SiRNA for targeted inhibition of demethylase ALKB-1 gene or ALKBH1 gene expression and application thereof

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to siRNA for targeted inhibition of demethylase ALKB-1 gene or ALKBH1 gene expression and application of the siRNA. According to the invention, caenorhabditis elegans is taken as a model, ALKB-1 high-specificity targeting siRNA is designed and synthesized, and is delivered into nematode bodies to realize ALKB-1 specificity knock-down, so that the aging process of caenorhabditis elegans is obviously delayed, and the caenorhabditis elegans also has an improvement effect on aging-related diseases including Parkinson's disease. Through mechanism analysis, it is found that the anti-aging effect of specific siRNA in targeted intervention of ALKB-1 is achieved by adjusting methylation modification of tRNA to influence protein homeostasis. The invention provides a new reference method for developing anti-aging drugs and gene therapy strategies for intervening ALKB-1 functions based on the siRNA targeted knock-down technology.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine. More specifically, it relates to siRNAs that target and inhibit the expression of the demethylase ALKB-1 gene or ALKBH1 gene and their applications. Background Art

[0002] Aging is a fundamental biological process throughout the entire human life cycle. With the extension of the average life expectancy and the increasing aging of the population, aging has become a major challenge for humanity. The decline in overall function associated with aging leads to a significant increase in the risk of developing various diseases, including neurodegenerative diseases, diabetes, osteoporosis, and cardiovascular and cerebrovascular diseases, etc. This results in a huge gap between the average life expectancy and the healthy life expectancy. The elderly have a large amount of time facing various disease challenges, which not only affects personal life but also greatly consumes social and medical resources. Currently, there is an urgent need to seek measures to address aging to promote the growth of the average healthy life expectancy in China and achieve healthy aging. Therefore, in-depth research on aging, finding targets and pathways to address aging and the occurrence of related diseases, meets the national needs and development strategies, and is a major medical topic keeping up with the times.

[0003] Small interfering RNA (siRNA), as a powerful gene expression regulation tool, achieves post-transcriptional gene silencing by specifically targeting the mRNA of the target gene. In recent years, siRNA has emerged in the research field of aging and aging-related diseases, especially showing great application potential in drug development based on gene therapy. In anti-aging, targeted siRNA inhibits the activity of mammalian target of rapamycin complex 1 (mTORC1) by silencing Raptor expression, showing excellent ability to delay cellular aging. In neurodegenerative diseases, siRNAs are designed to target the amyloid precursor protein gene (APP) or Tau protein gene, and treat Alzheimer's disease by reducing the accumulation of pathological proteins. The siRNA targeting the α-synuclein gene can improve the development of Parkinson's disease by reducing neuronal damage. Up to now, only six siRNA drugs have been approved by the US Food and Drug Administration for marketing, and multiple siRNA drugs are in clinical trials, covering a variety of chronic diseases and aging-related diseases. However, the siRNA drugs that can be marketed for clinical treatment are still limited, and there is an urgent need to develop more siRNA drugs for patients to choose from. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the defects and deficiencies that the siRNA drugs that can be marketed for clinical treatment are still limited and there is an urgent need to develop more siRNA drugs for patients to choose from, and to provide the application of siRNAs that target and inhibit the expression of the demethylase ALKB-1 gene or ALKBH1 gene in the preparation of drugs for anti-aging or aging-related diseases.

[0005] Another object of the present invention is to provide an siRNA#1 that targets and inhibits the expression of the ALKB-1 gene or the ALKBH1 gene.

[0006] Another object of the present invention is to provide an siRNA#2 that targets and inhibits the expression of the ALKB-1 gene or the ALKBH1 gene.

[0007] Another object of the present invention is to provide an siRNA#3 that targets and inhibits the expression of the ALKB-1 gene or the ALKBH1 gene.

[0008] Another object of the present invention is to provide the use of the siRNA#1 or the siRNA#2 or the siRNA#3 in the preparation of drugs for anti-aging or aging-related diseases.

[0009] Another object of the present invention is to provide a pharmaceutical composition.

[0010] The above objects of the present invention are achieved by the following technical solutions:

[0011] The present invention protects the use of siRNA that targets and inhibits the expression of the demethylase ALKB-1 gene or the ALKBH1 gene in the preparation of drugs for anti-aging or aging-related diseases.

[0012] It should be noted that ALKB-1 is a dioxygenase belonging to the Alkb family, whose activity depends on ferrous ions and α-ketoglutaric acid, and is the homologous protein of mammalian ALKBH1 in Caenorhabditis elegans. That is, the ALKB-1 gene and the ALKBH1 gene are homologous genes, but are named differently in different species.

[0013] Aging is accompanied by a decline in overall function, such as a decrease in motor ability. Therefore, delaying aging often can also improve the motor ability of the body. Through the analysis of the movement of Caenorhabditis elegans, the present invention finds that targeted siRNA specifically knocking down ALKB-1 can significantly extend the rapid movement cycle of wild-type Caenorhabditis elegans N2, which indicates that siRNA knocking down ALKB-1 can improve the motor ability of aged Caenorhabditis elegans, further corroborating that targeting and knocking down ALKB-1 by siRNA to inhibit its function has anti-aging effects.

[0014] During the aging process, the continuous accumulation of internal and external stresses gradually disrupts protein homeostasis, leading to the accumulation of misfolded and aggregated proteins, which further accelerates aging and increases the risk of age-related diseases such as Parkinson's disease (PD). Based on the PD nematode model constructed by overexpressing α-synuclein in nematode neurons, the present invention discovers that targeted siRNA knockdown of ALKB-1 can significantly improve the motor disorders and dopamine neuron damage phenotypes of PD model nematodes, indicating that siRNA knockdown of ALKB-1 has the effect of improving the symptoms of Parkinson's disease; this result proves that siRNA targeted intervention in the function of ALKB-1 also has potential application value in the prevention and treatment of aging-related diseases.

[0015] Chinese Patent Application (CN116445516A) shows that overexpression of ALKBH1 can delay adipocyte aging by inhibiting the expression of p16; specific knockout of ALKBH1 in adipose tissue will accelerate the aging of adipose tissue in high-fat-fed obese mice, exacerbate chronic inflammation and insulin resistance. However, in the above-mentioned patent application, ALKBH1 is targeted at the aging of adipocytes, which neither involves the impact on the aging of other cells nor can it illustrate the impact on the overall aging of the organism; cell aging and organismal aging are different concepts. Organismal aging does not solely depend on cell aging but rather on the clearance of senescent cells. In other words, when the number of individual senescent cells increases, as long as the ability to clear senescent cells is strong enough to remove the excess senescent cells, it will not exacerbate organismal aging. Therefore, the promotion of adipocyte aging by overexpression of ALKBH1 does not indicate whether it promotes or inhibits organismal aging. Additionally, although the above-mentioned patent application constructs a specific knockout of ALKBH1 in adipose tissue and finds that high-fat feeding of the gene knockout mice will accelerate the aging of adipose tissue in mice, exacerbate chronic inflammation and insulin resistance, this indicates that the specific knockout of ALKBH1 in adipose tissue is detrimental to the health of mice. However, it should be noted that in the above-mentioned patent application, the focus is on the high-fat-fed obese mouse model rather than the healthy mice on a normal diet, that is, the above-mentioned patent application illustrates the protective effect of ALKBH1 on obese mice but does not indicate the protective effect on normal mice. Exactly speaking, the above-mentioned patent application shows the function of ALKBH1 in lipid metabolism. The nematode model used in the present invention is an in vivo model rather than an in vitro model, illustrating organismal aging rather than cell aging; the nematodes used in the present invention are on a normal diet rather than obese model nematodes, illustrating aging under normal physiological functions rather than aging under the background of lipid metabolism disorders. That is, the present invention discovers for the first time that siRNA inhibiting the expression of ALKB-1 (ALKBH1) can significantly delay the aging process and also has an improving effect on aging-related diseases (such as Parkinson's disease in neurodegenerative diseases).

[0016] In summary, using Caenorhabditis elegans as a model, the present invention for the first time discovers that siRNA which significantly knockdowns ALKB-1 and inhibits its function can significantly delay the aging process and also has an improvement effect on aging-related diseases.

[0017] Furthermore, the aging-related diseases include neurodegenerative diseases.

[0018] Furthermore, the neurodegenerative diseases include Parkinson's disease, Alzheimer's disease, Huntington's disease or amyotrophic lateral sclerosis.

[0019] Preferably, the neurodegenerative disease is Parkinson's disease.

[0020] Furthermore, the siRNA upregulates the m 1 A methylation modification level of tRNA. The present invention for the first time discloses a new function of ALKB-1 (ALKBH1), which regulates organismal aging or aging-related diseases by modulating the methylation modification of tRNA.

[0021] The present invention protects an siRNA#1 that targets and inhibits the ALKB-1 gene or the ALKBH1 gene. The nucleotide sequence of the sense strand of the siRNA#1 is shown as SEQ ID NO: 1 (GCCUUUUACGGAAGGAAAAAU), and the nucleotide sequence of the antisense strand of the siRNA#1 is shown as SEQ ID NO: 2 (UUUUCCUUCCGUAAAAGGCUU).

[0022] The present invention protects an siRNA#2 that targets and inhibits the ALKB-1 gene or the ALKBH1 gene. The nucleotide sequence of the sense strand of the siRNA#1 is shown as SEQ ID NO: 3 (CCGAAUAUCACGAAUUUGACG), and the nucleotide sequence of the antisense strand of the siRNA#1 is shown as SEQ ID NO: 4 (UCAAAUUCGUGAUAUUCGGUG).

[0023] The present invention protects an siRNA#3 that targets and inhibits the ALKB-1 gene or the ALKBH1 gene. The nucleotide sequence of the sense strand of the siRNA#1 is shown as SEQ ID NO: 5 (GCAAUCGUGGAUCUAUGAUGG), and the nucleotide sequence of the antisense strand of the siRNA#1 is shown as SEQ ID NO: 6 (AUCAUAGAUCCACGAUUGCCA).

[0024] The present invention first targets the mRNA of ALKB-1, and according to the Ui-Tei, Reynolds, and Amarzguioui rules for siRNA design, three siRNA sequences with a length of 21 bp targeting ALKB-1 mRNA (named siRNA#1, siRNA#2, and siRNA#3 respectively) are designed and synthesized. Through the analysis of the double-strand stability of the seed region (the 2nd to 8th nucleotides of the guide strand) and mismatch analysis, the high specificity of the siRNA is ensured; at the same time, it is ensured that the GC content of the designed siRNA is between 35% and 52%, and the interval between the target positions of different siRNAs is greater than 30 bp. Experiments have proved that the obtained siRNA with ALKB-1 targeting can significantly delay the aging process and also has an improvement effect on aging-related diseases.

[0025] The present invention protects the use of the siRNA#1 or the siRNA#2 or the siRNA#3 in the preparation of drugs for anti-aging or aging-related diseases.

[0026] Furthermore, the aging-related diseases include neurodegenerative diseases.

[0027] Furthermore, the neurodegenerative diseases include Parkinson's disease, Alzheimer's disease, Huntington's disease, or amyotrophic lateral sclerosis.

[0028] Furthermore, the siRNA#1 or the siRNA#2 or the siRNA#3 up-regulates the m 1 A methylation modification level of tRNA.

[0029] The present invention protects a pharmaceutical composition containing one or more of the siRNA#1, the siRNA#2, and the siRNA#3.

[0030] Furthermore, the pharmaceutical composition further includes pharmaceutically acceptable excipients.

[0031] Furthermore, the administration methods of the pharmaceutical composition include microinjection, intravenous injection, or subcutaneous injection.

[0032] Preferably, the administration method of the pharmaceutical composition is microinjection.

[0033] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses Caenorhabditis elegans as a model, designs and synthesizes highly specific targeting siRNA for ALKB-1, and delivers it into the nematode body to achieve specific knockdown of ALKB-1, significantly delaying the aging process of Caenorhabditis elegans, and also having an improving effect on aging-related diseases including Parkinson's disease. Through mechanism analysis, it is found that the anti-aging effect of specific siRNA targeting and intervening ALKB-1 is achieved by regulating the methylation modification of tRNA and affecting protein homeostasis. Its mechanism of action has species conservation with homologs in higher animals and has the potential value for developing anti-aging siRNA drugs for humans. The siRNA targeting and intervening ALKB-1 and the mechanism of ALKB-1 regulating aging described in the present invention provide a new path and intervention target for realizing aging delay or prevention and treatment of aging-related diseases, and are expected to develop new siRNA drugs and gene therapy methods for anti-aging or aging-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is a statistical chart of data for specifically knocking down the transcriptional expression of ALKB-1 by microinjection delivery of targeting siRNA.

[0035] Figure 2 It is a statistical chart of data for specifically knocking down ALKB-1 by targeting siRNA to extend the lifespan of wild-type N2 nematodes (A) and improve locomotor ability (B).

[0036] Figure 3 It is a statistical chart of data for specifically knocking down ALKB-1 by targeting siRNA to improve the locomotor disorder (A) and dopamine neuron damage (B) in PD model nematodes.

[0037] Figure 4 It is a statistical chart of data for the demethylase ALKB-1 regulating the tRNA m1A modification in Caenorhabditis elegans. Among them, Figure (A) is an amino acid sequence comparison diagram, Figure (B) is a schematic diagram of constructing an ALKB-1 enzyme-inactivated mutant nematode strain using CRISPR technology, Figure (C) is a dot blot diagram, where the upper half of the dots are dot blots shown with an m1A modification-specific antibody, and the darker the black, the higher the m1A modification level; the lower half is a dot blot formed after staining with methylene blue, which is not affected by m1A modification and represents the loading amount of tRNA. The consistent depth indicates the same loading amount and is used as the loading reference for the upper half; Figure (D) is a statistical chart of the m1A methylation modification level of tRNA. 1 A modification level is higher; the lower half is a dot blot formed after staining with methylene blue, which is not affected by m1A modification and represents the loading amount of tRNA. The consistent depth indicates the same loading amount and is used as the loading reference for the upper half; 1 A modification affects and represents the loading amount of tRNA. The consistent depth indicates the same loading amount and is used as the loading reference for the upper half; (D) is a statistical chart of the m1A methylation modification level of tRNA. 1 A methylation modification level. DETAILED DESCRIPTION OF THE INVENTION

[0038] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0039] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0040] The PD model nematodes are preserved in this laboratory. The original nematode strain UM0010 [dat-1p::GFP; aex-3p::α-syn(A53T)] is from the laboratory of Garry Wong at the University of Macau. Literature source: Xiaobing H, Changliang W, Liang C, et al. Human amyloid beta and α-synuclein co-expression in neurons impair behavior and recapitulate features for Lewy body dementia in Caenorhabditis elegans. [J]. Biochimica et biophysica acta. Molecular basis of disease, 2021, 1867(10):166203-166203.

[0041] Example 1 Nematode Cultivation

[0042] (1) Preparation of NGM plates: Weigh 1.2 g of NaCl, 1 g of peptone, and 7 g of agar powder, add 400 mL of deionized water, and autoclave at 121 °C for 20 minutes; when cooled to about 60 °C, add 5 mL of KH 2 PO 4 / K 2 HPO 4 solution, 400 μL of 1M MgSO 4 solution, 400 μL of 1M CaCl 2 solution, and 400 μL of 5M cholesterol solution. After thorough mixing, pour it into a bacterial culture dish and let it stand to solidify; for lifespan, add a final concentration of 10 μM 5-Fluoro-2'-deoxyuridine (FUDR) and isopropyl-β-D-thiogalactoside (IPTG) to the NGM plates on the above basis;

[0043] (2) Preparation of OP50 food: Escherichia coli OP50 is the main food for Caenorhabditis elegans. When preparing OP50 food, pick a single colony of OP50 and culture it in LB medium in a constant temperature shaker at 37 °C for 12 hours. Then, centrifuge the bacterial solution to obtain a concentrated OP50 bacterial solution. The OP50 bacterial solution is stored in a refrigerator at 4 °C for later use. When in use, add it to the NGM plate to obtain an NGM nematode culture plate containing OP50.

[0044] (3) Synchronization and passage of nematodes: Resuspend the worms and eggs with sterilized deionized water and transfer them to a 15 mL sterilized centrifuge tube; prepare a nematode lysis solution according to the ratio of deionized water: 5M NaOH: sodium hypochlorite solution = 1:1:1. After mixing, add the lysis solution to the centrifuge tube and invert it up and down to mix the liquid evenly; when most of the worms are broken and the eggs are exposed, place it in a centrifuge and centrifuge at 1150×g for 2 minutes; then, remove the supernatant and wash it twice with deionized water. Then add M9 buffer containing MgSO 4 and tighten the tube cap and shake it to evenly distribute the eggs; the synchronized nematodes are cultured in a constant temperature incubator at 20 °C for 12 - 24 hours, and then centrifuged at 1800×g for 10 minutes to remove the supernatant. At this time, the L1-stage larvae sink to the bottom of the tube. Use a pipette to transfer them to an NGM plate containing OP50 and perform passage culture in a constant temperature incubator at 20 °C.

[0045] Example 2 Design, synthesis and delivery of targeted siRNA functional sequences

[0046] (1) Design and synthesis of ALKB-1 targeted siRNA functional sequences: Using the mRNA of Caenorhabditis elegans ALKB-1 as the target sequence, according to the Ui-Tei, Reynolds and Amarzguioui rules for siRNA design, design siRNA sequences targeting ALKB-1 mRNA with a length of 21 bp. On this basis, further screen candidate siRNA sequences with high specificity through seed region (nucleotides 2 - 8 of the guide strand) duplex stability analysis and mismatch analysis; then, through: a. The GC content of the siRNA is between 35% and 52%; b. The principle that the target positions of different siRNAs are spaced more than 30 bp apart, and finally obtain three highly specific siRNA functional sequences targeting ALKB-1 mRNA, namely ALKB-1 siRNA#1, ALKB-1 siRNA#2 and ALKB-1 siRNA#3. At the same time, design and synthesize a negative siRNA (NC siRNA) for use as a control. This sequence has no homology with ALKB-1. After the design is completed, it is synthesized by a professional synthesis company and purified by PAGE to obtain the finished siRNA.

[0047] (2) Delivery of siRNA by microinjection method:

[0048] The three PAGE-purified and synthesized siRNAs were separately dissolved in sterile diethyl pyrocarbonate (DEPC) water to obtain siRNA stock solutions with a concentration of 1 μg / μL; each siRNA stock solution was diluted to 200 μg / μL with DEPC water, and then an equal volume of 10% glucose solution was added to make the final glucose concentration 5%; afterwards, a BioShuttle siRNA in vivo transfection reagent with a mass-volume ratio of 1:1 was added, and after careful mixing, it was incubated at room temperature for 15 min to form a stable nano-complex. Next, nematodes in the early adult stage were selected for microinjection. They were anesthetized and fixed on an agar pad, and the injection solution was injected into the germ cells of the nematodes using a high-resolution microinjection system. The injection angle should not be too high, and the injection volume was about 1-2 μL; after injection, the nematodes were carefully transferred to M9 buffer for recovery, and after the vitality recovered, they were transferred to a normal OP50 NGM plate for cultivation. The number of nematodes injected each time was not less than 50 to ensure obtaining enough offspring nematodes.

[0049] Example 3 Detection of the knockdown effect of siRNA specifically targeting ALKB-1

[0050] (1) Collection of microinjected nematode offspring: Wild-type nematodes N2, single wild-type nematodes N2 successfully injected with siRNA in Example 2, or PD model nematodes preserved in our laboratory were cultured on OP50 NGM plates according to the method in Example 1 respectively; after the offspring grew to the early adult stage, the nematodes were collected into a centrifuge tube using M9 buffer and washed twice with M9 to remove residual bacteria. The collected worms were quickly frozen in liquid nitrogen and then stored in an ultra-low temperature freezer at -80 °C.

[0051] (2) Detection of gene transcription level by real-time quantitative PCR: RNA of wild-type nematodes N2, ALKB-1 siRNA#1 / #2 / #3 groups, and NC siRNA group worm samples was extracted using the Trizol method, reverse transcribed into cDNA, and the transcription level of alkb-1 was detected by real-time quantitative PCR, with the transcription level of the gene cdc-42 as the internal reference.

[0052] Example 4 Identification of nematode aging and aging-related phenotypes

[0053] (1) Nematode lifespan experiment: Before the lifespan experiment, wild-type N2 nematodes were cultured on fresh NGM plates for 2-3 generations, and it was ensured that the nematodes did not experience any starvation stress. Then, they were synchronized according to the nematode synchronization process in Example 1 to obtain nematodes synchronized to the L1 stage. The L1-stage nematodes were continuously cultured on the NGM plate until the late L4 stage or the early adult stage.

[0054] All lifespan experiments were conducted under the condition of 20°C. During the experiments, more than 100 wild-type nematodes N2, ALKB-1 siRNA #1 / #2 / #3 groups, and NC siRNA group nematodes at the late L4 stage or early adult stage were respectively selected and placed on the plates for lifespan experiments. 10 μM of 5-Fluoro-2'-deoxyuridine (FUDR) was added to the plates to inhibit the reproduction of nematodes, and OP50 inactivated at 70°C for 30 minutes (to remove the influence of bacterial metabolism on the experiment) was added as food. The nematodes at the late L4 stage were marked as the starting point of the lifespan experiment (t = 0, i.e., the 0th day). The number of surviving nematodes was counted daily. If the nematodes showed no response to external mechanical stimuli, they were determined to be dead. Nematodes that crawled out of the plate, had a protruding genital pore, or had hatched larvae inside were not included in the death statistics. The experimental data were analyzed by SPSS software, and the results were presented as Kaplan-Meier survival curves. The statistical differences were obtained by log-rank (Mantel-Cox) test. Each lifespan experiment was repeated at least once, and the trends of the repeated experimental results were consistent.

[0055] (2) Detection of nematode motility: Nematodes were cultivated according to the cultivation method of nematodes in the lifespan experiment, and then wild-type nematodes N2, ALKB-1 siRNA group, and NC siRNA group nematodes at the late L4 stage or early adult stage were transferred to the experimental plates and cultured at 20°C. The activity status of the nematodes was monitored and recorded daily: when the plate was gently tapped, if the nematodes crawled continuously in a sine wave shape, it was determined to be the fast activity period; otherwise, it was the slow activity period. Similar to the lifespan experiment operation, to maintain the drug effect, the nematodes were transferred to a new culture plate every two days. The activity data of the nematodes were analyzed and processed by t-test.

[0056] Phenotypic identification of the Parkinson's disease nematode model in Example 5

[0057] (1) Experiment on the dyskinesia phenotype: Wild-type nematodes N2 and the offspring of the overexpressing α-synuclein (A53T) PD model nematodes microinjected with ALKB-1 siRNA and NC siRNA were cultivated according to the cultivation method of nematodes in the lifespan experiment, and then the nematodes at the late L4 stage or early adult stage were transferred to the experimental plates and cultured at 25°C. The nematodes at the late L4 stage were marked as the starting point of the experiment (t = 0, i.e., the 0th day). On the fifth day, the nematodes were transferred to the M9 droplet on the glass slide, and a 30-second movement video was taken, and then the number of swings of the nematodes was counted. The results of the movement situation were statistically analyzed by t-test.

[0058] (2) Dopamine neuron injury phenotype experiment: The PD model nematodes were cultured according to the dyskinesia phenotype experiment. The morphology of dopamine neurons was observed under a fluorescence microscope on the 5th, 8th, and 12th days respectively, and the proportions of normal and damaged (including blistering, neuron loss, and breakage) neurons were counted. The results were statistically analyzed using the t-test.

[0059] Example 6 Identification of the enzyme activity of ALKB-1 and analysis of its biological function

[0060] The amino acid sequence of nematode ALKB-1 was aligned with the homolog ALKBH1 of animals such as humans, mice, and Drosophila to determine its conserved motifs and amino acid sites; an enzyme-inactivated mutant nematode strain of ALKB-1 was constructed by the CRISPR point mutation knockout technique. Then, wild-type nematode N2 and nematode samples of the ALKB-1 enzyme-inactivated mutant strain were collected respectively, genomic DNA, messenger RNA (mRNA), and transfer RNA (tRNA) were isolated and extracted respectively, and then the m 6 A and m 1 A modification differences between the two groups were detected using the dot blot method, and the results were analyzed using the t-test.

[0061] Experimental results of Examples 1-6

[0062] (1) Specific knockdown of the transcriptional expression of ALKB-1 by targeted siRNA

[0063] Table 1 Information on the functional sequence of siRNA targeting ALKB-1

[0064]

[0065]

[0066] The results of designing and synthesizing the functional sequence fragment of the targeted siRNA of ALKB-1 using ALKB-1 mRNA as a template are shown in Table 1. From Figure 1 it can be seen that by detecting the alkb-1 transcriptional level of the progeny of nematodes that were successfully delivered and ingested the ALKB-1-targeted siRNA by microinjection using real-time quantitative PCR, it was found that all the designed and synthesized ALKB-1-targeted siRNAs delivered by microinjection could significantly and specifically knockdown the expression of ALKB-1 (without affecting the transcription of other Alkb family and demethylase genes). Among them, ALKB-1 siRNA#3 had the most significant knockdown effect, and the knockdown efficiency was ≥70%.

[0067] (2) Specific knockdown of ALKB-1 by targeted siRNA extends the lifespan of wild-type N2 nematodes and improves their motor ability

[0068] Table 2 Effect of specific knockdown of ALKB-1 by targeted siRNA on the lifespan of wild-type N2 nematodes

[0069]

[0070]

[0071] Note: The lifespan experiment was analyzed by Kaplan-Meier in SPSS software, and the statistical difference (P value) was calculated by log-rank test. N is the number of nematodes finally included in the statistical results of the experiment; the experiment was performed with 3 independent biological replicates.

[0072] Table 3 Effects of targeted siRNA specifically knocking down ALKB-1 on the locomotor ability of wild-type N2 nematodes

[0073]

[0074] Note: The locomotor ability experiment was analyzed by Kaplan-Meier in SPSS software, and the statistical difference (P value) was calculated by log-rank test. N is the number of nematodes finally included in the statistical results of the experiment; the experiment was performed with 3 independent biological replicates.

[0075] Survival analysis and locomotor ability detection were performed on the wild-type N2 progeny nematodes that had been successfully delivered and ingested ALKB-1 siRNA by microinjection. The results are as Figure 2 , Table 2 and Table 3 show that specifically knocking down ALKB-1 using ALKB-1 siRNA#1, siRNA#2, and siRNA#3 can significantly extend the lifespan of wild-type N2 nematodes of Caenorhabditis elegans, and siRNA#3 has the most significant effect on delaying aging, with an extension rate of up to 16.7% ( Figure 2 Figure (A) in ); therefore, siRNA#3 was subsequently used to specifically knock down ALKB-1. Knocking down ALKB-1 with siRNA significantly prolonged the fast locomotion cycle of the nematodes, indicating that specifically knocking down ALKB-1 with siRNA slowed down the process of locomotion speed decline with aging ( Figure 2 Figure (B) in ). The above results prove that targeted intervention of ALKB-1 expression with siRNA has the effect of delaying aging and improving healthspan.

[0076] (3) Effects of siRNA targeted intervention of ALKB-1 on the locomotor disorder and dopamine neuron damage phenotypes in the PD nematode model

[0077] Analyze the effects of siRNA targeted intervention of ALKB-1 on the locomotor disorder and dopamine neuron damage phenotypes in the PD nematode model (overexpressing α-synuclein in neurons). The results are as Figure 3 shown, and it is found that specifically knocking down ALKB-1 with siRNA can significantly improve the locomotor disorder of PD model nematodesFigure 3 Figure (A) in Figure 3 Figure (B) in

[0078] (4) Identification of the enzymatic activity of ALKB-1 and analysis of its biological functions

[0079] By amino acid sequence alignment Figure 4 Figure (A) in Figure 4 showed that the key enzymatic active sites of the demethylase ALKB-1 were histidine at position 245 and aspartic acid residue at position 247. Then, the ALKB-1 enzyme-inactivated mutant nematode strain (alkb-1D247A) was constructed using CRISPR technology Figure 4 Figure (B) in

[0080] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. Application of siRNA targeting the inhibition of the expression of the demethylase ALKB-1 gene or ALKBH1 gene in the preparation of anti-aging or aging-related disease drugs.

2. The application according to claim 2, characterized in that: The aging-related diseases include neurodegenerative diseases.

3. The application according to claim 2, characterized in that: The neurodegenerative disease includes Parkinson's disease, Alzheimer's disease, Huntington's disease or amyotrophic lateral sclerosis.

4. The use according to any one of claims 1 to 3, characterized in that: The siRNA upregulates the m 1 AMethylation modification level.

5. A siRNA #1 for targeting and inhibiting the expression of ALKB-1 gene or ALKBH1 gene, characterized in that: The nucleotide sequence of the sense strand of the siRNA#1 is shown in SEQ ID NO:1, and the nucleotide sequence of the antisense strand of the siRNA#1 is shown in SEQ ID NO:

2.

6. A siRNA #2 for targeting and inhibiting the expression of ALKB-1 gene or ALKBH1 gene, characterized in that: The nucleotide sequence of the sense strand of the siRNA#1 is shown in SEQ ID NO:3, and the nucleotide sequence of the antisense strand of the siRNA#1 is shown in SEQ ID NO:

4.

7. A siRNA #3 for targeting and inhibiting the expression of ALKB-1 gene or ALKBH1 gene, characterized in that: The nucleotide sequence of the sense strand of the siRNA#1 is shown in SEQ ID NO:5, and the nucleotide sequence of the antisense strand of the siRNA#1 is shown in SEQ ID NO:

6.

8. Use of the siRNA#1 described in claim 5, the siRNA#2 described in claim 6, or the siRNA#3 described in claim 7 in the preparation of anti-aging or aging-related disease drugs.

9. The use according to claim 8, characterized in that: The aging-related diseases include neurodegenerative diseases.

10. A pharmaceutical composition, characterized in that Contains one or more of the siRNA#1 described in claim 5, the siRNA#2 described in claim 6, and the siRNA#3 described in claim 7.

Images