatment starts within 24 hours after birth, such as within 30 min to 3 hours after birth.

14. The method according to any one of the preceding claims, wherein the treatment is administered subcutaneously and / or by infusion (such as intermittent or continuous infusion).

15. The method according to any one of the preceding claims, wherein the premature infants are treated for at least 5 days, such as at least 1 week, such as 2 to 6 weeks, such as 2, 3, 4, 5 or 6 weeks.

16. The method according to any one of the preceding claims, wherein the continuous treatment is carried out until a gestational age of 32, 33 or 34 weeks.

17. The method according to any one of the preceding claims, wherein the serum IGF-1 level is maintained within the range of 28 to 109 ng / mL.

Images