Preparation and application of GPC3-targeted CAR-NK (Chimeric Antigen Receptor-Natural Killer) cell with CD38 gene knockout

Abstract

The invention discloses preparation and application of a CAR-NK cell targeting GPC3 and having a CD38 gene knocked out, the CAR molecular structure of the targeting GPC3 comprises CD8 alpha signal peptide, scFv targeting GPC3, a CD28 hinge region and a transmembrane region, a CD28 costimulatory factor, CD3 zeta intracellular signal transduction, T2A and mIL-15, meanwhile, an immune checkpoint gene of the NK cell is knocked out by adopting a Crispr / Cas9 system to overcome inhibition of a liver cancer tumor microenvironment on the CAR-NK cell, and the CAR-NK cell targeting GPC3 and the CD38 gene knocked out CAR-NK cell targeting GPC3 are obtained. The immune escape of liver cancer tumor cells is avoided, the anti-tumor effect of the NK cells is better played, and meanwhile, the AAV virus vector is used as a template, so that the tumorigenic risk of traditional virus transduction is avoided.

Description

Technical Field

[0001] The present invention belongs to the field of CAR-NK cell preparation, and particularly relates to the preparation and application of CAR-NK cells targeting GPC3 and knocked out of the CD38 gene. Background Art

[0002] Hepatocellular carcinoma (HCC) accounts for 75% - 85% of primary liver cancer. Its onset is occult, and the diagnosis is often in the middle and late stages. 50% - 60% of patients need to receive systemic treatment. The systemic treatment of liver cancer mainly includes molecular targeted drug treatment, immunotherapy, chemotherapy, traditional Chinese medicine treatment, etc. In recent years, targeted drug treatment and immunotherapy have improved the survival period of advanced patients to a certain extent, but their efficacy is limited, and there is still a large unmet clinical need.

[0003] Phosphatidylinositol proteoglycan (Glypican, GPC) is a member of the heparan sulfate proteoglycan family. Glypican-3 (GPC3) is one of the six members of the GPC family and is a membrane-expressed protein. It plays an important role in the processes of tumorigenesis, metastasis and invasion by regulating downstream signals such as WNT and Hedgehog. The expression of GPC3 is as high as 76% in hepatocellular carcinoma, but it is not expressed in normal adult tissues, so it is an ideal target for the treatment of hepatocellular carcinoma. At present, the poor efficacy of monoclonal antibody drugs targeting the GPC3 target and the toxicity of ADC drugs have slowed down their clinical research progress. The research and development of CAR-T cell drugs targeting GPC3 bring a glimmer of hope for the treatment of HCC. For example, GPC3-CAR-T cell drugs from companies such as Codiak BioSciences, Primordial Bio and Yimiao Shenzhou have all entered the clinical research stage. In particular, the GPC3-CAR-T cells of Codiak BioSciences combined with local treatment have enabled patients to achieve a tumor-free survival period of more than 7 years. Although it is an individual case, it gives people hope for the immunotherapy of HCC targeting GPC3.

[0004] CAR-T cell therapy is an autologous cell therapy. Its high price, poor accessibility, production and preparation cycle limitations, risks such as cytokine release syndrome (CRS) and immune effector cell-associated neurotoxicity syndrome (ICANS) have severely restricted its application. Therefore, chimeric antigen receptor-natural killer cell (CAR-NK) therapy has emerged. Compared with CAR-T cells, CAR-NK cells have more advantages in the treatment of solid tumors. For example, in terms of efficacy, the activation mechanisms of CAR-NK cells are more diverse. In addition to activation through the CAR pathway, they are also activated by broadly recognizing the reduction or loss of tumor cell MHC-1, and through antibody-dependent cell-mediated cytotoxicity (ADCC) activation, etc. Their killing effect is more broad-spectrum and can effectively overcome the heterogeneity of solid tumors; in terms of safety, CAR-NK cell therapy has no risk of graft-versus-host disease (GvHD), and the risks of CRS and ICANS are extremely low, with higher safety; in terms of accessibility, CAR-NK cells can be prepared into allogeneic off-the-shelf products, with controllable costs and no preparation cycle limitations. Therefore, CAR-NK cell therapy has become a rising star in the field of tumor immunocyte therapy. Summary of the Invention

[0005] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.

[0006] The present invention provides a CAR, which comprises a CD8α signal peptide, a scFv targeting GPC3, a CD28 hinge region and transmembrane region, a CD28 co-stimulatory factor, and a CD3ζ intracellular signaling region connected in sequence.

[0007] Further, the amino acid sequence of the CD8α signal peptide is as shown in SEQ ID NO:1.

[0008] Further, the amino acid sequence of the scFv targeting GPC3 is as shown in SEQ ID NO:2.

[0009] Further, the amino acid sequence of the CD28 hinge region and transmembrane region is as shown in SEQ ID NO:3.

[0010] Further, the amino acid sequence of the CD28 co-stimulatory factor is as shown in SEQ ID NO:4.

[0011] Further, the amino acid sequence of the CD3ζ intracellular signaling region is as shown in SEQ ID NO:5.

[0012] The present invention uses the term "chimeric antigen receptor (CAR)", which is an artificially synthesized receptor protein constructed by genetic engineering recombination technology. Its structure consists of an extracellular antigen-binding domain, a hinge region, a transmembrane domain, and an intracellular signaling domain. The extracellular domain usually takes the form of a single-chain antibody (scFv), which can specifically recognize antigens on the surface of target cells; the hinge region provides spatial flexibility through amino acid sequences to optimize antigen binding; the transmembrane region is derived from natural membrane proteins (such as CD8α or CD28) to achieve cell membrane anchoring; the intracellular domain contains at least one co-stimulatory molecule (such as CD28, 4-1BB) and a T cell activation signal module (CD3ζ), which activates the cytotoxic and proliferative functions of T cells through cascading signal transduction. This recombinant protein is transduced into T cells through retroviral or lentiviral vectors, enabling them to acquire non-MHC-restricted antigen recognition ability and targeted killing function.

[0013] The present invention uses the term "scFv" to refer to a fusion protein that includes at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are continuously linked by a flexible short polypeptide linker and can be expressed as a single-chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless otherwise indicated, as used herein, the scFv can have the VL variable region and the VH variable region in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide), the scFv can contain VL-linker-VH or can contain VH-linker-VL.

[0014] The present invention provides a nucleic acid molecule, which includes a nucleotide sequence encoding the aforementioned CAR.

[0015] Furthermore, the nucleic acid molecule includes a nucleotide sequence having at least 90% sequence identity with the nucleotide sequences shown in SEQ ID NOs: 7-11.

[0016] Furthermore, the nucleic acid molecule includes the nucleotide sequences shown in SEQ ID NOs: 7-11.

[0017] Furthermore, the nucleic acid molecule further includes a nucleotide sequence encoding mIL-15, and the amino acid sequence of the mIL-15 is as shown in SEQ ID NO: 6.

[0018] Furthermore, the nucleotide sequence encoding mIL-15 is as shown in SEQ ID NO: 12.

[0019] In some embodiments, the mIL-15 includes a CD8α signal peptide, IL-15, a CD8α hinge region, and a transmembrane region.

[0020] Further, the nucleotide sequences shown in SEQ ID NO: 7-11 in the nucleic acid molecule are sequentially linked.

[0021] Further, the coding sequence of mIL-15 in the nucleic acid molecule is linked to other sequences through T2A.

[0022] Further, the nucleotide sequences shown in SEQ ID NO: 7-11, T2A, and mIL-15 in the nucleic acid molecule are sequentially linked.

[0023] In some embodiments, the sequences shown in SEQ ID NO: 1-12 can be codon-optimized without affecting the function of the expressed protein, that is, similar sequences with homology above 95% or 90% appear. When the subunit positions in these two molecules are occupied by the same monomeric subunits, for example, if a certain position in each of the two DNA molecules is occupied by adenine, then they are homologous or identical at that position. The identity between two sequences directly varies with the number of matching or homologous positions.

[0024] In the present invention, the term "nucleic acid molecule" generally refers to a linear macromolecule formed by nucleotides linked through phosphodiester bonds, including two major categories: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Its core structure consists of bases (purines, pyrimidines), pentose sugars (deoxyribose or ribose), and phosphate groups. In patent applications, the definition of nucleic acid molecules often covers naturally occurring sequences, synthetic oligonucleotides, modified nucleic acids (such as phosphorothioate backbones, methylation, or locked nucleic acids, etc.), and molecules containing unnatural bases. For example, the category C12N15 / 00 in the International Patent Classification (IPC) clearly relates to "the preparation or isolation of nucleic acids or derivatives, or new vectors for such preparation", emphasizing its functional attribute as a carrier of genetic information. The technical features of nucleic acid molecules in patents often manifest as sequence specificity. Patent claims usually define specific nucleotide sequences in the form of SEQ ID NO, and claim the applications of them as probes, primers, therapeutic siRNAs, or CRISPR guide RNAs. For example, in US Patent US10,800,348 B2, a nucleic acid molecule is defined as "an oligomer composed of at least 15 consecutive nucleotides, capable of complementary binding to a target gene and inhibiting its expression", highlighting its functionality and structural stability.

[0025] The present invention provides a vector, which includes the nucleic acid molecule described above.

[0026] Further, the vector includes a plasmid vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a piggyBac vector, or a Sleeping Beauty transposon vector.

[0027] Further, the adeno-associated virus vector includes ssAAV, scAAV, and / or hybrid AAV subtypes.

[0028] Further, the adeno-associated virus vector includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13.

[0029] Further, the vector is an adeno-associated virus vector, and the adeno-associated virus vector includes a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 13.

[0030] Further, the adeno-associated virus vector includes the nucleotide sequence shown in SEQ ID NO: 14.

[0031] In some embodiments, the AAV vector, whose full name is Adeno-Associated Virus Vector, is a non-pathogenic virus vector commonly used for gene transfer in gene therapy. AAV itself does not cause serious diseases but can infect a variety of mammalian cells, including dividing and non-dividing cells. Its genome is relatively small and usually contains single-stranded DNA (ssDNA), which enables it to be converted into double-stranded DNA (dsDNA) in host cells and integrated into the non-histone region of the human chromosome without causing the risk of genomic insertion mutations, having relatively high safety characteristics. The design of the AAV vector usually involves deleting some or all of the viral genes in its wild-type genome to accommodate foreign genes. Such foreign genes, namely therapeutic genes, will be delivered to target cells to correct genetic diseases or express therapeutic proteins. The life cycle characteristics of AAV enable it to maintain gene expression in host cells for a long time without causing an immune response, which is particularly useful in long-term treatment strategies.

[0032] The present invention provides a NK cell, and the NK cell includes a nucleotide sequence encoding the aforementioned CAR, the aforementioned nucleic acid molecule, or the aforementioned vector.

[0033] Further, the NK cell is a NK cell in which the immune checkpoint gene is knocked out.

[0034] Further, the immune checkpoint gene includes CD38, PDCD1, CTLA4, LAG3, HAVCR2, TIGIT, VSIR, IDO1, BTLA, CD276.

[0035] Further, the immune checkpoint gene is CD38.

[0036] Further, the immune checkpoint gene is knocked out by Crispr / Cas9 technology.

[0037] In some embodiments, the immune checkpoint gene CD38 is knocked out by Crispr / Cas9 using a CD38 gene knockout gRNA, and the sequence of the CD38 gene knockout gRNA is as shown in SEQ ID NO:15. In some embodiments, the NK cells that knock out the immune checkpoint gene use PCR to synthesize the CAR gene fragment and the homologous arm fragment sequence, ligate the synthesized fragments to an adeno-associated virus vector through T4 ligase, and prepare AAV virus. At room temperature, the gRNA and Cas9 protein are mixed and electroporated with human primary NK cells. After electroporation, 20 minutes after electroporation, a certain amount of AAV virus particles are added to the culture system and the culture is continued.

[0038] The present invention uses the term "NK cell" for natural killer cells, Natural Killer Cells. Large granular lymphocytes, accounting for 10%-15% of peripheral blood lymphocytes, are the core effector cells of the innate immune system, with surface markers CD56⁺, CD16⁺ (FcγRIII), and do not express T cell receptor (TCR) and B cell receptor (BCR). NK cells can accurately recognize and kill tumor cells, virus-infected cells, remove senescent cells and abnormally proliferating cells, secrete cytokines such as IFN-γ, TNF-α, and activate immune cells such as macrophages and dendritic cells.

[0039] In some embodiments, the function of the vector used in the present invention to carry nucleic acid molecules is well-known to the public, and the technologies, methods, and materials required for its transport of nucleic acid molecules can be publicly obtained from technical documents in the corresponding fields. The technologies include, but are not limited to, vector construction, ligation of the vector to the target gene, transport of the vector, and cell culture after transport.

[0040] In some embodiments, the vector may further contain other appropriate "regulatory elements" or "regulatory sequences", including but not limited to enhancers; transcription factors; transcription terminators; efficient RNA processing signals such as splicing and polyadenylation signals (polyA); sequences that stabilize cytoplasmic mRNA such as the post-transcriptional regulatory element (WPRE) of woodchuck hepatitis virus (WHV); sequences that enhance translation efficiency (i.e., kozak consensus sequence); sequences that enhance protein stability; and sequences that enhance the secretion of the encoded product when needed. In certain embodiments, examples of the polyA include SV40, bovine growth hormone (bGH), and TKpolyA. In certain embodiments, examples of the enhancer include α-fetoprotein enhancer, TTR minimal promoter / enhancer, LSP (TH binding globulin promoter / α1-microglobulin / bikunin enhancer), and other enhancers.

[0041] In some embodiments, the adeno-associated viruses used in the present invention include various types of registered AAVs, including but not limited to 13 different serotypes of AAV in primates (i.e., AAV1 - AAV13), among which AAV2, AAV3, and AAV9 are derived from humans themselves. In some embodiments, AAVs of different serotypes can hybridize, and the hybridized AAV will have the characteristics of both hybrids. Therefore, the adeno-associated viruses used in the present invention also include AAV subtypes after hybridization of AVV, specifically including but not limited to rAAV2 / 1 (with tissue affinity for the nervous system (high-titer anterograde trans-synaptic), muscle, skeletal muscle, cardiac muscle, smooth muscle), rAAV2 / 2 (with tissue affinity for the retina, nervous system, muscle, liver, vascular smooth muscle), rAAV2 / 3 (with tissue affinity for muscle, liver, lung, eye), rAAV2 / 4 (with tissue affinity for the nervous system, muscle, eye, brain), rAAV2 / 5 (with tissue affinity for the nervous system, lung, retina, liver, synovial joint), rAAV2 / 6 (with tissue affinity for the nervous system, lung, muscle, heart), rAAV2 / 7 (with tissue affinity for muscle, liver), rAAV2 / 8 (with tissue affinity for the nervous system, liver, muscle, adipose tissue, pancreas, retina), rAAV2 / 9 (with tissue affinity for the nervous system, cardiac muscle, lung, retina, skin), rAAV2-retro (with tissue affinity for the nervous system (retrograde non-trans-synaptic)), AAV-PHP.eB (with tissue affinity for crossing the blood-brain barrier), AAV-PHP.S (with tissue affinity for the entire peripheral nerve), AAV-PAN (with tissue affinity for the pancreas), AAV-LUNG (with tissue affinity for the lung), AAV-DJ (with tissue affinity for the retina, lung, kidney, in vitro infected cells), AAV-7m8 (with tissue affinity for the retina), AAV-ShH10Y (with tissue affinity for retinal Muller cells), AAV-Rh10 (with tissue affinity for the liver, blood, heart, in vitro infected cells), AAV-Anc80L65 (with tissue affinity for the inner ear, retina, skeletal muscle, liver), AAV-SCH9 (with tissue affinity for neural stem cells in the SVZ region).

[0042] The present invention provides the use of the aforementioned NK cells in the preparation of a medicament for treating liver cancer expressing GPC3.

[0043] Furthermore, the liver cancer is in a mammal.

[0044] Furthermore, the mammal includes a human or a non-human mammal.

[0045] In the embodiments of the present invention, the liver cancer includes the following types: 1. Primary liver cancer is a malignant tumor originating from the liver itself. According to histological types, it is divided into hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma (ICC), and combined hepatocellular-cholangiocarcinoma (cHCC-CCA). Among them, hepatocellular carcinoma accounts for about 75%-85%, and is closely related to liver cirrhosis and hepatitis B virus infection; intrahepatic cholangiocarcinoma accounts for 10%-15%, originating from intrahepatic bile duct epithelial cells; the combined type has the pathological characteristics of both. 2. Hepatoblastoma belongs to embryonal tumors, mainly occurring in children under 3 years old. Pathologically, a mixed structure of fetal-type epithelial cells and mesenchymal tissue can be seen, belonging to an independent subclass of liver cancer. 3. Fibrolamellar hepatocellular carcinoma is a special subtype of hepatocellular carcinoma, accounting for about 1% of HCC. Microscopically, a large number of eosinophilic cancer cells are separated by lamellar fibrous matrix, and it is relatively common in young patients and has a better prognosis than ordinary HCC. 4. Undifferentiated carcinoma belongs to highly malignant primary liver cancer, lacking clear glandular or squamous differentiation characteristics, and needs to be differentiated from sarcomatoid carcinoma by immunohistochemistry, etc., and is relatively rare clinically. 5. Metastatic liver cancer (secondary liver cancer) is formed by hematogenous metastasis of malignant tumors from other organs to the liver. Colorectal cancer, gastric cancer, pancreatic cancer, breast cancer, etc. are all common primary sites, and its pathological characteristics are the same as those of the primary site, and differential diagnosis with primary liver cancer is required.

[0046] The present invention provides a pharmaceutical composition, which comprises a therapeutically effective amount of the aforementioned NK cells.

[0047] In some embodiments, "therapeutically effective amount" generally refers to the dose or concentration of a drug or active ingredient required to produce the desired therapeutic effect after administration. The core lies in that the dose needs to meet two conditions: one is that it is sufficient to produce detectable physiological or pathological improvement (such as alleviating symptoms, inhibiting disease progression or curing the disease) in the target patient population, and the other is that the dose does not exceed the safety threshold to avoid unacceptable toxic and side effects. Due to differences in patent types and technical fields. For example, in chemical drug patents, the therapeutically effective amount may be deduced from in vitro experimental data (such as IC50 values), the effective dose of animal models to the human equivalent dose (HED), and determined in combination with the results of phase I / II clinical trials; while in gene therapy patents, parameters such as vector copy number and expression level may be involved.

[0048] The present invention provides a method for manufacturing CAR-NK cells, which comprises introducing the aforementioned CAR, the aforementioned nucleic acid molecule, or the aforementioned vector into NK cells.

[0049] The present invention provides the use of the aforementioned CAR, the aforementioned nucleic acid molecule, or the aforementioned vector in the preparation of GPC3-targeted CAR-NK cells.

[0050] Advantages and beneficial effects of the present invention:

[0051] The objective of the present invention is to knockout the immune checkpoint gene (such as CD38) of NK cells through Crispr / Cas9 technology, and at the same time, combine an AAV viral vector as a template to directedly knock in the CAR molecule targeting GPC3 into the knocked-out gene position, prepare CAR-NK cells targeting GPC3 while knocking out the immune checkpoint, specifically kill GPC3-positive liver cancer cells, overcome the inhibition of the liver cancer tumor microenvironment on CAR-NK cells, avoid the immune escape of liver cancer cells, and enhance the efficacy of CAR-NK cells.

[0052] The structure of the CAR molecule targeting GPC3 is: CD8α signal peptide, scFv targeting GPC3, CD28 hinge region and transmembrane region, CD28 co-stimulatory factor, CD3ζ intracellular signal transduction, T2A, mIL-15 (CD8α signal peptide, IL-15, CD8α hinge region and transmembrane region).

[0053] Use the Crispr / Cas9 system to knockout the immune checkpoint gene (such as CD38) of NK cells, overcome the inhibition of the liver cancer tumor microenvironment on CAR-NK cells, avoid the immune escape of liver cancer tumor cells, and better exert the anti-tumor effect of NK cells.

[0054] At the same time of gene knockout, using the AAV viral vector as a template, insert the CAR molecule targeting GPC3 into the position of the immune checkpoint gene knocked out in NK cells to obtain CAR-NK cells targeting GPC3. The insertion position of the CAR molecule is fixed, avoiding the oncolytic risk of traditional virus transduction. Description of the Drawings

[0055] Figure 1 It is the structural diagram of the CAR molecule targeting GPC3.

[0056] Figure 2 It is the preparation scheme diagram of CAR-NK cells targeting GPC3 and knocking out the immune checkpoint.

[0057] Figure 3 It is the CD38 knockout efficiency, CAR positive rate and mIL15 expression diagram of CAR-NK cells targeting GPC3 and with CD38 gene knockout.

[0058] Figure 4 It is the expression result diagram of GPC3 on the liver cancer cell lines Hep3B and Huh-7.

[0059] Figure 5 It is the killing activity diagram of CAR-NK cells targeting GPC3 and with CD38 gene knockout against liver cancer cells Hep3B (left) and Huh-7 (right).

[0060] Figure 6It is a diagram showing the cytokine release test results of CAR-NK cells targeting GPC3 and with CD38 gene knockout.

[0061] Figure 7 It is a diagram showing the effect of CAR-NK cells targeting GPC3 and with CD38 gene knockout on a tumor animal model of GPC3-positive liver cancer cells. Detailed implementation methods

[0062] The present invention will be described in detail below in conjunction with the drawings and embodiments, so as to facilitate those skilled in the art to understand and implement the present invention, and further recognize the advantages of the present invention.

[0063] Unless otherwise defined in the specification of the present invention, all technical terms herein are used according to the customary definitions commonly used and understood by those of ordinary skill in the art. The experimental methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials, unless otherwise specified, can be obtained from commercial sources.

[0064] Example 1 Design of CAR molecular structure targeting GPC3

[0065] The CAR molecular structure targeting GPC3 adopted in the present invention is as Figure 1 shown, and it adopts a CD8 signal peptide, an scFv targeting GPC3, a CD28 hinge region and transmembrane region, a CD28 co-stimulatory factor, a CD3ζ intracellular signaling domain, T2A, and mIL-15 (a CD8 signal peptide, IL-15, a CD8 hinge region and transmembrane region).

[0066] The specific method is as follows:

[0067] Design of the antigen recognition domain (extracellular antigen-binding domain, scFv): Without changing the properties and functions of the GPC3 scFv, the antibody framework region sequence of the scFv is replaced with a human germline antibody framework region sequence to reduce immunogenicity, improve the affinity of the scFv for the GPC3 target, reduce the possibility of CAR NK cell self-activation, increase the efficiency of signal transmission to the cell interior, inhibit the terminal differentiation of CAR-NK, extend the survival time of CAR NK cells in vivo, and increase the anti-tumor performance of CAR-NK cells.

[0068] 2. Design of the co-stimulatory signal domain: Without changing the properties and functions of the CD28 co-stimulatory domain, reduce the possibility of CAR NK cell self-activation, increase the efficiency of CD28 signal transmission to the cell interior, extend the survival time of CAR-NK cells in vivo, and increase the anti-tumor performance of CAR-NK cells.

[0069] 3. CD3ζ signaling domain design: By modifying the amino acid sites related to signal transduction in the intracellular signaling region of CD3ζ, the intracellular signaling pathway of CAR-NK cells is ultimately improved, enhancing the in vivo expansion ability, persistence ability of CAR-NK cells, improving the cytokine secretion status, and further enhancing the anti-tumor performance of CAR-NK cells.

[0070] 4. mIL-15 structure design: The structure of membrane-bound IL-15 includes a CD8 signal peptide, mature native IL-15 amino acids, a CD8 hinge region, and a CD8 transmembrane region. The expression of membrane-bound IL-15 has a longer hinge region and a large activity space, which can easily bind to the IL-15 receptor (IL-15Rβγ) of NK cells themselves, thereby activating the downstream signaling pathway of the IL-15 receptor, promoting the self-proliferation of CAR-NK cells, and avoiding the cytokine toxicity caused by secreted IL-15.

[0071] 5. The CD8α signal peptide, scFv, CD28 co-stimulatory signaling domain, CD3ζ signaling domain, T2A, and mIL-15 structure are sequentially linked to form a chimeric antigen receptor, obtaining the amino acid sequence shown in SEQ ID NO:13.

[0072] See Table 1 for the amino acid sequences and nucleotide sequences of each component.

[0073] Table 1

[0074] Example 2: Preparation of CAR-NK cells targeting GPC3 and knockout of the CD38 gene

[0075] The present invention uses the Crispr / Cas9 system to knockout immune checkpoint genes of NK cells, such as Figure 2As shown, gRNAs targeting NK cell immune checkpoint genes (such as CD38) and homologous recombination repair templates were designed and synthesized. The homologous recombination repair template used in the present invention is an adeno-associated virus vector. The CAR gene fragment and homologous arm fragment sequences were synthesized by PCR, and the synthesized fragments were ligated to the adeno-associated virus vector by T4 ligase, and AAV virus was prepared. At room temperature, the gRNA was mixed with Cas9 protein and then mixed with human primary NK cells for electroporation. After electroporation, 20 minutes later, a certain amount of AAV virus particles were added to the culture system, and the culture was continued. One week later, the CAR positive rate was detected to evaluate its in vitro killing, factor release against GPC3-positive hepatocellular carcinoma tumor cell lines and in vivo anti-tumor effect on the animal model of GPC3-positive hepatocellular carcinoma tumor cell lines.

[0076] 1. Experimental method

[0077] 50 mL of healthy human peripheral blood was taken, and peripheral blood mononuclear cells (PBMC) were obtained by Ficoll density gradient centrifugation. NK cells were sorted by magnetic beads and cultured with K562 feeder cells. After 5 days, at room temperature, the CD38 gene knockout gRNA (SEQ ID NO:15, CTGAACTCGCAGTTGGCCAT) was mixed with Cas9 protein and allowed to stand for 10 minutes, and then the mixture was mixed with human primary NK cells for electroporation. After electroporation, the NK cells were resuspended in the medium. 20 minutes later, a certain amount of AAV virus particles were added to the culture system, and the culture was continued for 7 days and then harvested. Flow cytometry was used to detect the expression efficiency after CD38 gene knockout, the positive rate of CAR expression targeting GPC3, and the positive rate of mIL15 expression.

[0078] 2. Experimental results

[0079] After the above-mentioned harvested CAR-NK cells were detected by flow cytometry for the expression efficiency of CD38 gene knockout, the positive rate of CAR expression targeting GPC3, and the positive rate of mIL15 expression, the results are shown in Figure 3 , it can be seen that the expression efficiency after CD38 gene knockout was only 5.53%, the positive rate of CAR expression targeting GPC3 was 74.79%, and the positive rate of mIL15 expression was 62.3%.

[0080] Example 3: In vitro killing effect of CAR-NK cells targeting GPC3 and with CD38 gene knockout on GPC3-positive liver cancer cells

[0081] In this example, the killing efficiency of CAR-NK cells (AAV-GPC3-mIL15) targeting GPC3 and with CD38 gene knockout (the preparation method is as shown in Example 2) against target cells expressing GPC3 was detected as an example.

[0082] 1. Experimental method

[0083] 1) Preparation of target cells

[0084] Take a sufficient amount of target cells (Huh7-luciferase and Hep3B-luciferase), centrifuge at 400 g for 5 min, discard the supernatant, and resuspend and count the viability with 1640 basal medium. Adjust the density of the target cells to 2×10 5 Cells / mL,

[0085] 2) Preparation of effector cells

[0086] Take a sufficient amount of CAR-NK cells targeting GPC3 and with CD38 gene knockout, centrifuge at 400 g for 5 min, discard the supernatant, and resuspend and count the viability with 1640 basal medium. Dilute the effector cells to the corresponding concentrations according to the effector-to-target ratios of 1:32, 1:16, 1:8, 1:4, 1:2, 1:1, and 2:1.

[0087] 3) Plating

[0088] Control wells (50 μL medium + 50 μL target cells), experimental wells (50 μL target cells + 50 μL effector cells), set up 3 replicates, and incubate in the CO 2 incubator in the dark for 24 h.

[0089] 4) Loading onto the machine

[0090] Add 100 μL of luciferase substrate to all wells, and use a microplate reader to detect the chemiluminescence of each well.

[0091] 2. Experimental results

[0092] As Figure 4 shown, the expression of GPC3 on the Hep3B and Huh-7 hepatocellular carcinoma cell lines. As Figure 5 can be seen, CAR-NK cells targeting GPC3 and with CD38 gene knockout can significantly enhance the killing activity against GPC3+ tumor cells (Huh7 and Hep3B).

[0093] Example 4: Detection of cytokine release of CAR-NK cells targeting GPC3 and with CD38 gene knockout

[0094] This example takes the detection of the secretion of TNF-α and IFNγ after co-incubation of CD38 gene knockout CAR-NK cells targeting GPC3 with target cells as an example.

[0095] 1. Experimental method

[0096] 1) Preparation of target cells and effector cells

[0097] (1) Take a sufficient amount of target cells Hep3B, centrifuge at 500 g for 10 min, discard the supernatant, resuspend with 1640 basal medium, count the cells and calculate the viability rate. Adjust the cell density and set aside for use.

[0098] (2) Take a sufficient amount of effector cells, centrifuge to collect the cells, discard the supernatant, resuspend the cells with 1640 basal medium, and dilute the effector cells to the corresponding concentration according to the effector-to-target ratio of 1:1.

[0099] 2) Co-incubate target cells with effector cells

[0100] Take a sufficient amount of the above-mentioned effector cells, centrifuge at 500 g for 10 min, discard the supernatant, resuspend with 1640 basal medium, count the cells and calculate the viability rate. According to the effector-to-target ratio (1:1), spread the effector cells and target cells onto 96-well plates respectively. The control group is untreated control NK cells. At the same time, set up background wells (only effector cells). Incubate at 37 °C, 5% CO 2 , for 24 hours.

[0101] 3) Sample collection

[0102] After the incubation is completed, centrifuge and take the supernatant into an EP tube for standby.

[0103] 4) Cytokine detection

[0104] Operate according to the multi-factor flow cytometry detection kit instruction manual (Biolegend) to detect the contents of TNFα and IFNγ.

[0105] 2. Experimental results

[0106] As Figure 6 shown, compared with the control NK cells, after the CAR-NK cells are co-incubated with Hep3B, their ability to secrete TNFα and IFNγ is significantly enhanced.

[0107] Example 5: Effect of CAR-NK cells targeting GPC3 and with CD38 gene knockout on a tumor animal model of GPC3-positive liver cancer cells

[0108] This example takes the detection of the anti-tumor ability of CAR-NK cells targeting GPC3 and with CD38 gene knockout (AAV-GPC3-mIL15) against tumor-bearing mice as an example.

[0109] 1. Experimental method

[0110] 6-week-old female NCG mice (Jiangsu Jicui Yakang Biotechnology Co., Ltd.), under anesthesia, inject 1.0×10 5An orthotopic liver model was established using the GPC3-expressing positive hepatocellular carcinoma cell line Hep3B. Four days after modeling, in vivo imaging was performed on each mouse, and the mice were randomly divided into 2 groups according to the fluorescence intensity of their tumor burden. The day of grouping was designated as day0, and drug administration started on the day of grouping. The two groups of mice were intravenously injected with untreated NK cells or CAR-NK cells (AAV-GPC3-mIL15) targeting GPC3 and with CD38 gene knockout via the tail vein. A total of 4 doses were administered on days 0, 4, 7, and 10, and the dosage for each administration was 1.0×10 7 cells per mouse per time. During the experiment, the fluorescence intensity of the tumor burden in each group of mice was detected by in vivo imaging once a week, and the body weight of each mouse was measured once a week.

[0111] 2. Experimental results

[0112] The results are as Figure 7 shown. Compared with untreated NK cells, CAR-NK cells (AAV-GPC3-mIL15) targeting GPC3 and with CD38 gene knockout had a more significant inhibitory effect on tumor growth, while the body weight results of each group of mice were normal.

Claims

1. A CAR, wherein the CAR comprises a CD8α signal peptide, a scFv targeting GPC3, a CD28 hinge region and a transmembrane region, a CD28 co-stimulatory factor, and a CD3ζ intracellular signal transduction region connected in sequence; Preferably, the amino acid sequence of the CD8α signal peptide is as shown in SEQ ID NO: 1; Preferably, the amino acid sequence of the scFv targeting GPC3 is as shown in SEQ ID NO: 2; Preferably, the amino acid sequence of the hinge region and transmembrane region of CD28 is as shown in SEQ ID NO: 3; Preferably, the amino acid sequence of the CD28 co-stimulatory factor is as shown in SEQ ID NO: 4; Preferably, the amino acid sequence of the CD3ζ intracellular signaling region is as shown in SEQ ID NO:

5.

2. A nucleic acid molecule comprising a nucleotide sequence encoding the CAR of claim 1.

3. The nucleic acid molecule of claim 2, comprising a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence shown in SEQ ID NO:7-11; Preferably, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO:7-11; Preferably, the nucleic acid molecule further comprises a nucleotide sequence encoding mIL-15, and the amino acid sequence of mIL-15 is as shown in SEQ ID NO: 6; Preferably, the nucleotide sequence encoding mIL-15 is as shown in SEQ ID NO: 12; Preferably, the nucleotide sequences shown in SEQ ID NOs: 7-11 in the nucleic acid molecule are linked sequentially; Preferably, the coding sequence of mIL-15 in the nucleic acid molecule is connected to other sequences via T2A; Preferably, in the nucleic acid molecule, the nucleotide sequence shown in SEQ ID NO: 7-11, T2A, and mIL-15 are linked sequentially.

4. A vector comprising the nucleic acid molecule according to claim 1 or 2; Preferably, the vector comprises a plasmid vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a piggyBac vector or a Sleeping Beauty transposase vector; Preferably, the adeno-associated viral vector comprises ssAAV, scAAV and / or hybrid AAV subtypes; Preferably, the adeno-associated virus vector includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13.

5. The vector according to claim 4, wherein the vector is an adeno-associated viral vector, and the adeno-associated viral vector comprises a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 13; Preferably, the adeno-associated virus vector comprises the nucleotide sequence shown in SEQ ID NO:

14.

6. A NK cell, comprising a nucleotide sequence encoding the CAR according to claim 1, a nucleic acid molecule according to claim 2 or 3, or a vector according to claim 4 or 5; Preferably, the NK cells are NK cells with immune checkpoint genes knocked out; Preferably, the immune checkpoint genes include CD38, PDCD1, CTLA4, LAG3, HAVCR2, TIGIT, VSIR, IDO1, BTLA, and CD276; Preferably, the immune checkpoint gene is CD38; Preferably, the immune checkpoint gene is knocked out by Crispr / Cas9 technology.

7. Use of the NK cells according to claim 6 in the preparation of a drug for treating liver cancer expressing GPC3; Preferably, the liver cancer is in a mammal; Preferably, the mammal comprises a human or a non-human mammal.

8. A pharmaceutical composition comprising a therapeutically effective amount of the NK cells according to claim 6.

9. A method for producing CAR-NK cells, the method comprising introducing the CAR of claim 1, the nucleic acid molecule of claim 2 or 3, or the vector of claim 4 into NK cells.

10. Use of the CAR according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the vector according to claim 4 in preparing GPC3-targeted CAR-NK cells.

Images