siRNA targeting and inhibiting the expression of demethylase ALKB-1 gene or ALKBH1 gene and its application

By designing and delivering siRNAs targeting ALKB-1 or ALKBH1, it significantly delays the aging process in C. elegans and improves aging-related diseases, solving the problem of insufficient existing siRNA drugs and providing new anti-aging and disease treatment options.

CN120078799BActive Publication Date: 2025-08-29JINAN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510222001.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2025-08-29
Estimated Expiration
2045-02-27

AI Technical Summary

Technical Problem

Currently, there are still limited siRNA drugs that can be marketed for clinical treatment, and it is urgent to develop more siRNA drugs for patients to choose from, especially in the treatment of anti-aging and aging-related diseases. The prior art has not effectively targeted the inhibition of the expression of the demethylase ALKB-1 or ALKBH1 gene.

Method used

Design and synthesize specific small interfering RNA (siRNA) targeted to inhibit the expression of ALKB-1 or ALKBH1 genes, and deliver it to nematodes by microinjection, significantly delaying the aging process and improving aging-related diseases, especially neurodegenerative diseases such as Parkinson's disease.

Benefits of technology

It significantly extends the lifespan of C. elegans, improves motor ability, and reduces motor disorders and dopamine neuron damage in Parkinson's disease model nematode, and proves that siRNA targeted inhibition of ALKB-1 has the potential value of anti-aging and treatment of aging-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120078799B_ABST
    Figure CN120078799B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biomedical technology, and specifically relates to siRNA that targets and inhibits the expression of the demethylase ALKB-1 gene or ALKBH1 gene and its application. The present invention uses Caenorhabditis elegans as a model, designs and synthesizes highly specific targeted siRNA for ALKB-1, and delivers it into the nematode body to achieve specific knockdown of ALKB-1, significantly delaying the aging process of Caenorhabditis elegans, and also has an improvement effect on aging-related diseases including Parkinson's. Through mechanism analysis, it was found that the anti-aging effect of specific siRNA targeted intervention of ALKB-1 is achieved by regulating the methylation modification of tRNA to affect protein homeostasis. The present invention provides a new reference method for the development of anti-aging drugs and gene therapy strategies based on siRNA targeted knockdown technology to intervene in the function of ALKB-1.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology and more specifically relates to siRNA that targets and inhibits the expression of the demethylase ALKB-1 gene or ALKBH1 gene and its application. Background Art

[0002] Aging is a fundamental biological process that persists throughout the human lifespan. With increasing life expectancy and an increasingly aging population, aging has become a major challenge for humanity. The overall functional decline associated with aging significantly increases the risk of developing a variety of diseases, including neurodegenerative diseases, diabetes, osteoporosis, and cardiovascular and cerebrovascular diseases. This creates a significant gap between average life expectancy and healthy life expectancy. Elderly individuals face numerous challenges during this time, which not only impacts their personal lives but also significantly consumes social and medical resources. Currently, there is an urgent need to explore measures to address aging to promote increased healthy life expectancy and achieve healthy aging in my country. Therefore, in-depth research on aging and the identification of targets and pathways to address aging and related diseases aligns with national needs and development strategies and is a major medical topic that keeps pace with the times.

[0003] Small interfering RNA (siRNA) is a powerful tool for regulating gene expression, achieving post-transcriptional gene silencing by specifically targeting the mRNA of a target gene. In recent years, siRNA has emerged as a promising target in the research of aging and age-related diseases, particularly in the development of gene therapy-based drugs. In anti-aging, targeted siRNAs have demonstrated remarkable ability to delay cellular senescence by silencing Raptor expression and inhibiting the activity of the rapamycin complex 1 (mTORC1). In neurodegenerative diseases, siRNAs have been designed to target the β-amyloid precursor protein (APP) gene or the Tau protein gene to treat Alzheimer's disease by reducing the accumulation of pathological proteins. siRNAs targeting the α-synuclein gene have been shown to ameliorate the progression of Parkinson's disease by alleviating neuronal damage. To date, only six siRNA drugs have been approved for marketing by the US Food and Drug Administration, and several are in clinical trials for a variety of chronic diseases and age-related disorders. However, the number of siRNA drugs currently available for clinical treatment remains limited, and there is an urgent need to develop more siRNA drugs for patients. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the defects and shortcomings that the siRNA drugs currently available for clinical treatment are still limited and there is an urgent need to develop more siRNA drugs for patients to choose from, and to provide the use of siRNA that targets and inhibits the expression of the demethylase ALKB-1 gene or ALKBH1 gene in the preparation of anti-aging or aging-related disease drugs.

[0005] Another object of the present invention is to provide a siRNA#1 that targets and inhibits the expression of ALKB-1 gene or ALKBH1 gene.

[0006] Another object of the present invention is to provide a siRNA#2 that targets and inhibits the expression of ALKB-1 gene or ALKBH1 gene.

[0007] Another object of the present invention is to provide a siRNA#3 that targets and inhibits the expression of ALKB-1 gene or ALKBH1 gene.

[0008] Another object of the present invention is to provide the use of the siRNA#1, the siRNA#2, or the siRNA#3 in the preparation of anti-aging or aging-related disease drugs.

[0009] Another object of the present invention is to provide a pharmaceutical composition.

[0010] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0011] The present invention protects the use of siRNA that targets and inhibits the expression of the demethylase ALKB-1 gene or ALKBH1 gene in the preparation of anti-aging or aging-related disease drugs.

[0012] It should be noted that ALKB-1 is a dioxygenase belonging to the Alkb family. Its activity depends on ferrous ions and α-ketoglutarate. It is the homologous protein of mammalian ALKBH1 in nematodes. In other words, the ALKB-1 gene and ALKBH1 gene are homologous genes, but are named differently in different species.

[0013] Aging is accompanied by a decline in overall function, such as decreased motor ability. Therefore, delaying aging often also improves the body's motor ability. Through analysis of nematode movement, the present invention found that targeted siRNA knockdown of ALKB-1 significantly prolonged the rapid movement cycle of wild-type nematode N2. This suggests that siRNA knockdown of ALKB-1 can improve the motor ability of aged nematodes, further supporting the anti-aging effect of siRNA-targeted knockdown of ALKB-1 and thus inhibition of its function.

[0014] The internal and external pressures that continuously accumulate during aging make it impossible to maintain protein homeostasis and cause it to become disordered, leading to the accumulation of misfolded and aggregated proteins, further accelerating aging and increasing the risk of age-related diseases such as Parkinson's disease (PD). Based on a nematode model of PD constructed by overexpressing α-synuclein in nematode neurons, the present invention found that targeted siRNA knockdown of ALKB-1 can significantly improve the movement disorders and dopamine neuron damage phenotype of PD model nematodes, indicating that siRNA knockdown of ALKB-1 has the effect of improving Parkinson's disease symptoms; this result proves that siRNA targeted intervention of ALKB-1 function also has potential application value in the prevention and treatment of aging-related diseases.

[0015] A Chinese patent application (CN116445516A) indicates that ALKBH1 overexpression can delay adipocyte aging by inhibiting the expression of p16; specific knockout of ALKBH1 in adipose tissue leads to accelerated adipose tissue aging, exacerbated chronic inflammation, and insulin resistance in high-fat-fed obese mice. However, in the above-mentioned patent application, ALKBH1 targets the aging of adipocytes, and does not involve the impact on the aging of other cells, nor can it explain the impact on the overall aging of the organism; cellular aging and organismal aging are different concepts. Organismal aging does not depend entirely on cellular aging, but on the clearance of senescent cells. In other words, when the number of individual senescent cells increases, as long as the ability to clear senescent cells is strong enough to clear excess senescent cells, it will not aggravate the aging of the organism. Therefore, ALKBH1 overexpression promotes adipocyte aging, which does not indicate whether it promotes or inhibits organismal aging. In addition, although the patent application constructed a specific knockout of ALKBH1 in adipose tissue and found that high-fat feeding of the gene knockout mice accelerated the aging of the mouse adipose tissue, exacerbated chronic inflammation and insulin resistance, indicating that the specific knockout of ALKBH1 in adipose tissue is detrimental to the health of mice, it is worth noting that the patent application focuses on the high-fat fed obese mouse model, rather than healthy mice on a normal diet. That is, the patent application describes the protective effect of ALKBH1 on obese mice, but does not show the protective effect on normal mice. Specifically, the patent application shows the function of ALKBH1 in lipid metabolism. The nematode model used in the present invention is an in vivo model rather than an in vitro model, which illustrates the aging of the body rather than cellular aging; the present invention uses nematodes that eat normally, rather than obese model nematodes, which illustrates aging under normal physiological functions rather than aging in the context of lipid metabolism disorders. That is, the present invention discovered for the first time that siRNA that inhibits the expression of ALKB-1 (ALKBH1) can significantly delay the aging process and also has an improvement effect on aging-related diseases (such as Parkinson's disease among neurodegenerative diseases).

[0016] In summary, the present invention uses Caenorhabditis elegans as a model and discovers for the first time that siRNA that significantly knocks down ALKB-1 and thus inhibits its function can significantly delay the aging process and also has an improvement effect on aging-related diseases.

[0017] Furthermore, the aging-related diseases include neurodegenerative diseases.

[0018] Furthermore, the neurodegenerative disease includes Parkinson's disease, Alzheimer's disease, Huntington's disease or amyotrophic lateral sclerosis.

[0019] Preferably, the neurodegenerative disease is Parkinson's disease.

[0020] Furthermore, the siRNA upregulates the m 1 A. Methylation modification level. The present invention discloses for the first time the new function of ALKB-1 (ALKBH1), which regulates tRNA methylation modification to regulate body aging or aging-related diseases.

[0021] The present invention protects an siRNA #1 that targets and inhibits the ALKB-1 gene or the ALKBH1 gene. The nucleotide sequence of the positive chain of the siRNA #1 is shown in SEQ ID NO: 1 (GCCUUUUACGGAAGGAAAAAU), and the nucleotide sequence of the antisense chain of the siRNA #1 is shown in SEQ ID NO: 2 (UUUUCCUUCCGUAAAAGGCUU).

[0022] The present invention protects an siRNA#2 that targets and inhibits the ALKB-1 gene or ALKBH1 gene. The nucleotide sequence of the positive chain of the siRNA#1 is shown in SEQ ID NO: 3 (CCGAAUAUCACGAAUUUGACG), and the nucleotide sequence of the antisense chain of the siRNA#1 is shown in SEQ ID NO: 4 (UCAAAUUCGUGAUAUUCGGUG).

[0023] The present invention protects an siRNA#3 that targets and inhibits the ALKB-1 gene or ALKBH1 gene. The nucleotide sequence of the positive chain of the siRNA#1 is shown in SEQ ID NO: 5 (GCAAUCGUGGAUCUAUGAUGG), and the nucleotide sequence of the antisense chain of the siRNA#1 is shown in SEQ ID NO: 6 (AUCAUAGAUCCACGAUUGCCA).

[0024] The present invention first targeted ALKB-1 mRNA and, following the Ui-Tei, Reynolds, and Amarzguioui rules of siRNA design, designed and synthesized three 21-bp siRNA sequences targeting ALKB-1 mRNA (designated siRNA#1, siRNA#2, and siRNA#3). High specificity of the siRNAs was ensured through double-strand stability analysis and mismatch analysis of the seed region (nucleotides 2-8 of the guide strand). Furthermore, the GC content of the designed siRNAs was maintained between 35% and 52%, and the intervals between different siRNA target sites were greater than 30 bp. Experimental results have demonstrated that the resulting ALKB-1-targeting siRNAs can significantly delay aging and improve aging-related diseases.

[0025] The present invention protects the use of the siRNA#1, the siRNA#2, or the siRNA#3 in preparing drugs for resisting aging or aging-related diseases.

[0026] Furthermore, the aging-related diseases include neurodegenerative diseases.

[0027] Furthermore, the neurodegenerative disease includes Parkinson's disease, Alzheimer's disease, Huntington's disease or amyotrophic lateral sclerosis.

[0028] Furthermore, the siRNA#1 or the siRNA#2 or the siRNA#3 upregulates the m 1 A. Methylation modification level.

[0029] The present invention protects a pharmaceutical composition containing one or more of the siRNA#1, the siRNA#2, and the siRNA#3.

[0030] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0031] Furthermore, the administration of the pharmaceutical composition includes microinjection, intravenous injection or subcutaneous injection.

[0032] Preferably, the pharmaceutical composition is administered by microinjection.

[0033] Compared with the existing technology, the present invention has the following beneficial effects: the present invention uses Caenorhabditis elegans as a model, designs and synthesizes highly specific ALKB-1 targeted siRNA, and delivers it into the nematode to achieve specific knockdown of ALKB-1, significantly delaying the aging process of Caenorhabditis elegans, and also has an improvement effect on aging-related diseases including Parkinson's disease. Through mechanism analysis, it was found that the anti-aging effect of specific siRNA targeted intervention of ALKB-1 is achieved by regulating the methylation modification of tRNA to affect protein homeostasis. Its mechanism of action is species-conserved with homologs of higher animals, and has potential value for the development of anti-aging siRNA drugs for humans. The siRNA targeted intervention of ALKB-1 and the mechanism of ALKB-1 regulating aging described in the present invention provide a new path and intervention target for achieving delayed aging or the prevention and treatment of aging-related diseases, and are expected to develop new siRNA drugs and gene therapy methods for anti-aging or aging-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Statistical data showing the specific knockdown of ALKB-1 transcriptional expression by microinjection-delivered targeted siRNA.

[0035] Figure 2 Statistical graph showing that targeted siRNA specifically knocked down ALKB-1 to extend the lifespan of wild-type N2 nematodes (A) and improve movement ability (B).

[0036] Figure 3 Statistical graph showing that targeted siRNA specifically knocked down ALKB-1 to improve movement disorders (A) and dopamine neuron damage (B) in PD model nematodes.

[0037] Figure 4 Figure 1 shows the statistical data of the regulation of tRNA m1A modification by the demethylase ALKB-1 in C. elegans. (A) shows the amino acid sequence alignment, (B) shows the schematic diagram of the construction of ALKB-1 enzyme-inactive mutant nematode strains using CRISPR technology, and (C) shows a dot blot. The dots in the upper half are dot blots displayed with an m1A modification-specific antibody. Darker black indicates m1A modification. 1 AThe higher the modification level; the lower part is the dot blot formed after staining with methylene blue, which is not affected by m 1 A modification effect, representing the loading amount of tRNA. The same depth indicates the same loading amount, which is used as the loading reference of the upper part; (D) The figure shows the m 1 A. Statistical diagram of methylation modification levels. DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0039] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0040] The PD model nematodes are preserved in our laboratory. The original nematode strain UM0010 [dat-1p::GFP; aex-3p::α-syn(A53T)] comes from the laboratory of Garry Wong at the University of Macau. The literature source is: Xiaobing H, Changliang W, Liang C, et al. Human amyloid beta and α-synuclein co-expression in neurons impair behavior and recapitulate features for Lewy body dementia in Caenorhabditis elegans. [J]. Biochimica et biophysica acta. Molecular basis of disease, 2021, 1867(10): 166203-166203.

[0041] Example 1 Nematode culture

[0042] (1) Preparation of NGM plates: Weigh 1.2 g of NaCl, 1 g of peptone, and 7 g of agar powder, add 400 mL of deionized water, and sterilize at 121°C for 20 minutes; when cooled to about 60°C, add 5 mL of KH2PO4 / K2HPO4 solution, 400 μL of 1 M MgSO4 solution, 400 μL of 1 M CaCl2 solution, and 400 μL of 5 M cholesterol solution, mix thoroughly, and pour into a bacterial culture dish, and let it stand to solidify; for lifespan NGM plates, add 5-Fluoro-2'-deoxyuridine (FUDR) and isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 10 μM on the basis of the above;

[0043] (2) Preparation of OP50 food: Escherichia coli OP50 is the main food of C. elegans. To prepare OP50 food, pick a single OP50 colony in LB medium and culture it in a 37°C constant temperature shaker for 12 hours. Then, centrifuge the bacterial solution to obtain a concentrated OP50 bacterial solution. Store the OP50 bacterial solution in a 4°C refrigerator until use. When using, add it to the NGM plate to obtain the NGM nematode culture plate containing OP50.

[0044] (3) Synchronization and passaging of nematodes: Resuspend the worm bodies and eggs in sterilized deionized water and transfer them to a 15 mL sterilized centrifuge tube; prepare the nematode lysis solution in a ratio of deionized water: 5M NaOH: sodium hypochlorite solution = 1:1:1. After mixing, add the lysis solution to the centrifuge tube and invert it to mix the liquid; when most of the worm bodies are broken and the eggs are exposed, place it in a centrifuge and centrifuge at 1150×g for 2 minutes; then remove the supernatant and wash it twice with deionized water. Then add M9 buffer containing MgSO4, tighten the tube cap and shake it to evenly distribute the eggs; place the synchronized nematodes in a 20℃ constant temperature incubator for 12-24 hours, then centrifuge at 1800×g for 10 minutes, remove the supernatant, and the L1 larvae will sink to the bottom of the tube. Use a pipette to transfer them to an NGM plate containing OP50 and pass them in a 20℃ constant temperature incubator for passaging.

[0045] Example 2 Design, synthesis and delivery of targeted siRNA functional sequences

[0046] (1) Design and synthesis of ALKB-1 targeting siRNA functional sequences: Using the Caenorhabditis elegans ALKB-1 mRNA as the target sequence, a 21 bp siRNA sequence targeting ALKB-1 mRNA was designed according to the Ui-Tei, Reynolds, and Amarzguioui rules for siRNA design. On this basis, candidate siRNA sequences with high specificity were further screened through double-strand stability analysis and mismatch analysis of the seed region (nucleotides 2-8 of the guide chain); then, by the following principles: a) the GC content of the siRNA was between 35% and 52%; b) the interval between different siRNA target positions was greater than 30 bp, three highly specific siRNA functional sequences targeting ALKB-1 mRNA were finally obtained, namely ALKB-1 siRNA #1, ALKB-1 siRNA #2, and ALKB-1 siRNA #3. At the same time, a negative siRNA (NC siRNA) was designed and synthesized as a control, and this sequence had no homology to ALKB-1. After the design was completed, it was synthesized at a professional synthesis company and purified by PAGE to obtain the finished siRNA.

[0047] (2) Microinjection delivery of siRNA:

[0048] The three siRNAs purified by PAGE were dissolved in sterile diethylpyrocarbonate (DEPC)-free water to obtain a 1 μg / μL siRNA stock solution. Each siRNA stock solution was diluted to 200 μg / μL using DEPC-free water, and then an equal volume of 10% glucose solution was added to a final glucose concentration of 5%. BioShuttle siRNA in vivo transfection reagent was then added at a 1:1 weight-to-volume ratio, carefully mixed, and incubated at room temperature for 15 minutes to form a stable nanocomplex. Next, early adult nematodes were selected for microinjection. They were anesthetized and fixed on an agar pad. Using a high-resolution microinjection system, the injection solution was injected into the gonadal cells of the nematodes at a moderate angle, with an injection volume of approximately 1-2 μL. After injection, the nematodes were carefully transferred to M9 buffer for thaw and, once viability was restored, transferred to normal OP50 NGM plates for culture. A minimum of 50 nematodes were injected per injection to ensure sufficient progeny.

[0049] Example 3 Detection of knockdown effect of siRNA specifically targeting ALKB-1

[0050] (1) Collection of microinjected nematode offspring: Wild-type nematode N2 and a single wild-type nematode N2 successfully injected with siRNA in Example 2 or a PD model nematode preserved in this laboratory were cultured in OP50NGM plates according to the method in Example 1; after the offspring grew to the early adult stage, the nematodes were collected into a centrifuge tube using M9 buffer and washed twice with M9 to remove residual bacteria. The collected nematodes were quickly frozen with liquid nitrogen and stored in a -80°C ultra-low temperature freezer;

[0051] (2) Real-time quantitative PCR detection of gene transcription levels: RNA was extracted from wild-type nematode N2, ALKB-1 siRNA #1 / #2 / #3 groups, and NC siRNA group using the Trizol method. cDNA was obtained by reverse transcription. The transcription level of alkb-1 was detected by real-time quantitative PCR, with the transcription level of the gene cdc-42 as the internal reference.

[0052] Example 4 Identification of nematode aging and aging-related phenotypes

[0053] (1) Nematode lifespan experiment: Before conducting the lifespan experiment, wild-type N2 nematodes were cultured on fresh NGM plates for 2 to 3 generations, and the nematodes were ensured not to have experienced any starvation stimulation. Then, the nematodes were synchronized according to the synchronization process of Example 1 to obtain nematodes assimilated to the L1 stage. The L1 stage nematodes were further cultured on NGM plates until the late L4 stage or early adult stage.

[0054] All lifespan experiments were conducted at 20°C. Over 100 wild-type nematodes (N2), ALKB-1 siRNA #1 / #2 / #3 groups, and NC siRNA groups, in their late L4 or early adult stages, were plated onto lifespan assay plates. 10 μM 5-fluoro-2'-deoxyuridine (FUDR) was added to the plates to inhibit nematode reproduction, along with OP50 inactivated at 70°C for 30 minutes to eliminate the effects of bacterial metabolism. Late L4 nematodes were marked as the starting point of the lifespan experiment (t = 0). Surviving nematodes were counted daily, and nematodes were considered dead if they showed no response to mechanical stimulation. Nematodes that crawled off the plates, had protruding genitalia, or had larvae hatching internally were not counted as dead. Experimental data were analyzed using SPSS software and presented as Kaplan-Meier survival curves. Statistical differences were assessed using the log-rank (Mantel-Cox) test. Each lifespan experiment was repeated at least once, and the results of the repeated experiments were consistent.

[0055] (2) Detection of nematode movement ability: Cultivate nematodes according to the culture method of nematodes in the lifespan experiment. Then, transfer wild-type nematodes N2, ALKB-1 siRNA group, and NC siRNA group nematodes in the late L4 or early adult stage to the experimental plate and culture at 20°C. Monitor and record the activity of the nematodes daily: when the plate is tapped, if the nematodes crawl continuously in a sinusoidal pattern, it is determined to be in the fast activity period; otherwise, it is in the slow activity period. As with the lifespan experiment, to maintain the drug effect, the nematodes need to be transferred to a new culture plate every two days. The activity data of the nematodes were analyzed and processed using the t-test.

[0056] Example 5 Phenotypic Identification of the Nematode Model of Parkinson's Disease

[0057] (1) Movement disorder phenotype experiment: Wild-type nematode N2 and offspring of α-synuclein (A53T) PD model nematodes microinjected with ALKB-1 siRNA and NC siRNA were cultured according to the nematode culture method in the lifespan experiment. Then, nematodes in the late L4 stage or early adult stage were transferred to the experimental plate and cultured at 25°C. The late L4 stage nematodes were marked as the starting point of the experiment (t = 0, i.e., day 0). On the fifth day, the nematodes were transferred to a drop of M9 on a glass slide, and a 30-second movement video was taken. The number of nematode swings was then counted. The movement results were statistically analyzed using a t-test.

[0058] (2) Dopamine neuron damage phenotype experiment: PD model nematodes were cultured according to the movement disorder phenotype experiment. The morphology of dopamine neurons was observed under a fluorescence microscope on days 5, 8, and 12. The proportions of normal and damaged (including blebbing, neuronal loss, and rupture) neurons were calculated and the results were statistically analyzed using the t-test.

[0059] Example 6 Identification of ALKB-1 Enzyme Activity and Analysis of Biological Function

[0060] The amino acid sequences of ALKB-1 in nematodes were compared with its homologs ALKBH1 in humans, mice, fruit flies, and other animals to determine their conserved motifs and amino acid sites. CRISPR point mutation knockout technology was used to construct an enzyme-inactive mutant nematode strain of ALKB-1. Then, samples of wild-type nematodes N2 and ALKB-1 enzyme-inactive mutant nematodes were collected, and genomic DNA, messenger RNA (mRNA), and transfer RNA (tRNA) were isolated and extracted. The mRNA expression of the two groups was then detected using the dot blot method. 6 A and m 1 A modified differences, the results were analyzed using t test.

[0061] Experimental results of Examples 1 to 6

[0062] (1) Targeted siRNA specifically knocks down the transcriptional expression of ALKB-1

[0063] Table 1 Functional sequence information of siRNA targeting ALKB-1

[0064]

[0065]

[0066] The results of designing and synthesizing ALKB-1 targeting siRNA functional sequence fragments using ALKB-1 mRNA as a template are shown in Table 1. Figure 1 It can be seen that the alkb-1 transcription level of nematode offspring that successfully ingested ALKB-1 targeted siRNA by microinjection was detected by real-time quantitative PCR. It was found that the ALKB-1 targeted siRNA designed and synthesized by microinjection delivery can significantly and specifically knock down the expression of ALKB-1 (without affecting the transcription of other Alkb family and demethylase genes), among which ALKB-1 siRNA#3 had the most significant knockdown effect, with a knockdown efficiency of ≥70%.

[0067] (2) Targeted siRNA specifically knocks down ALKB-1 to extend the lifespan of wild-type N2 nematodes and improve their motility

[0068] Table 2 Effects of targeted siRNA-specific knockdown of ALKB-1 on the lifespan of wild-type N2 nematodes

[0069]

[0070]

[0071] Note: Lifespan analysis was performed using SPSS Kaplan-Meier analysis, and statistical differences (P values) were calculated using the log-rank test. N represents the number of nematodes included in the final statistical results. The experiment was performed with three independent biological replicates.

[0072] Table 3 Effects of targeted siRNA-specific knockdown of ALKB-1 on the motility of wild-type N2 nematodes

[0073]

[0074] Note: Motility tests were analyzed using SPSS Kaplan-Meier analysis, and statistical differences (P values) were calculated using the log-rank test. N represents the number of nematodes included in the final statistical results. The experiment was performed with three independent biological replicates.

[0075] Survival analysis and motility test were performed on the offspring of wild-type N2 nematodes that had successfully received ALKB-1 siRNA by microinjection. Figure 2 As shown in Tables 2 and 3, it was found that the use of ALKB-1 siRNA #1, siRNA #2, and siRNA #3 to specifically knock down ALKB-1 can significantly prolong the lifespan of wild-type C. elegans N2 nematodes, and siRNA #3 has the most significant effect in delaying aging, with an extension rate of up to 16.7% ( Figure 2 Therefore, siRNA#3 was used to achieve specific knockdown of ALKB-1 in the subsequent studies. siRNA knockdown of ALKB-1 significantly prolonged the rapid movement period of C. elegans, indicating that siRNA-specific knockdown of ALKB-1 slowed down the process of slowing movement speed with aging ( Figure 2 The above results demonstrate that siRNA targeted intervention of ALKB-1 expression can delay aging and improve healthy lifespan.

[0076] (3) Effects of siRNA-targeted intervention of ALKB-1 on movement disorders and dopamine neuron damage phenotypes in the nematode model of PD

[0077] The effects of siRNA targeting ALKB-1 on the phenotypes of motor impairment and dopamine neuron damage in the nematode model of PD (overexpression of α-synuclein in neurons) were analyzed. Figure 3 As shown in Figure 2, it was found that siRNA-specific knockdown of ALKB-1 could significantly improve the movement disorder of PD model nematodes ( Figure 3 (A) in the figure), and it can also significantly reduce the damage ratio of dopamine neurons ( Figure 3 The above results indicate that knockdown of ALKB-1 by siRNA can improve the pathogenesis of Parkinson's disease.

[0078] (4) Identification of ALKB-1 enzyme activity and biological function analysis

[0079] By comparing the amino acid sequences ( Figure 4 (A) in the figure) determined that the key active sites of the demethylase ALKB-1 are the 245th histidine and 247th aspartic acid residues, and then used CRISPR technology to construct an ALKB-1 enzyme-inactive mutant nematode strain (alkb-1D247A) ( Figure 4 (B) in the figure); the genomic DNA, mRNA and tRNA of wild-type N2 nematodes and ALKB-1 enzyme inactive mutant nematodes were extracted respectively, and the difference in methylation modification levels between the two was detected by Dot Blot. Figure 4 As shown in Figures (C) and (D), tRNA m1A methylation levels were significantly higher in nematodes with ALKB-1 inactivation compared to wild-type nematodes, indicating that the nematode demethylase ALKB-1 primarily mediates tRNA m1A demethylation in nematodes. Because tRNA m1A modification regulates protein homeostasis by affecting translation, it is closely associated with aging and age-related diseases. This suggests that siRNA-targeted intervention with ALKB-1 may regulate aging by modulating tRNA methylation and influencing protein homeostasis.

[0080] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A siRNA #1 that targets and inhibits the expression of ALKB-1 gene or ALKBH1 gene, characterized in that: The nucleotide sequence of the sense strand of siRNA#1 is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of siRNA#1 is shown in SEQ ID NO:

2.

2. A siRNA #2 that targets and inhibits the expression of ALKB-1 gene or ALKBH1 gene, characterized in that: The nucleotide sequence of the sense strand of siRNA#2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of siRNA#2 is shown in SEQ ID NO:

4.

3. A siRNA #3 that targets and inhibits the expression of ALKB-1 gene or ALKBH1 gene, characterized in that: The nucleotide sequence of the sense strand of siRNA#3 is shown in SEQ ID NO: 5, and the nucleotide sequence of the antisense strand of siRNA#3 is shown in SEQ ID NO:

6.

4. Use of the siRNA#1 according to claim 1, the siRNA#2 according to claim 2, or the siRNA#3 according to claim 3 in the preparation of anti-aging drugs.

5. Use of the siRNA#1 according to claim 1, the siRNA#2 according to claim 2, or the siRNA#3 according to claim 3 in the preparation of an anti-Parkinson's disease drug.

6. A pharmaceutical composition, characterized in that Contains one or more of the siRNA#1 according to claim 1, the siRNA#2 according to claim 2, and the siRNA#3 according to claim 3.

Citation Information

Patent Citations

  • Application of ALKBH1 as adipocyte aging marker

    CN116445516A

  • Method of survival and protection of neurons by inhibitors of RNA m6A demethylases FTO and ALKBH5

    GB202019041D0