Monkey pox virus nano-vaccine based on STING agonist and silicon nano-particles as well as preparation method and application of monkey pox virus nano-vaccine

Abstract

The invention relates to a monkey pox virus nano vaccine based on an STING agonist and silicon nanoparticles as well as a preparation method and application of the monkey pox virus nano vaccine. The nano vaccine comprises a monkey pox virus antigen, the silicon nanoparticles and the STING agonist, the monkey pox virus antigen is combined to the surface of the silicon nanoparticle through a DogTag-DogCatcher system; the STING agonist is connected to the surface of the monkey pox virus antigen. The monkey pox virus antigen is covalently coupled with the silicon nanoparticles, and the antigen is displayed on the surfaces of the particles in a specific spatial orientation manner, so that the multivalence and accessibility of the antigen are enhanced, the shielding effect of the silicon nanoparticles on epitopes of the antigen is reduced, and the immune response induced by the vaccine is higher than that of a monomer immunogen protein.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly relates to a monkeypox virus nano-vaccine based on STING agonists and silicon nanoparticles, a preparation method thereof, and an application thereof. Background Art

[0002] Monkeypox virus (MPXV) belongs to the genus Orthopoxvirus of the family Orthopoxviridae, and is an enveloped double-stranded DNA virus with a brick-shaped or oval appearance. Its complex and large protein system provides sufficient conditions for the replication of the virus in cells. It is mainly transmitted between people through close contact, and can also be infected through droplets, contact with virus contaminants, etc.

[0003] Monkeypox virus mainly has two infection forms. One is the intracellular mature virion (IMV) attached to host cells, and the other is the extracellular enveloped virion (EEV) released from host cells in a budding form. Among them, the A29L protein, M1R protein of IMV and the A35R protein of EEV have been proven to be important targets of neutralizing antibodies and are the main antigens for the development of monkeypox vaccines. Current research shows that the antibodies produced by a single antigen protein may only act on a specific stage of virus infection, and the combination of multiple antigen proteins can induce a better immune response. Therefore, a multi-antigen vaccine containing IMV and EEV is an ideal new generation of monkeypox protein vaccine.

[0004] Nano-vaccines are a new type of, safer, economical and effective vaccines. Based on the structure and properties of nanoparticles, antigens and adjuvants are assembled and delivered through gene fusion, chemical modification or physical action to simulate pathogens to activate antigen-presenting cells, enhance the effective delivery and presentation of antigen molecules, and induce a highly efficient immune response.

[0005] As a vaccine adjuvant and antigen delivery system, silicon nanoparticles have good biocompatibility and stability. Their unique mesoporous structure, high specific surface area and large pore volume can load a large amount of antigens and small molecule adjuvants through surface modification, extend the residence time of antigens and adjuvants, and promote the phagocytosis and uptake of antigen-presenting cells.

[0006] The monkeypox epidemic shows hidden transmission, unclear infection sources, and great difficulty in prevention and control. Moreover, there is currently no effective specific vaccine against monkeypox virus. Therefore, developing a safe and effective monkeypox virus vaccine is an urgent problem to be solved globally at present. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a monkeypox virus nano-vaccine based on STING agonists and silicon nanoparticles, a preparation method thereof, and an application thereof. The nano-vaccine constructed by the present invention significantly improves the immune response effect.

[0008] To achieve this goal, the present invention adopts the following technical solutions:

[0009] In a first aspect, the present invention provides a monkeypox virus nano-vaccine based on a STING agonist and silicon nanoparticles, and the nano-vaccine includes monkeypox virus antigen, silicon nanoparticles, and a STING agonist;

[0010] The poxvirus antigen is bound to the surface of the silicon nanoparticles through the DogTag-DogCatcher system; the STING agonist is connected to the surface of the monkeypox virus antigen.

[0011] In the present invention, a novel monkeypox virus nano-vaccine is designed. The monkeypox virus nano-vaccine is simultaneously conjugated with a STING agonist (such as STG982), realizing the synchronous delivery of antigen and adjuvant. The silicon nanoparticles are used to load a large amount of antigen and adjuvant, increasing the size of the vaccine and achieving multi-antigen accessibility. At the same time, the STING signaling pathway is activated to enhance the depth and breadth of the immune response. The immune response induced by the obtained monkeypox virus nano-vaccine is significantly higher than that of Si-Ag.

[0012] Preferably, the monkeypox virus antigen is fused and expressed with the DogCatcher polypeptide.

[0013] In a specific embodiment of the present invention, the nucleic acid sequence of DogCatcher used is SEQ ID No.1.

[0014] SEQ ID No.1:

[0015] AAACTGGGCGAAATTGAATTTATTAAAGTGGATAAAACCGATAAAAAACCGCTGCGCGGCGCGGTGTTTAGCCTGCAGAAACAGCATCCGGATTATCCGGATATTTATGGCGCGATTGATCAGAACGGCACCTATCAGGATGTGCGCACCGGCGAAGATGGCAAACTGACCTTTACCAACCTGAGCGATGGCAAATATCGCCTGATTGAAAACAGCGAACCGCCGGGCTATAAACCGGTGCAGAACAAACCGATTGTGAGCTTTCGCATTGTGGATGGCGAAGTGCGCGATGTGACCAGCATTGTGCCGCAG.

[0016] Preferably, the amino group of the silicon nanoparticles is connected to the carboxyl group of the DogTag polypeptide.

[0017] In a specific embodiment of the present invention, the nucleic acid sequence of the DogTag used is SEQ ID No. 2.

[0018] SEQ ID No. 2:

[0019] GATATTCCGGCGACCTATGAATTTACCGATGGCAAACATTATATTACCAACGAACCGATTCCGCCGAAA.

[0020] Preferably, the monkeypox virus antigen includes any one or a combination of at least two of the A29L protein, A35R protein, or M1R protein.

[0021] In a specific implementation of the present invention, the nucleic acid sequence of A29L used is SEQ ID No. 3, the nucleic acid sequence of A35R is SEQ ID No. 4, and the nucleic acid sequence of M1R is SEQ ID No. 5.

[0022] SEQ ID No. 3:

[0023] ATGGATGGCACCCTGTTTCCGGGCGATGATGATCTGGCGATTCCGGCGACCGAATTTTTTAGCACCAAAGCGGCGAAAAACCCGGAAACCAAACGCGAAGCGATTGTGAAAGCGTATGGCGATGATAACGAAGAAACCCTGAAACAGCGCCTGACCAACCTGGAAAAAAAAATTACCAACATTACCACCAAATTTGAACAGATTGAAAAATGCTGCAAACGCAACGATGAAGTGCTGTTTCGCCTGGAAAACCATGCGGAAACCCTGCGCGCGGCGATGATTAGCCTGGCGAAAAAAATTGATGTGCAGACCGGCCGCCATCCGTATGAAGGCAGCGGCGAAAGCGGCGGCAGCGGCAAACTGGGCGAAATTGAATTTATTAAAGTGGATAAAACCGATAAAAAACCGCTGCGCGGCGCGGTGTTTAGCCTGCAGAAACAGCATCCGGATTATCCGGATATTTATGGCGCGATTGATCAGAACGGCACCTATCAGGATGTGCGCACCGGCGAAGATGGCAAACTGACCTTTACCAACCTGAGCGATGGCAAATATCGCCTGATTGAAAACAGCGAACCGCCGGGCTATAAACCGGTGCAGAACAAACCGATTGTGAGCTTTCGCATTGTGGATGGCGAAGTGCGCGATGTGACCAGCATTGTGCCGCAG。

[0024] SEQ ID No.4:

[0025] AACCAGTGCATGAGCGCGAACAAAGCGGCGATTACCGATAGCGCGGTGGCGGTGGCGGCGGCGAGCAGCACCCATCGCAAAGTGGTGAGCAGCACCACCCAGTATGATCATAAAGAAAGCTGCAACGGCCTGTATTATCAGGGCAGCTGCTATATTCTGCATAGCGATTATAAAAGCTTTGAAGATGCGAAAGCGAACTGCGCGGCGGAAAGCAGCACCCTGCCGAACAAAAGCGATGTGCTGACCACCTGGCTGATTGATTATGTGGAAGATACCTGGGGCAGCGATGGCAACCCGATTACCAAAACCACCAGCGATTATCAGGATAGCGATGTGAGCCAGGAAGTGCGCAAATATTTTTGCACCGGCAGCGGCGAAAGCGGCGGCAGCGGCAAACTGGGCGAAATTGAATTTATTAAAGTGGATAAAACCGATAAAAAACCGCTGCGCGGCGCGGTGTTTAGCCTGCAGAAACAGCATCCGGATTATCCGGATATTTATGGCGCGATTGATCAGAACGGCACCTATCAGGATGTGCGCACCGGCGAAGATGGCAAACTGACCTTTACCAACCTGAGCGATGGCAAATATCGCCTGATTGAAAACAGCGAACCGCCGGGCTATAAACCGGTGCAGAACAAACCGATTGTGAGCTTTCGCATTGTGGATGGCGAAGTGCGCGATGTGACCAGCATTGTGCCGCAG

[0026] SEQ ID No.5:

[0027] ATGGATCATAACCAGTATCTGCTGACCATGTTTTTTGCGGATGATGATAGCTTTTTTAAATATTTTGCGAGCCAGGATGATGAAAGCAGCCTGAGCGATATTCTGCAGATTACCCAGTATCTGGATTTTCTGCTGCTGCTGCTGATTCAGAGCAAAAACAAACTGGAAGCGGTGGGCCATTGCTATGAAAGCCTGAGCGAAGAATATCGCCAGCTGACCAAATTTACCGATAGCCAGGATTTTAAAAAACTGTTTAACAAAGTGCCGATTGTGACCGATGGCCGCGTGAAACTGAACAAAGGCTATCTGTTTGATTTTGTGATTAGCCTGATGCGCTTTAAAAAAGAAAGCGCGCTGGCGACCACCGCGATTGATCCGGTGCGCTATATTGATCCGCGCCGCGATATTGCGTTTAGCAACGTGATGGATATTCTGAAAAGCAACAAAGTGGAACAGGGCAGCGGCGAAAGCGGCGGCAGCGGCAAACTGGGCGAAATTGAATTTATTAAAGTGGATAAAACCGATAAAAAACCGCTGCGCGGCGCGGTGTTTAGCCTGCAGAAACAGCATCCGGATTATCCGGATATTTATGGCGCGATTGATCAGAACGGCACCTATCAGGATGTGCGCACCGGCGAAGATGGCAAACTGACCTTTACCAACCTGAGCGATGGCAAATATCGCCTGATTGAAAACAGCGAACCGCCGGGCTATAAACCGGTGCAGAACAAACCGATTGTGAGCTTTCGCATTGTGGATGGCGAAGTGCGCGATGTGACCAGCATTGTGCCGCAG。

[0028] Preferably, the STING agonist includes any one or a combination of at least two of STG982, c-di-AMP, 2’,3’-cGAMP or SR-717.

[0029] Second aspect, the present invention provides a preparation method of the monkeypox virus nano-vaccine based on STING agonist and silicon nanoparticles according to the first aspect, and the preparation method includes: fusing and expressing monkeypox virus antigen with DogCatcher polypeptide to obtain an antigen conjugate, coupling silicon nanoparticles with DogTag to form a silicon nano-conjugate, incubating the antigen conjugate with the silicon nano-conjugate to obtain nanoparticles, and respectively performing modification reactions on the nanoparticles and the agonist and then connecting them to prepare.

[0030] Preferably, the fusion expression includes constructing a nucleic acid sequence connecting monkeypox virus antigen and DogCatcher polypeptide and connecting it with a plasmid to construct an expression vector, transferring it into competent cells, inducing and sonicating, and purifying to obtain the antigen conjugate.

[0031] Preferably, the inducer includes IPTG.

[0032] Preferably, the concentration of the inducer is 0.3 - 0.8 mM, for example, it can be 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM or 0.8 mM, etc.

[0033] Preferably, when the monkeypox virus antigen is A29L protein, the induction temperature is 15 - 25 °C and the time is 15 - 25 h. The 15 - 25 °C, for example, can be 15 °C, 16 °C, 17 °C, 18 °C, 19 °C, 20 °C, 21 °C, 22 °C, 23 °C, 24 °C or 25 °C, etc. The 15 - 25 h, for example, can be 15 h, 16 h, 17 h, 18 h, 19 h, 20 h, 21 h, 22 h, 23 h, 24 h or 25 h, etc.

[0034] Preferably, when the monkeypox virus antigen is A35R protein or M1R protein, the induction temperature is 35 - 40 °C and the time is 2 - 6 h. The 35 - 40 °C, for example, can be 35 °C, 36 °C, 37 °C, 38 °C, 39 °C or 40 °C, etc. The 2 - 6 h, for example, can be 2 h, 3 h, 4 h, 5 h or 6 h, etc.

[0035] Preferably, the purification method includes agarose gel affinity chromatography.

[0036] Preferably, the preparation method of the silicon nano-conjugate includes: mixing and dissolving silicon nanoparticles, 1-ethyl-(3-dimethylaminopropyl)carbodiimide, N-hydroxysulfosuccinimide and DogTag polypeptide in a buffer solution for reaction, and performing dialysis to prepare.

[0037] Preferably, the molar ratio of the silicon nanoparticles, 1-ethyl-(3-dimethylaminopropyl)carbodiimide, N-hydroxysulfosuccinimide, and DogTag polypeptide is 1:(45-55):(45-55):(0.5-2). The "(45-55)" can be, for example, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55, etc. The "(0.5-2)" can be, for example, 0.5, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, or 2.0, etc.

[0038] Preferably, the buffer solution includes MES buffer solution.

[0039] Preferably, the temperature of the reaction is 20-30°C and the time is 8-16 h. The "20-30°C" can be, for example, 20°C, 22°C, 24°C, 26°C, 28°C, or 30°C, etc. The "8-16 h" can be, for example, 8 h, 9 h, 10 h, 11 h, 12 h, 13 h, 14 h, 15 h, or 16 h, etc.

[0040] Preferably, the dialysis solution for dialysis includes phosphate buffer solution.

[0041] Preferably, the molar ratio of the antigen conjugate to the silicon nanoparticle conjugate is 4:(1-5). The "(1-5)" can be, for example, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or 5, etc.

[0042] Preferably, the temperature of the incubation is 1-5°C and the time is 4-12 h. The "1-5°C" can be, for example, 1°C, 1.5°C, 2°C, 2.5°C, 3°C, 3.5°C, 4°C, 4.5°C, or 5°C, etc. The "4-12 h" can be, for example, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, or 12 h, etc.

[0043] Preferably, the nanoparticles after the modification reaction are linked with sulfhydryl groups.

[0044] Preferably, the agonist after the modification reaction is linked with maleimide groups.

[0045] Preferably, the molar ratio of the nanoparticles to the agonist is 1:(3-6). The "(3-6)" can be, for example, 3, 3.5, 4, 4.5, 5, 5.5, or 6, etc.

[0046] Preferably, the temperature of the linking reaction is 1-5°C and the time is 4-12 h. The "1-5°C" can be, for example, 1°C, 1.5°C, 2°C, 2.5°C, 3°C, 3.5°C, 4°C, 4.5°C, or 5°C, etc. The "4-12 h" can be, for example, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, or 12 h, etc.

[0047] In a third aspect, the present invention provides an application of the monkeypox virus nano-vaccine based on a STING agonist and silicon nanoparticles described in the first aspect or the preparation method of the monkeypox virus nano-vaccine based on a STING agonist and silicon nanoparticles described in the second aspect in the preparation of monkeypox preventive drugs.

[0048] Compared with the prior art, the present invention has at least the following beneficial effects:

[0049] 1. The present invention covalently couples three monkeypox virus antigens (A29L, A35R, and M1R) with silicon nanoparticles through the DogTag-DogCatcher system. The antigens are displayed on the particle surface in a specific spatial orientation, enhancing the multivalency and accessibility of the antigens, while reducing the shielding effect of silicon nanoparticles on antigen epitopes. The immune response induced by the Si-Ag obtained by this method is higher than that of the monomeric immunogenic protein.

[0050] 2. The monkeypox virus nano-vaccine of the present invention simultaneously conjugates a STING agonist, achieving synchronous delivery of the antigen and the adjuvant. The silicon nanoparticles load a large amount of antigen and adjuvant, increasing the vaccine size and achieving the accessibility of multiple antigens, while activating the STING signaling pathway and enhancing the depth and breadth of the immune response. The immune response induced by the vaccine obtained by this method is significantly higher than that of Si-Ag. Description of the Drawings

[0051] Figure 1 It is a reaction schematic diagram for vaccine preparation.

[0052] Figure 2 It is a dynamic light scattering analysis diagram. Among them, Figure a is the particle size distribution diagram of A29L-vaccine, Figure b is the particle size of A35R-vaccine, and Figure c is the particle size distribution diagram of M1R-vaccine.

[0053] Figure 3 It is a Fourier transform infrared spectroscopy analysis diagram.

[0054] Figure 4 It is an electron microscopy image of the nano-vaccine.

[0055] Figure 5 It is a storage stability analysis diagram of the nano-vaccine.

[0056] Figure 6It is a graph of the humoral immune level generated by the nano-vaccine. Among them, Figure a is the graph of the titer of A29L-specific IgG antibody, Figure b is the graph of the titer of A35R-specific IgG antibody, Figure c is the graph of the titer of M1R-specific IgG antibody; Figure d is the graph of the titer of A29L-specific IgG1 / IgG2a antibody, Figure e is the graph of the titer of A35R-specific IgG1 / IgG2a antibody, Figure f is the graph of the titer of M1R-specific IgG1 / IgG2a antibody; Figure g is the graph of the titer of three antigen-specific IgG2b antibodies; Figure h is the graph of the titer of three antigen-specific IgM antibodies.

[0057] Figure 7 It is a graph of the antibody affinity evaluation results of the nano-vaccine.

[0058] Figure 8 It is a graph of the level of splenic secreted cytokines generated by the nano-vaccine. Among them, Figure a is the bar graph of the concentration of IFN-γ;

[0059] Figure b is the bar graph of the concentration of TNF-α, Figure c is the bar graph of the concentration of IL-2, Figure d is the bar graph of the concentration of IL-4, Figure e is

[0060] the bar graph of the concentration of IL-5, and Figure f is the bar graph of the concentration of IL-10.

[0061] Figure 9 It is a bar analysis graph of the level of splenic cytokines generated by the nano-vaccine. Among them, Figure a is the bar analysis graph of the percentages of IFN-γ + and IL-4 + cells in CD4 + T cells stimulated by A29L, Figure b is the bar analysis graph of the percentages of IFN-γ + and IL-4 + cells in CD4 + T cells stimulated by A35R, Figure c is the bar analysis graph of the percentages of IFN-γ + and IL-4 + cells in CD4 + T cells stimulated by M1R; Figure d is the bar analysis graph of the percentages of IFN-γ + and IL-4 + cells in CD8 + T cells stimulated by A29L, Figure e is the bar analysis graph of the percentages of IFN-γ + and IL-4 + cells in CD8 + T cells stimulated by A35R, Figure f is the bar analysis graph of the percentages of IFN-γ + and IL-4 + cells in CD8 + T cells stimulated by M1R.

[0062] Figure 10 Bar chart analysis of the levels of splenic memory T cells and memory B cells generated by the nano-vaccine. Among them, Figure a is the bar chart analysis of the percentage of central memory T cells in CD4 + and CD8 + T cells stimulated by A29L, Figure b is the bar chart analysis of the percentage of central memory T cells in CD4 + and CD8 + T cells stimulated by A35R, Figure c is the bar chart analysis of the percentage of central memory T cells in CD4 + and CD8 + T cells stimulated by M1R; Figure d is the bar chart analysis of the percentage of effector memory T cells in CD4 + and CD8 + T cells stimulated by A29L, Figure e is the bar chart analysis of the percentage of effector memory T cells in CD4 + and CD8 + T cells stimulated by A35R, Figure f is the bar chart analysis of the percentage of effector memory T cells in CD4 + and CD8 + T cells stimulated by M1R; Figure g is the bar chart analysis of the percentage of specific memory B cells stimulated by A29L, A35R and M1R.

[0063] Figure 11 Bar chart analysis of the levels of activated splenocytes generated by the nano-vaccine. Among them, Figure a is the bar chart analysis of the percentage of activated B cells stimulated by A29L, A35R and M1R, Figure b is the bar chart analysis of the percentage of activated CD4 T cells stimulated by A29L, A35R and M1R, and Figure c is the bar chart analysis of the percentage of activated CD8 T cells stimulated by A29L, A35R and M1R.

[0064] Figure 12 Bar chart analysis of the activation level of cytotoxic T lymphocytes generated by the nano-vaccine. Among them, Figure a is the bar chart analysis of the percentage of CD8 + T cell surface CD107a + cell percentage stimulated by A29L, A35R and M1R, and Figure b is the bar chart analysis of the percentage of FasL + on the surface of CD8 + T cells stimulated by A29L, A35R and M1R.

[0065] Figure 13 Bar chart analysis of the proliferation level of splenocytes generated by the nano-vaccine.

[0066] Figure 14Column analysis chart of the maturation level of nano-vaccine-stimulated mouse bone marrow-derived dendritic cells (BMDCs) in vitro. Among them, Figure a is the column analysis chart of the percentage of CD80 + MHCII + cells on the surface of BMDCs stimulated by PBS, antigen, Si-Ag, and vaccine, and Figure b is the column analysis chart of the percentage of CD86 + MHCII + cells on the surface of BMDCs stimulated by PBS, antigen, Si-Ag, and vaccine.

[0067] Figure 15 Column analysis chart of the protective effect of nano-vaccine on mice challenged with a lethal dose of monkeypox virus. Detailed implementation mode

[0068] The technical solution of the present invention will be further described below in conjunction with the accompanying drawings and through specific implementation modes. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of the protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0069] Sources of the kits used in the following examples:

[0070] Cytokine kit: BioLegend.

[0071] Example 1

[0072] Preparation of monkeypox virus nano-vaccine is carried out in this example

[0073] (1) Nucleic acid sequence

[0074] In this example, the nucleic acid sequence of DogCatcher is SEQ ID No.1, the nucleic acid sequence of DogTag is SEQ ID No.2, the nucleic acid sequence of A29L is SEQ ID No.3, the nucleic acid sequence of A35R is SEQ ID No.4, the nucleic acid sequence of M1R is SEQ ID No.5, and the connection mode between DogCatcher and the antigen in the antigen conjugate is fusion expression in Escherichia coli.

[0075] (2) Preparation of antigen conjugate

[0076] Construct the gene sequences of A29L-DogCatcher, A35R-DogCatcher and M1R-DogCatcher respectively, synthesize the pET-28a(+) plasmid vector respectively, and transform it into BL21(DE3) competent cells. The strains containing the target gene were screened by the plate coating method. The screened strains were cultured on a large scale. For A29L-DogCatcher, 0.5 mM IPTG was used and induced at 20 °C for 20 h. For A35R-DogCatcher and M1R-DogCatcher, 0.5 mM IPTG was used and induced at 37 °C for 4 h, and the cells were collected by centrifugation.

[0077] Resuspend the cells in 50 mM Tris-HCl buffer (pH 8.0) at a ratio of 10%, stir evenly, and then use an ultrasonic cell disruptor to disrupt the cells. After the ultrasonic treatment, the inclusion bodies and the supernatant were separated at 10000 rpm. After washing the inclusion bodies of A35R-DogCatcher and M1R-DogCatcher 3 times, add the inclusion body lysate to make the final protein concentration 1 mg / mL, and place it in a water bath at 37 °C for 3 h to obtain the inclusion body denatured solution. The inclusion body denatured solution was slowly dropped into 10 times the volume of the inclusion body renaturation solution at 4 °C, so that the final protein concentration in the inclusion body renaturation solution was 0.1 mg / mL. Finally, stir and renature overnight at 4 °C.

[0078] The supernatant of A29L-DogCatcher, the protein renaturation solutions of A35R-DogCatcher and M1R-DogCatcher were purified by Ni-agarose gel affinity chromatography to remove the impurity proteins and exchanged into 20 mM phosphate buffer (pH 7.4) to obtain relatively pure A29L-DogCatcher protein, A35R-DogCatcher protein and M1R-DogCatcher protein.

[0079] (3) Preparation of silicon nanoconjugates

[0080] Prepare 20 mM MES buffer (pH 4.5), take silicon nanoparticles, 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), N-hydroxysulfosuccinimide (Sulfo-NHS) and DogTag respectively, and mix them according to a molar ratio of 1:50:50:1, react at 25 °C for 12 h, and dialyze thoroughly into 20 mM phosphate buffer (pH 7.4) using a dialysis bag with a molecular weight cut-off of 2 kDa. Obtain the silicon nanoparticle and DogTag conjugate (Si-DogTag).

[0081] (4) Preparation of monkeypox virus nano-vaccine

[0082] The fusion expression products of three antigens and DogCatcher (Ag-DogCatcher) were respectively mixed with Si-DogTag at a molar ratio of 4:3 and reacted at 4°C for 8 h to obtain the nanoparticles Si-Ag. Si-Ag was reacted with 2-iminothiolane at a molar ratio of 1:40 at 4°C for 5 h, and then reacted with STG982 with a maleimide group at a molar ratio of 1:4.5 at 4°C for 8 h to obtain the nanoparticle vaccine. The preparation process of the vaccine is as Figure 1 shown.

[0083] Example 2

[0084] In this example, the structural characterization of the vaccine was carried out

[0085] (1) Dynamic light scattering detection

[0086] The hydrodynamic diameter of the vaccine was analyzed by dynamic light scattering (DLS). The sample concentration was adjusted by dilution to 0.2 mg / mL, 60 μL was aspirated and added to a cuvette, and at room temperature, the particle size and polydispersity index (PDI) of A29L-vaccine, A35R-vaccine, and M1R-vaccine were measured using a Zetasizer Nano ZS. After repeating the scan three times, the average particle size was calculated. As Figure 2 shown in Figure a, the size of A29L-vaccine was 195 nm, and the average PDI was 0.14. As Figure 2 shown in Figure b, the size of A35R-vaccine was 220 nm, and the average PDI was 0.18. As Figure 2 shown in Figure c, the size of M1R-vaccine was 255 nm, and the average PDI was 0.15. Compared with the three uncoupled antigens, the size of the silicon nanoparticles was 51 nm, the size of A29L-DogCatcher protein was 28 nm, the size of A35R-DogCatcher protein was 30 nm, and the size of M1R-DogCatcher protein was 38 nm. The diameters of the three vaccine particles increased significantly, indicating that the vaccine was successfully prepared.

[0087] (2) Infrared spectroscopy detection

[0088] Infrared spectroscopy was used to analyze the chemical structure and functional group changes before and after vaccine coupling. The silica nanoparticles (Si), Si-Ag, and vaccine samples were dialyzed and replaced with distilled water, and then the EP tubes were sealed with a sealing film and densely punctured with small holes. They were frozen overnight at -80°C, taken out and placed in a freeze dryer for lyophilization, and lyophilized at -50°C for 24 h until completely dehydrated. A small amount of the lyophilized sample was mixed with KBr, ground thoroughly, and pressed into a transparent thin film, which was placed in an FT-IR spectrometer and scanned in the wavenumber range of 4000 - 400 cm -1 and the average value was taken after repeating 30 times. As Figure 3 shown, Si had a peak at 1112 cm-1 (Si-O-Si stretching), 802 cm -1 (Si-O stretching), 475 cm -1 (Si-O stretching) and 3440 cm -1 (N-H stretching) showed typical transmission peaks. Compared with Si, Si-Ag showed a right-shifted peak and stronger absorption at 3420 cm -1 , which was attributed to the serine and lysine residues (O-H stretching and N-H stretching) of the conjugated antigen, indicating that the antigen was successfully conjugated to the silicon nanoparticles. In addition, minor changes were observed at 1450 cm -1 (C-O vibration), 1108 cm -1 (C-O stretching) and 2900 cm -1 (C-H stretching). Compared with Si-Ag, due to the binding of STG982, the peak (C-O stretching) of the vaccine at 1108 cm -1 shifted to 1090 cm -1 , indicating that STG982 was conjugated to the antigen protein.

[0089] (3) Transmission electron microscopy detection

[0090] Transmission electron microscopy can characterize the morphological appearance of the nano-vaccine. Prepare a 20 mg / mL uranyl acetate solution and filter it through a 0.22 μm filter membrane to obtain a negative staining dye. Prepare a 0.5 mg / mL vaccine sample, pipette 10 μL and drop it onto a copper grid, let it stand for 1 minute, wash it twice with an equal volume of deionized water, and stain it with the uranyl acetate solution to make the sample ready for use. As Figure 4 shown, the vaccine showed a solid spherical and porous dendritic morphology, with a size of about 200 nm, and no obvious aggregation occurred.

[0091] Use dynamic light scattering (DLS) to observe the particle size and PDI changes of the vaccine on days 0 and 14 to evaluate the storage stability of the vaccine. As Figure 5 shown, A29L-vaccine, A35R-vaccine, and M1R-vaccine did not show significant size changes after storage at 4°C for 14 days. It indicates that the vaccine has good storage stability at 4°C.

[0092] Example 3

[0093] This example measures the antibody levels induced by the vaccine

[0094] Twenty 8-week-old female BALB / c mice were selected and randomly divided into four groups, namely the PBS group, the antigen group, the Si-Ag group, and the vaccine group, with 5 mice in each group. By intramuscular injection, the injection dose was 8 μg of each of the three proteins per mouse each time, and the injections were given on days 0, 14, and 28, for a total of 3 injections. Before injecting the samples on days 14 and 28, 200 μL of blood was taken from the orbital cavity of the mice, and the mice were sacrificed on day 42 to collect the serum, which was stored at -80 °C for later use. The specific IgG, IgG1, IgG2a, IgG2b, and IgM against A29L, A35R, and M1R in the mouse serum were detected by ELISA.

[0095] As Figure 6 shown in panel a of 3 , the vaccine group showed a higher A29L-specific IgG titer (9.5×10 4 ) on day 28 (after two doses) than the antigen group (2.7×10 5 , P<0.01) and the Si-Ag group (8.1×10 Figure 6 , P<0.01), about 350 times that of the antigen group. Similarly, on day 28, as 5 shown in panels b and c of 5 , the vaccine group showed the highest A35R-specific IgG titer (2.9×10 6 ) and M1R-specific IgG titer (2.2×10 5 ) among the four groups. Two vaccinations could stimulate a strong antigen-specific antibody response. From day 28 to day 42 (after three doses), the three antigen-specific IgG titers increased rapidly, and the A29L-specific IgG titer (3.5×10 5 ), A35R-specific IgG titer (7.3×10 ), and M1R-specific IgG titer (7.4×10

[0096] ) of the vaccine group on day 42 (after three doses) were the highest among the four groups, 519, 91, and 112 times that of the antigen group respectively. After three doses of immunization, the IgG titers of the vaccine group were basically two orders of magnitude higher than those of the antigen group, indicating that the immunogenicity of the antigen protein itself was poor, and the three antigen-specific antibody titers were higher after the third vaccination than after the second vaccination, indicating that the immune boosting effect of the vaccine was obvious. This shows that the coupling of STG982 and silica nanoparticles can enhance the immune response of the antigen protein additively. Th2 cells mediate the humoral immune direction and can stimulate the production of antibody IgG1, while Th1 cells mediate the cell immune direction and can stimulate the production of antibody IgG2a. Th2 / Th1 is in a dynamic balance in the body, keeping the human immune system in a balanced state. The antigen-specific IgG1 and IgG2a titers of the mouse serum on day 42 were measured. As Figure 6As shown in Figures d, e, and f, the A29L, A35R, and M1R-specific IgG1 and IgG2a titers in the vaccine group were the highest among the four groups, and the IgG1 titer was lower than the IgG2a titer. The A29L, A35R, and M1R-specific IgG2a / IgG1 ratios (1.09, 3.61, and 3.73) in the vaccine group were higher than those in the Si-Ag group (0.39, 1.26, and 1.03). This indicates that the conjugation of STG982 altered the Th1 / Th2 balance. Since IgG1 and IgG2a are protective antibody isotypes, the vaccine elicited a strong protective humoral immunity.

[0097] IgG2b can specifically recognize various pathogens, activate the complement system, and maintain immune balance. The antigen-specific IgG2b titer in the mouse serum on day 42 was measured. As Figure 6 shown in Figure g, the A29L-specific (1.3×10 4 ), A35R-specific (6.8×10 3 ), and M1R-specific IgG2b titers (1.1×10 4 ) in the vaccine group were the highest among the four groups, and the A29L-specific IgG2b titer in the vaccine group was higher than the A35R- and M1R-specific Ig2b titers.

[0098] IgM is the antibody produced earliest in the early stage of pathogen infection and plays immune roles such as bacteriolysis and virus neutralization in the early stage of infection. The antigen-specific IgM titer in the mouse serum on day 42 was measured. As Figure 6 shown in Figure h, the three antigen-specific IgM titers were much lower than the corresponding IgG titers, but at the same time, it was found that there was a relatively obvious IgM titer in the PBS group. The A29L-specific (1.3×10 4 ), A35R-specific (6.8×10 3 ), and M1R-specific IgM titers (1.1×10 4 ) in the vaccine group were the highest among the four groups, and the A29L-specific IgM titer in the vaccine group was higher than the A35R- and M1R-specific IgM titers, indicating that the vaccine can stimulate the body to produce an immune response faster.

[0099] The enhancement of the antibody avidity index helps the body to produce immune memory. The competitive ELISA method was used to measure the antibody avidity level produced by the vaccine. The antibody avidity index (AI) was characterized by the sodium thiocyanate concentration corresponding to the elution of 50% of the specific antibody by sodium thiocyanate. The sodium thiocyanate concentration gradient was set as 0, 0.4, 0.6, 0.8, 1, 1.2, 1.6, and 2.4 mol / L. After incubation and color development, the OD 450 value was read, and the antibody avidity index AI was calculated. As Figure 7As shown, the AI values of specific IgG against A29L, A35R, and M1R in the vaccine group were higher than those in the antigen group and the Si-Ag group. Therefore, the conjugation of STG982 and silica nanoparticles can enhance the affinity of antigen-specific IgG, and the AI value of M1R-specific IgG in the vaccine group was higher than that of A29L- and A35R-specific IgG.

[0100] Example 4

[0101] In this example, the cytokine levels secreted by vaccine-induced splenocytes were measured.

[0102] On the 42nd day, fresh spleens of mice were taken, ground to isolate splenocytes, and cell culture was carried out in 24-well plates. The number of inoculated cells was 1×10 6 , and each well was stimulated with 8 μg of A29L, A35R, and M1R for 60 hours, and the supernatant was collected by centrifugation. The levels of IFN-γ, TNF-α, IL-2, IL-4, IL-5, and IL-10 in the cell culture supernatant were measured using a cytokine ELISA detection kit. As Figure 8 shown in Figures a, b, c, d, e, and f, after stimulation with A29L, the levels of IFN-γ, TNF-α, IL-2, IL-4, IL-5, and IL-10 in the vaccine group increased by 29.2, 1.59, 18.07, 25.63, 9.76, and 14.89 times, respectively, compared with the antigen group. After stimulation with A35R, the levels of the six cytokines in the vaccine group increased by 19.46, 3.34, 5.59, 8.5, 5.34, and 15.86 times compared with the antigen group. After stimulation with M1R, they increased by 19.14, 2.92, 17.04, 6.13, 10.52, and 5.73 times, respectively. Compared with the stimulation of A35R and M1R, the levels of IFN-γ, TNF-α, and IL-2 caused by A29L stimulation were higher, indicating that A29L has a better stimulating effect on Th1-type immunity. The levels of IL-4, IL-5, and IL-10 caused by M1R stimulation were higher than those of A29L and A35R stimulation, indicating that M1R shows stronger Th2-type immunity compared with A29L and A35R. Therefore, this vaccine can promote the secretion of Th1- and Th2-type splenocyte cytokines and can induce stronger cellular and humoral immune responses.

[0103] Example 5

[0104] In this example, the cytokine levels in splenocytes produced by the vaccine were measured.

[0105] On the 42nd day, fresh spleens of mice were taken, ground to isolate splenocytes, and cell culture was carried out in 24-well plates. The number of inoculated cells was 1×10 6, each well was stimulated with 8 μg of A29L, A35R, and M1R respectively for 6 hours, 1 μL of Golgiplug was added, and then the cells were cultured for another 5 h. The cell pellet was collected, and a mixed antibody of anti-CD3-APC, anti-CD4-FITC, and anti-CD8a-PE-Cy7 was prepared and used to stain the cells in the dark at 4 °C for 30 minutes. After fixing and permeabilizing the cells, a mixed antibody of IL-4-PE and IFN-γ-PerCP-Cyanine5.5 was prepared and used to stain the cells in the dark at 4 °C for 30 minutes. After washing the cells, flow cytometry was performed. As Figure 9 shown in Figures a, b, and c, after stimulation with A29L, A35R, and M1R respectively, the vaccine group showed a higher percentage of CD4 + IFN-γ + and CD4 + IL-4 + T cells than the antigen group and the Si-Ag group. Therefore, the vaccine can strongly stimulate antigen-specific CD4 + T cell responses. It should be noted that M1R stimulation of specific CD4 + IFN-γ + T cell responses was the most effective, while A29L stimulation of specific CD4 + IL-4 + T cell responses was the most effective. As Figure 9 shown in Figures d, e, and f, after stimulation with A29L, A35R, and M1R respectively, the percentage of CD8 + IFN-γ + and CD8 + IL-4 + T cells in the vaccine group was higher than that in the antigen group and the Si-Ag group. Therefore, the vaccine can strongly stimulate antigen-specific cytotoxic T lymphocyte (CTL) responses. In particular, A35R most effectively stimulated specific CD8 + IFN-γ + T cell responses, while A29L most effectively stimulated specific CD8 + IL-4 + T cell responses. It shows that after modification with silicon nanoparticles and STG982, the vaccine can induce strong cellular and humoral immunity.

[0106] Example 6

[0107] In this example, the levels of memory T cells and memory B cells in splenocytes produced by the vaccine were measured.

[0108] On the 42nd day, fresh spleens of mice were taken, ground to isolate spleen cells, and the cells were cultured in a 24-well plate. The number of inoculated cells was 1×10 6, each well was stimulated with 8 μg of A29L, A35R, and M1R for 48 hours. After collecting the cells, 1 μL / 1 mL of FVD was added, vortexed thoroughly, and stained in the dark at 4°C for 30 min. After washing the cells, a mixed antibody of CD4-eFluor450, CD8-PE-Cy7, CD44-PE, CD62L-APC, CD27-FITC, and CD19-AlexaFluor700 was prepared and used to stain the cells in the dark at 4°C for 30 minutes. After washing the cells, flow cytometry was performed. Central memory T cells (Central memory T cell, T CM ; CD44 + CD62L + ) express lymph node homing receptors, resulting in the retention of cells in secondary lymphoid organs; effector memory T cells (Effector memory T cell, T EM ; CD44 + CD62L - ) mediate effector functions.

[0109] As shown in Figure 10 Figure a, Figure b, and Figure c, the proportions of CD4 + T CM and CD8 + T CM cells in the vaccine group were higher than those in the antigen group and the Si-Ag group under the stimulation of A29L, A35R, and M1R. In particular, the vaccine was most effective in stimulating A35R-specific CD8 + T CM , while the three antigen-specific CD4 + T CM were comparable to each other. In addition, as shown in Figure 10 Figure d, Figure e, and Figure f, after stimulation with A29L, A35R, and M1R, the proportion of CD8 + T EM in the vaccine group was higher than that in the antigen group and the Si-Ag group, and the stimulation of A35R-specific CD8 + T EM was the greatest. The A29L-specific CD4 + T EM response in the vaccine group was higher than that in other groups, and the A35R- and M1R-specific CD4 + T EM responses were comparable to those in the Si-Ag group. Therefore, the vaccine can significantly stimulate T + and T + in CD4 CM and CD8 EM T cells in the spleen, thereby further enhancing the persistent cellular immune response.

[0110] As shown in Figure 10As shown in the figure of China, under the stimulation of A29L, A35R and M1R, the percentage of CD19 + CD27 + cells in the vaccine group was higher than that in the antigen group and the Si-Ag group respectively. Therefore, the vaccine can strongly stimulate antigen-specific memory B cells. In particular, the percentage of A35R-specific CD19 + CD27 + cells in the vaccine group was higher than that of A29L- and M1R-specific cells. It shows that the modified vaccine can enhance the production of memory T cells and memory B cells.

[0111] Example 7

[0112] In this example, the activation levels of B cells and T cells in splenocytes produced by the vaccine were measured.

[0113] On the 42nd day, fresh spleens of mice were taken, ground to isolate spleen cells, and cell culture was carried out in 24-well plates. The number of inoculated cells was 1×10 6 , and each well was stimulated with 8 μg of A29L, A35R and M1R for 48 hours. After collecting the cells, 1 μL / 1 mL FVD was added, vortexed and mixed evenly, and stained in the dark at 4°C for 30 min. After washing the cells, a mixed antibody of CD4-eFluor450, CD8-PE-Cy7, CD19-AlexaFluor700, CD69-FITC, CD107a-PE and FasL-APC was prepared, stained in the dark at 4°C for 30 minutes, and the cells were washed and then subjected to flow cytometry.

[0114] CD69 is one of the earliest surface markers of T cells and B lymphocytes after antigen stimulation and can reflect the activation degree of the two types of cells. As Figure 11 shown in Figures a, b and c, under the stimulation of A29L, A35R and M1R, the CD69 + CD19 + , CD69 + CD4 + and CD69 + CD8 + T cell percentages in the vaccine group were higher than those in the antigen group and the Si-Ag group respectively. This indicates that the vaccine can promote the expression of the CD69 molecule on the cell surface. Therefore, the vaccine can effectively activate B cells and T cells.

[0115] CTL is effector CD8 + T cells, also known as cytotoxic lymphoma cells, play an important role in specifically killing certain virus-infected cells. CD107a is one of the biomarkers on the surface of CTL, and Fas ligand mediates cell killing. As Figure 12 shown in Figures a and b, under the stimulation of A29L, A35R and M1R, the CD107a in the vaccine group+ CD8 + and FasL + CD8 + The percentages of CD8 + CD8 + and FasL + CD8 + T cells were significantly higher than those in the antigen group and the Si-Ag group. It is worth noting that CD107a in the vaccine group stimulated by M1R + The percentages of CD8

[0116] Example 8

[0117] In this example, the spleen cell proliferation level produced by the vaccine was measured

[0118] On the 42nd day, fresh spleens of mice were taken, ground to isolate spleen cells, and cell culture was carried out in 96-well plates. The number of inoculated cells was 5×10 5 . Blank, control, and experimental groups were set up for culture respectively. After the experimental group was stimulated with 0.8 μg of A29L, A35R, and M1R in each well for 60 hours, 10 μL of CCK8 reagent was added to all wells, and after continued culture for 4 hours, the absorbance was measured at 450 nm and the cell proliferation index (PI) was calculated

[0119] As Figure 13 shown, under the stimulation of A29L, the proliferation indices of the antigen group, the Si-Ag group, and the vaccine group were 2.8, 3.6, and 4.1 respectively. After stimulation with A35R, the proliferation indices of the antigen group, the Si-Ag group, and the vaccine group were 0.8, 1.4, and 2.0 respectively. After stimulation with M1R, the proliferation indices of the antigen group, the Si-Ag group, and the vaccine group were 1.7, 2.1, and 2.6 respectively. Compared with the antigen group and the Si-Ag group, the three PI values of the vaccine group were the highest among the four groups, and the vaccine group showed stronger proliferation ability. In particular, the PI stimulated by A29L in the vaccine group was higher than the PI values stimulated by A35R and M1R. Therefore, the vaccine can promote the effective proliferation of spleen cells

[0120] Example 9

[0121] In this example, the maturation level of mouse bone marrow-derived dendritic cells by the vaccine was measured

[0122] Mouse bone marrow-derived dendritic cells (BMDCs) were cultured in 24-well plates and stimulated with antigen, Ag-Si, and vaccine (each containing 8 μg of three antigen proteins). After 36 hours of culture, the cells were collected. After washing the cells, a mixed antibody of MHCⅡ-AF700, CD86-APC, and CD80-PE was prepared and stained at 4°C in the dark for 30 minutes. After washing the cells, flow cytometry was performed. As Figure 14 shown in Figure a of + MHCII + the percentage of CD80 Figure 14 cells in the vaccine group (53.5%) was higher than that in the Si-Ag group (48.8%, P < 0.05) and the antigen group (44.1%, P < 0.05). As + MHCII + shown in Figure b of

[0123] Example 10

[0124] In this example, the protective effect of the vaccine on mice was tested when attacked with a lethal dose of mousepox virus

[0125] Eighteen 8-week-old female BALB / c mice were selected and randomly divided into 3 groups, namely the PBS group, the antigen group, and the vaccine group, with 6 mice in each group. By intramuscular injection, the injection dose was 8 μg of three antigen proteins per mouse each time, and the injections were given on days 0, 14, and 28. On day 42, the mice were intraperitoneally injected with a lethal dose of mousepox virus (1×10 6 PFU / mouse), and the survival of the mice was observed on days 5, 7, 10, 12, and 14 after the virus attack, and the survival rate of the mice was calculated. As Figure 15 shown, all PBS-immunized mice died within 5 days after the mousepox virus attack (6 / 6). In addition, 83.3% of the antigen-immunized mice (5 / 6) died within 5 - 7 days after the virus attack, indicating that the antigen had poor protection. In contrast, all vaccine-immunized mice (0 / 6) survived within 14 days, indicating that the vaccine provided effective cross-protection against the lethal attack of mousepox virus in mice.

[0126] Example 11

[0127] In this example, the toxicity of the vaccine to the heart, liver, and kidneys of mice was determined

[0128] The levels of creatine kinase (CK), lactate dehydrogenase (LDH), alanine aminotransferase (ALT), total protein (TP), albumin (ALB), and uric acid (UA) in the sera of mice on the 42nd day were measured using a fully automated biochemical analyzer. Among them, CK and LDH are cardiac function indicators, ALT, TP, and ALB are liver function indicators, and UA is used to represent renal excretory function. The potential toxicity of the vaccine to the cardiac, hepatic, and renal functions of mice was evaluated by measuring the levels of these substances. As shown in Table 1, compared with the PBS group, the antigen, Si-Ag, and vaccine groups were basically consistent in these parameters, with no significant differences. Therefore, the vaccination of this vaccine has no obvious toxicity to the cardiac, hepatic, and renal functions of mice.

[0129] Table 1

[0130]

[0131] In summary, in the present invention, the monkeypox virus antigen is covalently conjugated with silicon nanoparticles through the DogTag-DogCatcher system, and the antigen is displayed on the surface of the particles in a specific spatial orientation, enhancing the multivalency and accessibility of the antigen, while reducing the shielding effect of silicon nanoparticles on antigen epitopes. The immune response induced by this vaccine is higher than that of the monomeric immunogenic protein.

[0132] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles, characterized in that: The nanovaccine includes monkeypox virus antigen, silicon nanoparticles and STING agonist; The poxvirus antigen is bound to the surface of the silicon nanoparticle through the DogTag-DogCatcher system; and the STING agonist is connected to the surface of the monkeypox virus antigen.

2. The monkeypox virus nanovaccine based on STING agonist and silicon nanoparticles according to claim 1, characterized in that: The monkeypox virus antigen is fused with the DogCatcher polypeptide for expression; Preferably, the amino group of the silicon nanoparticle is connected to the carboxyl group of the DogTag polypeptide; Preferably, the STING agonist is covalently linked to the surface of the monkeypox virus antigen.

3. The monkeypox virus nanovaccine based on STING agonist and silicon nanoparticles according to claim 1 or 2, characterized in that: The monkeypox virus antigen includes any one of A29L protein, A35R protein or M1R protein or a combination of at least two or more thereof.

4. The monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to any one of claims 1 to 3, characterized in that: The STING agonist includes any one of STG982, c-di-AMP, 2',3'-cGAMP or SR-717, or a combination of at least two thereof.

5. A method for preparing a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to any one of claims 1 to 4, characterized in that: The preparation method comprises: fusing monkeypox virus antigen with DogCatcher polypeptide to obtain antigen conjugate, conjugating silicon nanoparticles with DogTag to form silicon nanoconjugate, incubating the antigen conjugate with the silicon nanoconjugate to obtain nanoparticles, and performing modification reaction on the nanoparticles and agonists respectively and then connecting them to obtain the nanoparticles.

6. The method for preparing a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to claim 5, characterized in that: The fusion expression comprises constructing a nucleic acid sequence connecting monkeypox virus antigen and DogCatcher polypeptide, connecting with a plasmid to construct an expression vector, transferring into a host cell, inducing and ultrasonically disrupting, and purifying to obtain an antigen conjugate; Preferably, the induction agent comprises IPTG; Preferably, the concentration of the inducer is 0.3-0.8 mM; Preferably, when the monkeypox virus antigen is A29L protein, the induction temperature is 15-25°C and the time is 15-25h; Preferably, when the monkeypox virus antigen is A35R protein or M1R protein, the induction temperature is 35-40° C. and the time is 2-6 h; Preferably, the purification method comprises agarose gel affinity chromatography.

7. The method for preparing a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to claim 5 or 6, characterized in that: The preparation method of the silicon nanoconjugate comprises: mixing and dissolving silicon nanoparticles, 1-ethyl-(3-dimethylaminopropyl) carbodiimide, N-hydroxysulfosuccinimide and DogTag polypeptide in a buffer solution for reaction, and dialyzing to obtain the silicon nanoconjugate; Preferably, the molar ratio of the silicon nanoparticles, 1-ethyl-(3-dimethylaminopropyl)carbodiimide, N-hydroxysulfosuccinimide and DogTag polypeptide is 1:(45-55):(45-55):(0.5-2); Preferably, the buffer comprises MES buffer; Preferably, the reaction temperature is 20-30°C and the reaction time is 8-16h; Preferably, the dialysate of the dialysis comprises phosphate buffer.

8. The method for preparing a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to any one of claims 5 to 7, characterized in that: The molar ratio of the antigen conjugate to the silicon nanoconjugate is 4:(1-5); Preferably, the incubation temperature is 1-5°C and the time is 4-12h.

9. The method for preparing a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to any one of claims 5 to 8, characterized in that: The nanoparticles after the modification reaction are connected with thiol groups; Preferably, the agonist after the modification reaction is connected to a maleimide group; Preferably, the molar ratio of the nanoparticles to the agonist is 1:(3-6); Preferably, the temperature of the ligation reaction is 1-5°C and the time is 4-12h.

10. Use of a method for preparing a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to any one of claims 1 to 4 or a monkeypox virus nanovaccine based on a STING agonist and silicon nanoparticles according to any one of claims 5 to 9 in preparing a monkeypox preventive drug.

Images