Chimeric antigen receptor modified cell drug as well as preparation method and application thereof
Through chimeric antigen receptor-modified cellular drugs, specific clearance of B cells and/or plasma cells is achieved, solving the problem that existing treatment methods cannot completely cure autoimmune diseases, and achieving efficient and safe therapeutic effects.
Patent Information
- Application Number
- CN202510111241.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-06-06
AI Technical Summary
Existing treatments for autoimmune diseases cannot completely cure the disease, and long-term use of immunosuppressive drugs and biological agents may bring serious side effects.
Develop a cellular drug modified by chimeric antigen receptors, and introduce chimeric antigen receptors targeting B cells and/or plasma cells through genetic engineering technology to achieve specific clearance of B cells and/or plasma cells, preventing the production of autoimmune antibodies and the formation of immune complexes.
This cellular drug can specifically remove B cells in vitro and in vivo, prevent the production of autoimmune antibodies and the formation of immune complexes, thereby achieving the purpose of thoroughly treating autoimmune diseases, and has high safety and long-term efficacy.
Smart Images

Figure CN120093911A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of cell medicines, and specifically relates to a chimeric antigen receptor modified cell medicine, and a preparation method and application thereof. Background Art
[0002] The body's immune system is a sophisticated and complex network, including immune cells and immune molecules, which can resist various diseases. Under certain conditions, the homeostasis of the immune system is destroyed, causing the immune system to mistakenly attack its own normal tissues and organs, thus causing autoimmune diseases (AID). The pathogenesis of autoimmune diseases is complex, involving multiple factors such as genetics, environment, and abnormal immune regulation. According to statistics, about 5%-10% of the world's population is affected by autoimmune diseases, among which the prevalence rate in women is significantly higher than that in men, which may be related to differences in sex hormone levels and immune systems. Common autoimmune diseases include systemic lupus erythematosus (SLE), myasthenia gravis (MG), multiple sclerosis (MS), rheumatoid arthritis (RA), and type 1 diabetes. With the advancement of diagnostic technology and changes in environmental factors, the incidence of autoimmune diseases is on the rise, bringing a huge burden to the global public health system.
[0003] At present, the treatment of autoimmune diseases mainly relies on immunosuppression and anti-inflammatory treatment to control symptoms and delay disease progression. Common treatment methods include glucocorticoids, immunosuppressants and biological agents. Glucocorticoids (such as cortisone, prednisone, methylprednisolone, dexamethasone) have strong anti-inflammatory and immunosuppressive effects and are the first-line treatment for many autoimmune diseases. However, long-term use of glucocorticoids may lead to serious side effects, such as body shape changes, growth stagnation in children, osteoporosis, eye damage, cardiovascular and cerebrovascular diseases, metabolic disorders and increased risk of infection. Immunosuppressants (such as methotrexate, cyclophosphamide, leflunomide, cyclosporine, etc.) reduce immune responses by inhibiting the proliferation and function of immune cells, but the side effects caused by their nonspecific immunosuppressive effects are also more obvious, including bone marrow suppression, liver and kidney function damage, and increased risk of infection and tumors. Glucocorticoids and immunosuppressants lead to systemic immunosuppression due to their lack of specificity. With the development of biotechnology, drugs are designed to have higher antigen specificity and reduce adverse reactions. In recent years, biological agents (especially monoclonal antibodies) have made significant progress in the treatment of autoimmune diseases. By targeting specific immune molecules or cells, the immune response can be more accurately regulated, improving the patient's symptoms and quality of life. Anti-TNF-α drugs (infliximab) have shown good efficacy in rheumatoid arthritis and Crohn's disease. B cells play a key role in humoral immunity and have important physiological functions, including the production of antibodies, antigen presentation to T cells, participation in the formation of immune memory, and promotion of immune tolerance. Studies have found that B cells play an important role in the occurrence and development of autoimmune diseases, and targeted elimination of B cells can inhibit abnormal immune responses. A variety of drugs targeting B cells and their activation molecules have been used as treatments for various autoimmune diseases, such as anti-CD20 monoclonal antibodies (rituximab), B lymphocyte stimulator-specific inhibitors (belimumab), etc. However, biological agents cannot restore the patient's immune imbalance, and there are problems such as high treatment costs, long-term medication, potential side effects (such as infection, allergic reactions, and immunogenicity), which limit their widespread application. In addition, some patients respond poorly to existing therapeutic drugs or develop drug resistance, making the disease difficult to control.
[0004] Chimeric antigen receptor T cell (CAR-T) is a T cell modified by genetic engineering technology. The antigen recognition domain and the cell activation domain are combined to form a chimeric antigen receptor (CAR) and introduced into T cells, so that T cells can specifically recognize and bind to specific antigens on the surface of tumor cells through CAR, thereby activating T cells, triggering an immune response, and killing tumor cells. CAR-T cell therapy eliminates B cells by targeting CD19 and BCMA, and has achieved significant therapeutic effects in the clinical treatment of B cell malignancies (such as ALL, DLBCL, MCL) and multiple myeloma, and many relapsed and refractory patients have achieved long-term remission. At present, more than 10 CAR-T cell therapies have been approved by the US FDA and China CDE for the treatment of blood tumors, changing the treatment pattern of blood tumors.
[0005] In summary, autoimmune diseases are a complex and highly heterogeneous class of diseases, and existing treatments cannot meet clinical needs. Although existing treatments have improved the prognosis of patients with autoimmune diseases to a certain extent, most of these methods can only relieve symptoms and cannot cure the disease. In addition, long-term use of immunosuppressive drugs and biological agents may cause serious side effects, which will bring great physical and mental burdens to patients. Therefore, the development of new treatments that are safe and have long-term efficacy has become an urgent need in the field of autoimmune disease research. Summary of the invention
[0006] In view of the deficiencies of the prior art, the purpose of the present invention is to propose a chimeric antigen receptor modified cell drug and its preparation method and application, which can specifically eliminate B cells and / or plasma cells, prevent the production of autoimmune antibodies and the formation of immune complexes, and achieve the purpose of completely curing the disease.
[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0008] The first aspect of the present invention is to provide a method for preparing a cell drug modified with a chimeric antigen receptor, comprising the following steps: introducing a chimeric antigen receptor targeting B cells and / or plasma cells into an in vitro or in vivo immune cell through a gene delivery system to obtain a cell drug; wherein the targets of the targeted B cells and / or plasma cells include CD19, BCMA, CD20, CD22, CD38, CD138, GPRC5D, and SLAMF7.
[0009] It should be noted that the method of introducing the chimeric antigen receptor CAR into the body's immune cells includes but is not limited to viral vector infection, electroporation transfection (introducing the CAR nucleic acid sequence through an electroporator), transposon, gene knockin, extracellular vesicles, lipid nanoparticles (Lipid Nanoparticles, LNP), nanogold particles, chemical reagent transfection; wherein, the viral vector includes but is not limited to lentiviral vectors, retroviral vectors, adenoviral vectors, and adeno-associated viral vectors. In some embodiments, a lentiviral vector is used, specifically a four-plasmid lentiviral packaging system (lentiviral expression plasmid pRRLSIN-EF1α-CAR 19 with a target gene, packaging plasmids pMDLg / pRRE (Kan+) and pRSV-REV (Kan+), lentiviral envelope plasmid pMD2.G (Kan+) / pCMV-BaEV RLess (Kan+)). In some embodiments, the retroviral vector used is specifically a two-plasmid viral packaging system (retroviral expression plasmid MSGV-m19BBZ-P2A-EGFP carrying the target gene, and viral packaging plasmid pCL-Eco).
[0010] Preferably, the target of the targeted B cells and / or plasma cells is CD19, BCMA, CD20 or CD22.
[0011] More preferably, the target of the targeted B cells and / or plasma cells is CD19 or BCMA.
[0012] In some embodiments, the chimeric antigen receptor comprises a signal peptide, an antigen binding domain, a hinge region, a transmembrane domain, a co-stimulatory signaling region, and a cell activation signaling domain;
[0013] The nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence is shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8;
[0014] The nucleotide sequence of the chimeric antigen receptor is a nucleotide sequence having at least 75% homology to the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence is an amino acid sequence having at least 75% homology to the amino acid sequence shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.
[0015] It should be noted that the CAR nucleic acid sequence includes but is not limited to a plasmid containing CAR and in vitro transcribed mRNA.
[0016] In some embodiments, the signal peptide includes CD8A, CD4, CD3, CD5, CD19, CD20, CD22, CD28, CD33, CD45, CD80, CD86, GM-CSFR, and PD-L1; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10; the nucleotide sequence of GM-CSFR is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.12.
[0017] Preferably, the signal peptide is CD8A or GM-CSFR.
[0018] In some embodiments, the antigen binding domain is an antigen binding fragment Fab, an antigen binding fragment scFv, a ligand, a receptor, or an antigen that targets B cells and / or plasma cells;
[0019] The antigen-binding fragment Fab or antigen-binding fragment scFv is selected from at least one of FMC63, HI19α, 4G7, Inebilizumab, Tafasitamab targeting CD19, 11D5, FHVH33, 1D12G9, 19F2 targeting BCMA, Rituximab, Ibritumomab, Tositumomab, Ofatumumab, Ocrelizumab, Atuzumab targeting CD20, Epratuzumab, Suciraslimab, RFB4 targeting CD22;
[0020] Among them, the nucleotide sequence of the antigen-binding fragment scFv targeting CD19 is as shown in SEQ ID NO.13 or a nucleotide sequence having at least 75% homology to the nucleotide sequence shown in SEQ ID NO.13, and the amino acid sequence is as shown in SEQ ID NO.14 or an amino acid sequence having at least 75% homology to the amino acid sequence shown in SEQ ID NO.14.
[0021] Preferably, the antigen-binding fragment is a scFv composed of VH-Linker-VL or VL-Linker-VH; more preferably, the antigen-binding fragment scFv is composed of VL-Linker-VH.
[0022] In some embodiments, the hinge region is selected from at least one of CD8A, CD28, IgG1, IgG2, and IgG4; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.15, and its amino acid sequence is shown in SEQ ID NO.16; the nucleotide sequence of CD28 is shown in SEQ ID NO.17, and its amino acid sequence is shown in SEQ ID NO.18.
[0023] In some embodiments, the transmembrane domain is selected from one of CD8A, CD28, CD4, CD3, ICOS, CD5, CD9, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, TCRα, and TCRβ; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.19, and its amino acid sequence is shown in SEQ ID NO.20; the nucleotide sequence of CD28 is shown in SEQ ID NO.21, and its amino acid sequence is shown in SEQ ID NO.22.
[0024] In some embodiments, the costimulatory signaling region is an intracellular domain of a costimulatory molecule, and the costimulatory molecule is selected from CD27, CD28, 4-1BB (CD137), OX40 (CD134), ICOS (CD278), CD40, lymphocyte function-associated antigen-1 (LFA-1), CD30, CD49a, CD49D, CD49f, CD69, CD84, CD96 (Tactile), CD100 (SEMA4D), CD103, SLAM (SLAMF1, CD150, IPO-3), CD160 (BY5 5), at least one of SELPLG (CD162), DNAM1 (CD226), Ly9 (CD229), SLAMF4 (CD244, 2B4), CEACAM1, CDS, CRTAM, DAP10, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, KIRDS2, and LAT;
[0025] Among them, the nucleotide sequence of 4-1BB is shown in SEQ ID NO.23, and the amino acid sequence is shown in SEQ ID NO.24; the nucleotide sequence of CD28 is shown in SEQ ID NO.25, and the amino acid sequence is shown in SEQ ID NO.26.
[0026] In some embodiments, the cell activation signaling domain is selected from at least one of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d; wherein the nucleotide sequence of CD3ζ is as shown in SEQ IDNO.27, and the amino acid sequence is as shown in SEQ IDNO.28.
[0027] Preferably, the cell activation signaling domain is the intracellular signaling domain of CD3, specifically CD3ζ or CD3ε.
[0028] The second aspect of the present invention is to provide a cell drug modified by a chimeric antigen receptor, wherein the in vivo immune cells include T lymphocytes, NK cells, macrophages, NKT cells, tumor infiltrating lymphocytes (TIL), lymphokine-activated killer cells (LAK), and cytokine-induced killer cells (CIK).
[0029] Preferably, the in vivo immune cells are T lymphocytes, NK cells, macrophages or NKT cells.
[0030] It should be noted that the sources of in vivo immune cells include, but are not limited to, peripheral blood, whole blood, single blood collection, umbilical cord blood, tumor tissue, spleen, bone marrow, monocytes, T lymphocytes, NK cells, NKT lymphocytes, macrophages, induced pluripotent stem cells (iPSC), hematopoietic stem cells (HPSC), embryonic stem cells (ESC), tumor infiltrating lymphocytes (TIL), lymphokine-activated killer cells (LAK), cytokine-induced killer cells (CIK);
[0031] Among them, T lymphocytes are selected from CD3 + T lymphocytes, CD4 + T cells, CD8 + T cells, initial T cells (TN), stem cell memory T cells (TSCM), effector T cells (TEFF), memory T cells (TM), central memory T cells (TCM), effector memory T (TEM) cells, terminally differentiated effector memory T cells (TEMRA), tumor infiltrating lymphocytes (TIL), iPSC-induced differentiated T cells, immature T cells, mature T cells, helper T cells, cytotoxic T cells, regulatory T cells (Treg), TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, mucosa-associated invariant T cells (MAIT), follicular helper T cells, αβT cells, γδT cells; NK cells include but are not limited to autologous peripheral blood NK, autologous umbilical cord blood NK, allogeneic peripheral blood NK, allogeneic umbilical cord blood NK, induced pluripotent stem cell (iPS)-induced differentiated NK, and NK-92.
[0032] Further, the preparation of the chimeric antigen receptor introduced into the in vivo immune cells (CAR-T cells) includes the following steps:
[0033] S1. Collect peripheral blood from healthy volunteers or patients, and centrifuge to obtain autologous plasma and cell precipitates; dilute the precipitated cells with normal saline and add them to a centrifuge tube containing Ficoll solution, separate PBMCs by density gradient centrifugation, and wash the cells twice with normal saline;
[0034] S2. Take the separated PBMC cells, add virus solution (MOI is 1-200) and polybrene (final concentration is 1-20 μg / mL);
[0035] S3, centrifugal infection, placed at 37°C, 5% CO 2 After lentiviral infection, the cells were centrifuged and the medium was changed, and the cells were resuspended in serum-free cell culture medium, and 1-10% plasma / serum replacement / human AB serum and cytokines (IL-2 and / or IL15) were added to continue culturing and amplification.
[0036] S2 can be replaced with serum-free cell culture medium with activators and recombinant cytokines (IL-2 and / or IL15) added to activate PBMC. Take T cells activated for 24-120 hours, add virus solution (MOI of 1-200) and polybrene (final concentration of 1-20 μg / mL).
[0037] S2 can also be replaced with serum-free cell culture medium with activators and recombinant cytokines (IL-2 and / or IL15) added to activate PBMC. Use RetroNectin to coat the cell culture plate before infection, and wash the culture plate 2-24 hours after coating. Add the virus solution (MOI is 1-200), centrifuge at 1000-2000×g, 1-2h, and remove or not remove the virus supernatant. Take T cells activated for 48-96h, add them to the culture plate, and add polybrene (final concentration 0-20μg / mL) at the same time.
[0038] Among them, the activator includes but is not limited to anti-human CD3 / CD28 magnetic beads, anti-human CD3 magnetic beads, anti-human CD3 monoclonal antibody (OKT-3), anti-human CD3 monoclonal antibody and anti-human CD28 monoclonal antibody, and anti-mouse CD3 / CD28 magnetic beads.
[0039] In addition to the above, chimeric antigen receptors introduced into in vivo immune cells (CAR-T cells) can also be prepared by the following steps:
[0040] S1. Collect spleen from mice to isolate spleen cells, filter and lyse red blood cells using a 100 μm cell sieve. Use mouse T cell isolation beads (STEMCELL Technologies) to magnetically sort mouse primary T lymphocytes, add CD28 / CD3 beads (Mouse T-activator anti-CD3 / CD28 Dynabeads, Gibco) to stimulate for 24-96 hours. Centrifuge and wash the cells, and adjust the cell density to 1-2×10 6 cells / mL, transferred to 6-well plates, 2 mL / well.
[0041] S2. Add the retrovirus MSGV-m19BBZ-P2A-EGFP and transfection enhancer polybrene (final concentration 0-20 μg / mL).
[0042] S3, centrifuge infection, 1500g, 60min. Place at 37℃, 5% CO 2 Culture in an incubator. Change the medium 24 hours after infection and place the cells at 37°C and 5% CO 2 Culture in an incubator.
[0043] It is further explained that the preparation of chimeric antigen receptors introduced into in vivo immune cells (CAR-NK cells) includes the following three methods.
[0044] Method 1: Coat the culture flask overnight in advance. Collect peripheral blood from healthy volunteers or patients, centrifuge to obtain autologous plasma and cell precipitate; dilute the precipitated cells with saline and add them to a centrifuge tube containing Ficoll solution, separate PBMC by density gradient centrifugation, and wash the cells twice with saline. Take mononuclear cells and enrich CD56 by CD56 magnetic bead sorting + Adjust the cell density to 0.5-4×10 6 / mL, use medium containing IL-2, IL-7, IL-15, IL-21, 1-10% plasma / serum replacement / human AB serum, inoculate into coated culture bottles, and place at 37°C, 5% CO 2 Culture in an incubator. After culturing for 24-96 hours, collect NK cells, wash the cells twice and count them, and adjust the cell density to 1-2×10 6 cells / mL, add lentivirus and transfection enhancer polybrene (final concentration 0-20μg / mL). Centrifuge infection, 500-2000g, 60min. Place at 37℃, 5% CO 2 Culture in an incubator. Change the medium 24 hours after infection and place the cells at 37°C and 5% CO 2 Culture in an incubator.
[0045] Method 2: Coat the culture flask overnight in advance. Collect umbilical cord blood, centrifuge to obtain plasma and cell precipitate; dilute the precipitated cells with saline and add them to a centrifuge tube containing Ficoll solution, separate CBMC by density gradient centrifugation, and wash the cells twice with saline. Take mononuclear cells and enrich CD56 by CD56 magnetic bead sorting + Adjust the cell density to 0.5-4×10 6 / mL, use medium containing IL-2, IL-7, IL-15, IL-21, 1-10% plasma / serum replacement / human AB serum, inoculate into coated culture bottles, and place at 37°C, 5% CO 2 Culture in an incubator. Use RetroNectin to coat the cell culture plate before infection. Wash the culture plate 2-24 hours after coating. Add purified lentiviral virus solution (MOI is 1-200), centrifuge at 500-2000g for 1-2 hours, and remove or not remove the virus supernatant. Take NK cells cultured for 48-120 hours, add them to the culture plate, and add polybrene (final concentration 0-20μg / mL). Place at 37°C, 5% CO 2 Culture in an incubator. After 24 hours of lentiviral infection, the cells were centrifuged and the medium was changed, and the cells were resuspended in serum-free cell culture medium, and 1-10% plasma / serum replacement / human AB serum and cytokines (IL-2 and / or IL15) were added to continue culture and amplification.
[0046] Method 3: Coat the culture flask overnight in advance. Collect umbilical cord blood or peripheral blood, centrifuge to obtain plasma and cell precipitate; dilute the precipitated cells with saline and add them to a centrifuge tube containing Ficoll solution, separate the mononuclear cells by density gradient centrifugation, and wash the cells twice with saline. Take the mononuclear cells and enrich CD3 by CD3 and CD56 magnetic beads. - CD56 + Adjust the cell density to 0.5-4×10 6 / mL, use medium containing IL-2, IL-7, IL-15, IL-21, 1-10% plasma / serum replacement / human AB serum, inoculate into coated culture bottles, and place at 37°C, 5% CO 2 Culture in an incubator. Use RetroNectin to coat the cell culture plate before infection. Wash the culture plate 2-24 hours after coating. Add retroviral solution, centrifuge at 500-2000g for 1-2 hours, and remove or not remove the virus supernatant. Take NK cells cultured for 48-120 hours, add them to the culture plate, and add polybrene (final concentration 0-20μg / mL). Place at 37℃, 5% CO 2Culture in an incubator. After 24 hours of lentiviral infection, the cells were centrifuged and the medium was changed, and the cells were resuspended in serum-free cell culture medium, and 1-10% plasma / serum replacement / human AB serum and cytokines (IL-2 and / or IL15) were added to continue culture and amplification.
[0047] The third aspect of the present invention is to provide a chimeric antigen receptor modified cell drug for use in the preparation of a drug for treating autoimmune diseases, wherein the autoimmune diseases include systemic lupus erythematosus (SLE), lupus nephritis, IgA nephropathy, myasthenia gravis (MG), multiple sclerosis (MS), idiopathic thrombocytopenic purpura (ITP), neuromyelitis optica spectrum disorder (NMOSD), pulmonary alveolar proteinosis (PAP), idiopathic inflammatory myopathy, anti-N-methyl-D-aspartate receptor encephalitis (NMDAR encephalitis), systemic sclerosis, primary Sjögren's syndrome (PSS), and idiopathic thrombocytopenic purpura (ITP). syndrome, pSS), rheumatoid arthritis (RA), granulomatosis with polyangiitis, pemphigus vulgaris, primary sclerosing cholangitis, inflammatory bowel disease (IBD), ankylosing spondylitis (AS), psoriasis, type 1 diabetes, and Crohn's disease.
[0048] The present invention has the following beneficial effects:
[0049] 1. The chimeric antigen receptor-modified cellular drug provided by the present invention can achieve specific recognition of B cells and / or plasma cells and activate immune cells through specific single-chain antibody fragments (scFv), and can specifically eliminate B cells in vitro and in vivo, thereby preventing the production of autoimmune antibodies and the formation of immune complexes, thereby achieving the purpose of completely treating the disease.
[0050] 2. Among the cell drugs modified with chimeric antigen receptors provided by the present invention, CAR-T cells can eliminate B cells of systemic lupus erythematosus mice MRL-lpr and IgA nephropathy model cell line Dakiki; CAR-NK cells can specifically eliminate IgA nephropathy model cell line Dakiki, and their effect is more obvious than that of CAR-T. NK cells almost do not secrete inflammatory factors that cause cytokine release syndrome, which improves safety. Allogeneic transfusion has no immune rejection and can be developed into a ready-to-use cell injection solution, which improves the accessibility of drugs and is expected to reduce costs.
[0051] 3. The chimeric antigen receptor-modified cellular drugs provided by the present invention can be used in the preparation of drugs for the treatment of autoimmune diseases, and can target and eliminate B cells and / or plasma cells that have a greater impact on the occurrence and development of autoimmune diseases, thereby providing a new strategy for autoimmune diseases. It is expected to provide more effective treatment methods for patients with autoimmune diseases, improve the quality of life of patients, and ultimately cure the disease. It has a wide range of indications and has huge application potential and commercial value. BRIEF DESCRIPTION OF THE DRAWINGS
[0052] Figure 1 To detect the construction of retrovirus MSGV-m19BBZ-P2A-EGFP by agarose gel electrophoresis;
[0053] Figure 2 This is the plasmid map of the retroviral expression vector MSGV-m19BBZ-P2A-EGFP;
[0054] Figure 3 Agarose gel electrophoresis was used to detect the construction of lentivirus pRRLSIN-EF1α-CAR 19;
[0055] Figure 4 This is the plasmid map of the lentiviral expression vector pRRLSIN-EF1α-CAR 19;
[0056] Figure 5 Flow cytometry was used to detect the CAR positivity rate of mouse CAR-T cells targeting mouse mCD19;
[0057] Figure 6 Flow cytometry was used to detect the in vitro killing effect of mouse CAR-T cells on B cells of MRL-lpr in systemic lupus erythematosus mice;
[0058] Figure 7 Flow cytometry was used to detect the clearance of B cells by mouse CAR-T cells on MRL-lpr B cells in systemic lupus erythematosus mice;
[0059] Figure 8To detect the CAR positivity and NK phenotype of CAR-T and CAR-NK cells modified by CAR gene by flow cytometry;
[0060] Fig. 9 To detect the in vitro killing effect of CAR gene modified human immune cells CAR-T and CAR-NK on human peripheral blood B cells by flow cytometry;
[0061] Fig.10 LDH was used to detect the in vitro killing effect of CAR gene-modified human immune cells CAR-T and CAR-NK on the B cell line Dakiki (IgA nephropathy model cell line). DETAILED DESCRIPTION
[0062] The present invention will be further described in detail below in conjunction with the accompanying drawings. The embodiments described with reference to the accompanying drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention.
[0063] Example 1 Production of retrovirus MSGV-m19BBZ-P2A-EGFP and preparation of mouse CAR-T cells targeting mouse mCD19
[0064] 1. Construction of retroviral expression vector MSGV-m19BBZ-P2A-EGFP
[0065] The chimeric antigen receptor CAR (m19BBZ) targeting mouse mCD19 is composed of a signal peptide, an antigen binding domain, a hinge region, a transmembrane domain, a co-stimulatory signal transduction region and a CD3 signal transduction domain in series. The nucleotide sequence of CAR is shown in SEQ ID NO.3. It was artificially synthesized by General Bio (Anhui) Co., Ltd. and cloned into -4Z-64A (in The constructed recombinant vector was named pGEM-m19BBZ-64A. The m19BBZ gene fragment was amplified by PCR using pGEM-m19BBZ-64A as template and HindIII-m19BBZ-F / SalI-m19BBZ-R as primers (HindIII-m19BBZ-F sequence: CCCAAGCTTGCCACCATGGGTGTCCCTA; SalI-m19BBZ-R sequence: TGCGGTCGACGCGAGGGGCCAGGGTCT). The results are as follows: Figure 1As shown in A, lane 1 and lane 2 are HindIII-m19BBZ-SalI fragments (1450 bp), and the size is in line with expectations. The target fragment HindIII-m19BBZ-SalI and the vector MSGV-1D3-28Z All ITAMs intact-P2A-EGFP (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) were digested with HindIII and SalI, and the HindIII-m19BBZ-SalI digestion product was directly recovered using a DNA gel recovery kit (US Everbright), and the vector MSGV-1D3-28Z All ITAMs intact-P2A-EGFP digestion product was recovered by agarose gel electrophoresis and then cut into the gel. The results are shown in Figure 1 As shown in B, lane 1 is the vector restriction map. After restriction digestion, two fragments are generated, with sizes of 6286 bp and 1437 bp respectively. The band size is in line with expectations. The larger band is cut and recovered using a DNA gel recovery kit (US Everbright). The recovered restriction products are connected, and the connected products are transformed into TransStbl3 chemical competent cells (Beijing Quanshijin Biotechnology Co., Ltd.). 10 single colonies are picked and identified by colony PCR (with HindIII-m19BBZ-F / mCD8Hinge-R as primers, HindIII-m19BBZ-F sequence: CCCAAGCTTGCCACCATGGGTGTCCCTA; mCD8 Hinge-R sequence: AGTTCGCAGCACTGGCTTGGTA), and the results are shown in Figure 1 As shown in C, clones 1-10 amplified the target bands and the bands were obvious, indicating that they might be positive clones. After the clone 10 was shaken, the plasmid was extracted and sequenced. The sequence was found to be correct, and the retroviral expression vector MSGV-m19BBZ-P2A-EGFP was obtained. The plasmid map is shown in Figure 2 As shown. Endo-free Plasmid Maxi Kit (Omega) was used to extract plasmid. The concentration and purity of the extracted plasmid were detected by UV spectrophotometer, and then stored in a -20°C refrigerator for subsequent retroviral packaging.
[0066] 2. Production of retrovirus MSGV-m19BBZ-P2A-EGFP
[0067] (1) HEK293T cells were revived from cryopreservation and subcultured with DMEM complete medium (DMEM medium + 10% FBS). HEK293T cells were cultured at 2.2×10 7The cells were inoculated into 15 cm culture dishes at a density of 1.5 cells / dish, and DMEM complete medium was added. The cells were cultured overnight to allow the cells to reach 80-90% confluence for plasmid transfection.
[0068] (2) Add the retroviral packaging plasmids (expression plasmid MSGV-m19BBZ-P2A-EGFP, viral packaging plasmid pCL-Eco) and PEI (polysciences) into serum-free DMEM, mix well, and let stand for 5 minutes. Add the latter to the former, mix well, and let stand for 20 minutes to form a DNA-PEI complex.
[0069] (3) Add the DNA-PEI complex to DMEM medium containing 5% FBS, mix thoroughly, replace the culture medium in the cell culture dish, and place at 37°C and 5% CO 2 Culture in incubator.
[0070] (4) 20 hours after transfection, discard the cell culture supernatant and add 5% FBSDMEM culture medium, 20 mL / dish. 48 hours after transfection, collect the culture supernatant, a total of ~200 mL.
[0071] (5) Filter the collected viral supernatant with a 0.45 μm filter, add 40% PEG8000 solution to a final concentration of 10%, place on ice for ~3 h (mix several times during this period), and centrifuge (4°C, 2000g, 30 min). Resuspend the precipitate with 2 mL of DMEM medium containing 10% FBS. Aliquot and store in a -80°C refrigerator, and record as retrovirus MSGV-m19BBZ-P2A-EGFP.
[0072] 3. Preparation of mouse CAR-T cells targeting mouse mCD19
[0073] (1) The spleen of MRL-lpr mice was taken to isolate spleen cells, and the red blood cells were filtered and lysed using a 100 μm cell sieve.
[0074] (2) Mouse primary T lymphocytes were sorted using mouse T cell isolation beads (STEMCELL Technologies) and stimulated for 24-96 h by adding CD28 / CD3 beads (Mouse T-activator anti-CD3 / CD28 Dynabeads, Gibco). The cells were centrifuged and washed, and the cell density was adjusted to 1×10 6 cells / mL, transferred to 6-well plates, 2 mL / well.
[0075] (3) Add the retrovirus MSGV-m19BBZ-P2A-EGFP and the transfection enhancer polybrene (8 μg / mL). At the same time, set up a group without retrovirus as a T cell control group. Centrifuge the infection at 1500g for 60 min. Culture in a 37°C, 5% CO2 incubator.
[0076] (4) Change the medium 24 hours after infection and place the cells at 37°C and 5% CO 2 The cells were cultured in an incubator. CAR expression was detected by flow cytometry 3 days after infection. Figure 5 As shown, after retrovirus infection of spleen T cells in MRL-lpr mice, the expression of CAR could be detected by flow cytometry, and the transduction efficiency was about 80%.
[0077] Example 2 Production of lentivirus pRRLSIN-EF1α-CAR 19 and preparation of CAR-T and CAR-NK cells targeting human CD19
[0078] 1. Construction of lentiviral expression vector pRRLSIN-EF1α-CAR 19
[0079] The chimeric antigen receptor CAR (CAR 19) targeting human CD19 is composed of a signal peptide, an antigen binding domain, a hinge region, a transmembrane domain, a co-stimulatory signaling region and a CD3 signaling domain in series, and its nucleotide sequence is most preferably as shown in SEQ ID NO.1. The CAR 19 fragment was transferred to the EcoRI and MIuI restriction sites of the pLVX-EF1α-IRES-puro vector by PCR amplification, restriction digestion, ligation, transformation and positive clone screening, and then EF1α-CAR 19 was cloned between the NheI and MIuI restriction sites of the pRRLSIN vector by PCR amplification, restriction digestion, ligation, transformation and positive clone screening to construct pRRLSIN-EF1α-CAR 19. The specific process is as follows: pLVX-CMV-CAR 19-T2A-GFP (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) was used as a template, and EcoRI-SP-F / MIuI-CD3-R was used as primers (EcoRI-SP-F sequence: GGAATTCATGGCCTTACCAGTGACC; MIuI-CD3-R sequence: CGACGCGTTTAGCGAGGGGGCAGGGC) was used to amplify the EcoRI-CAR 19-MIuI fragment. The results are shown in the figure. Figure 3As shown in A, lane 1 is the EcoRI-CAR 19-MIuI fragment. The target fragment EcoRI-CAR 19-MIuI and the vector pLVX-EF1α-CAR (5E5) (stored by Guangzhou Anjie Biomedical Technology Co., Ltd.) were digested with EcoRI and MIuI, and the EcoRI-CAR 19-MIuI digestion product was directly recovered. The vector pLVX-EF1α-CAR (5E5) digestion product was recovered after agarose gel electrophoresis. The results are shown in Figure 3 As shown in B, lane 1 is the vector restriction map. After restriction digestion, two fragments are generated. The band size is in line with expectations. The larger band is cut and recovered using a DNA gel recovery kit (US Everbright). The recovered restriction products are connected, and the connected products are transformed into TransStbl3 chemical competent cells (Beijing Quanshijin Biotechnology Co., Ltd.). Ten single colonies were picked and identified by colony PCR (using CAR 19-F and MIuI-CD3-R as primers, CAR 19-F sequence: AGGAGTCCCATCAAGGTTC; MIuI-CD3-R sequence: CGACGCGTTTAGCGAGGGGGCAGGGC). The results are shown in Figure 3 As shown in C, clones 1-10 amplified the target bands and the bands were obvious, indicating that they might be positive clones. After the clone 1 was shaken, the plasmid was extracted and sequenced. The sequence was found to be correct, and the pLVX-EF1α-CAR 19 plasmid was obtained. Using pLVX-EF1α-CAR 19 as a template and NheI-EF1α-F / MIuI-CD3-R as primers (NheI-EF1α-F sequence: CTAGCTAGCGCTCCGGTGCCCGTCAGT; MIuI-CD3-R sequence: CGACGCGTTTAGCGAGGGGGCAGGGC), the NheI-EF1α-CAR 19-MIuI fragment was amplified. The results are shown in Figure 3 D, where lane 1 is the NheI-EF1α-CAR 19-MIuI fragment. The target fragment NheI-EF1α-CAR 19-MIuI and the vector pRRLSIN-EF1α-CAR (5E5) (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) were digested with NheI and MIuI, where the NheI-EF1α-CAR 19-MIuI digestion product was directly recovered, and the vector pRRLSIN-EF1α-CAR (5E5) digestion product was recovered after agarose gel electrophoresis. The results are shown in Figure 3As shown in E, lane 1 is the restriction map of the pRRLSIN-EF1α-CAR (5E5) vector. After restriction digestion, two fragments are generated. The band size is in line with expectations. The larger band is cut and recovered using a DNA gel recovery kit (US Everbright). The recovered restriction products are connected, and the connected products are transformed into TransStbl3 chemical competent cells (Beijing Quanshijin Biotechnology Co., Ltd.). Ten single colonies were picked and identified by colony PCR (using CAR19-F and MIuI-CD3-R as primers, CAR 19F sequence is: AGGAGTCCCATCAAGGTTC, MIuI-CD3-R sequence is: CGACGCGTTTAGC GAGGGGGCAGGGC), and the results are shown in Figure 3 As shown in F, clones 1-10 amplified the target bands and the bands were obvious, indicating that they might be positive clones. After clone 1 was shaken, the plasmid was extracted and sequenced. The sequence was found to be correct, and the pRRLSIN-EF1α-CAR 19 plasmid was obtained. The plasmid map is shown in Figure 4 As shown. Endo-free Plasmid Maxi Kit (Omega) was used to extract plasmid. The concentration and purity of the extracted plasmid were detected by UV spectrophotometer, and then stored in a -20°C refrigerator for subsequent lentiviral packaging.
[0080] 2. Lentivirus pRRLSIN-EF1α-CAR 19 packaging and purification
[0081] (1) Resuscitate frozen HEK293T cells and subculture them with DMEM complete medium (DMEM medium + 10% FBS). Inoculate HEK293T cells into 10-layer cell factories, add DMEM complete medium, and culture overnight to allow the cells to reach 80-90% confluence for plasmid transfection.
[0082] (2) Add lentiviral packaging plasmids (expression plasmid pRRLSIN-EF1α-CAR 19, lentiviral packaging plasmids pMDLg / pRRE (Kan+) and pRSV-REV (Kan+), lentiviral envelope plasmid pMD2.G (Kan+)) and PEI (polysciences) to serum-free DMEM, mix well, and let stand for 5 minutes. Add the latter to the former, mix well, and let stand for 20 minutes to form a DNA-PEI complex.
[0083] (3) Add the DNA-PEI complex to 1L of DMEM medium containing 5% FBS, mix thoroughly, replace the culture medium in the 10-layer cell factory, and place at 37°C and 5% CO 2 Culture in incubator.
[0084] (4) Collect the culture supernatant 48 h and 72 h after transfection and store in a refrigerator at 2-8°C.
[0085] (5) The collected culture supernatants were mixed and cells and cell debris were removed using a capsule filter (Sartorius). The clarified and filtered lentiviral supernatant was filtered through a Spectrum tangential flow filtration system ( KR2I) was concentrated 10 to 15 times, filtered through a 0.45 μm filter membrane, and then purified by chromatography.
[0086] (6) The purified lentivirus was sterilized and filtered through a 0.22 μm filter (Sartorius), aliquoted, and stored in a −80° C. refrigerator, and was designated as pRRLSIN-EF1α-CAR 19 lentivirus.
[0087] 3. Preparation of CAR-T targeting human CD19
[0088] (1) Collect umbilical cord blood or peripheral blood and separate mononuclear cells by density gradient centrifugation.
[0089] (2) Take mononuclear cells and adjust the cell density to 1.5×10 6 / mL, using KBM581 medium containing 1000IU / mL IL2 and 5-10% plasma, adding CD3 / CD28 magnetic beads for activation, and placing at 37°C, 5% CO 2 Culture in an incubator.
[0090] (3) After 24-96 hours of activation, T cells were collected, washed twice and counted, and the cell density was adjusted to 1×10 6 cells / mL, add lentivirus pRRLSIN-EF1α-CAR 19 and transfection enhancer polybrene (8μg / mL). Centrifuge infection at 500g for 60min. Place at 37℃, 5% CO 2 Culture in an incubator.
[0091] (4) Change the medium 24 hours after infection and place the cells at 37°C and 5% CO 2 Culture in an incubator.
[0092] At the same time, a group without lentivirus was set up as a T cell control group.
[0093] 4. Preparation of CAR-NK cells targeting human CD19
[0094] (1) Collect umbilical cord blood or peripheral blood and separate mononuclear cells by density gradient centrifugation. Coat the culture flask overnight in advance.
[0095] (2) Mononuclear cells were selected and enriched for CD56 by CD56 magnetic beads +Adjust the cell density to 1.5 × 10 6 / mL, use KBM581 medium containing 1000IU / mL IL-2, IL-7, IL-15, IL-21, and 5-10% plasma, inoculate into the coated culture flask, and place at 37°C, 5% CO 2 Culture in an incubator.
[0096] (3) After culturing for 24-96 h, NK cells were collected, washed twice and counted, and the cell density was adjusted to 1×10 6 cells / mL, added lentivirus pRRLSIN-EF1α-CAR 19 and transfection enhancer polybrene (8μg / mL).
[0097] (4) Centrifugal infection, 500g, 60min. Place at 37℃, 5% CO 2 Culture in an incubator.
[0098] (5) Change the medium 24 h after infection and place the cells at 37°C and 5% CO 2 Culture in an incubator.
[0099] At the same time, a group without lentivirus was set up as the NK cell control group.
[0100] Flow cytometry was used to detect the purity of NK cells and the positive rate of CAR on days 3-7 after infection. The results are shown in the figure. - CD56 + The cell ratio reached 95% ( Figure 8 A), after lentivirus infection of human T / NK cells, the expression of CAR can be detected by flow cytometry and the positive rate reaches about 50% ( Figure 8 A and Figure 8 B) illustrates the successful preparation of CAR-T cells and CAR-NK cells modified with CAR gene targeting human CD19.
[0101] Experimental Example 1: Testing the in vitro killing effect of mouse CAR-T cells on B cells of systemic lupus erythematosus MRL-lpr and the clearance effect on B cells in vivo
[0102] 1. In vitro killing effect of mouse CAR-T cells on B cells of systemic lupus erythematosus MRL-lpr
[0103] (1) The spleen of MRL-lpr mice was taken to isolate spleen cells, and the red blood cells were lysed by filtering with a 100 μm cell sieve. The single cell suspension of spleen cells was collected as target cells, and the cells were washed by centrifugation three times with RPMI 1640 culture medium (serum-free), 300 g, 5 min.
[0104] (2) Take a portion of the cells and resuspend them in 4 mL of RPMI1640 containing a final concentration of 2 μM CFSE, incubate at room temperature in the dark for 10 min, and wash the cells three times by centrifugation at 300 g for 5 min in RPMI1640 culture medium containing 10% FBS.
[0105] (3) The mouse T cells and CAR-T cells prepared in Example 1 were collected as effector cells, and the cells were washed three times with RPMI 1640 culture medium, 300g, 5min. The effector cells and target cells were resuspended, and the number of effector cells and target cells were counted respectively. The co-incubation wells were prepared: the number of target cells was 5×10 5 cells / well, the effector-target ratios were 0.4:1 and 1:1, and target cell control wells (NC) were set at the same time.
[0106] (4) In addition, the following wells were set up for adjustment and compensation: target cell blank well (no staining), target cell isotype control well, target cell CFSE single staining well, target cell 7-AAD single staining well, target cell CD45 single staining well, target cell CD19 single staining well, and target cell multi-staining well. Gently tap the cell culture plate to mix well and place it at 37°C, 5% CO 2 After 15 hours, the cell culture plate was removed from the incubator, and cells from each well were collected to prepare a single cell suspension. Cells from each well were washed three times by centrifugation with PBS at 300 g for 5 min.
[0107] (5) Add 7-AAD to the target cell 7-AAD single staining well, target cell multi-staining well, and co-incubation well and incubate at room temperature in the dark for 5 min.
[0108] Flow cytometry was used to detect CD19 in each group + The residual B cells (i.e. CFSE + 7-AAD - CD19 + / CD45 + The killing efficiency was calculated according to the following formula: Killing efficiency (%) = (NC group CD19 + (%)-Experimental group CD19 + (%)) / NC group CD19 + (%)×100%. The results showed that compared with the NC group and the T cell group, the CAR-T cell group had a significantly higher CD19 + / CD45 + The proportion of cells decreased, and as the effector-target ratio increased, CD19 + / CD45 + The cell ratio decreased more ( Figure 6A), when the effector-target ratio was 0.4 and 1, the killing efficiency of CAR-T on splenic B cells was significantly higher than that on T cells, and the killing efficiency of the CAR-T group increased with the increase of the effector-target ratio ( Figure 6 B), indicating that mouse CAR-T cells targeting mCD19 in vitro can effectively eliminate B cells in the spleen in a dose-dependent manner.
[0109] 2. Clearance of B cells by MRL-lpr in systemic lupus erythematosus mice
[0110] MRL-lpr is an experimental animal model of systemic lupus erythematosus (SLE) and lupus nephritis.
[0111] The mouse T cells and CAR-T cells prepared in Example 1 were injected into MRL-lpr mice through the tail vein, 1×10 6 After 7 days, blood was collected from the orbits of the mice and the mice were euthanized.
[0112] Detection of CD19 in blood by flow cytometry + The results showed that compared with the T cell group, the CAR-T cell group could significantly reduce the level of CD19 in the blood. + B cells ( Figure 7 A and Figure 7 B), indicating that CAR gene-modified T cells targeting mCD19 can significantly eliminate CD19+B cells in mice.
[0113] Experimental Example 2 Verification of the in vitro cell killing effect of CAR gene-modified human immune cells on human B cells
[0114] 1. CAR gene-modified human immune cells for human peripheral blood CD19 + Cytotoxicity of B cells in vitro
[0115] (1) Human peripheral blood was collected and PBMCs were isolated as target cells by density gradient centrifugation. The cells were washed three times by centrifugation with RPMI 1640 culture medium (serum-free), 300 g, 5 min. Some cells were resuspended in RPMI1640 containing a final concentration of 2 μM CFSE, incubated at room temperature in the dark for 10 min, and washed three times by centrifugation with RPMI1640 culture medium containing 10% FBS, 300 g, 5 min.
[0116] (2) The human T cells, CAR-T cells, NK cells, and CAR-NK cells prepared in Example 2 were collected as effector cells, and the cells were washed three times with RPMI 1640 culture medium, 300g, 5min. The effector cells and target cells were resuspended, counted separately, and the co-incubation wells were prepared with effector-target ratios of 5, 10, and 20.
[0117] (3) In addition, the following wells were set up for adjustment and compensation: target cell blank well (no staining), target cell isotype control well, target cell CFSE single staining well, target cell 7-AAD single staining well, target cell CD45 single staining well, target cell CD19 single staining well, and target cell multiple staining well. Gently tap the cell culture plate to mix well and place it at 37°C, 5% CO 2 After 15 h, the cell culture plate was taken out from the incubator, and cells from each well were collected to prepare a single cell suspension.
[0118] (3) Wash the cells in each well with PBS by centrifugation three times at 300 g for 5 min. Add 7-AAD to the target cell 7-AAD single staining well, target cell multi-staining well, and co-incubation well and incubate at room temperature in the dark for 5 min.
[0119] Flow cytometry was used to detect CD19 in each group + The residual B cells (i.e. CFSE + 7-AAD - CD19 + / CD45 + The results are as follows Fig. 9 A and Fig. 9 As shown in B, compared with the T and NK cell groups, the CAR-T and CAR-NK cell groups had higher CD19 + / CD45 + The cell ratio decreased significantly, indicating that T and NK cells modified by CAR targeting CD19 can effectively eliminate human CD19 + B cells.
[0120] 2. In vitro cell killing effect of CAR gene-modified human immune cells on human B cell line Dakiki
[0121] DAKiKi cells are surface IgA-positive human B lymphocytes screened from African nasopharyngeal carcinoma patients and transformed by Epstein-Barr virus. They are IgA nephropathy model cell lines. Using the B cell line Dakiki as target cells, human T cells, CAR-T cells, NK cells, and CAR-NK cells prepared in Example 2 as effector cells, the in vitro cell killing efficiency was detected by the LDH method.
[0122] (1) The effector cells were co-cultured with Dakiki at different effector-target ratios (2, 5, 10, 20). At the same time, the effector cell spontaneous LDH release well, the target cell spontaneous LDH release well, the target cell maximum LDH release well, the volume correction control well, and the culture medium background control well were set. All groups were repeated 3 times, and each repeat had 3 replicates. After centrifugation at 300g for 4 minutes, the culture plate was placed in a 37°C, 5% CO 2 Incubate in incubator for 6 hours.
[0123] (2) Add 10 μL of Lysis Solution (10×) to the target cell maximum LDH release well and volume correction control well, and incubate for 45 min. Centrifuge the culture plate at 300 g for 4 min.
[0124] (3) Pipette 50 μL of supernatant from each well into a new ELISA plate and add 50 μL of Reagent, incubate at room temperature in the dark for 30 minutes. Add 50 μL Stop Solution to each well; pop large bubbles with a syringe needle, and measure absorbance at 490 nm or 492 nm within 1 hour after adding Stop Solution.
[0125] The killing efficiency was calculated according to the following formula: The exact value of spontaneous LDH release of effector cells, spontaneous LDH release of target cells and experimental group should be the reading minus the background reading of culture medium; Maximum release of target cells = maximum LDH release well of target cells - volume correction control well; Specific killing efficiency (%) = (experimental group - spontaneous release of effector cells - spontaneous release of target cells) / (maximum release of target cells - spontaneous release of target cells). The results are shown in Fig.10 As shown in the figure, at different effector-target ratios, CAR gene modification targeting CD19 can enhance the cell killing of B cell line Dakiki by T cells and NK cells, and at high-efficiency target ratios (10 and 20), the cell killing effect of CAR-NK on Dakiki is significantly stronger than that of CAR-T cells. At low-efficiency target ratios (2 and 5), the cell killing effect of CAR-NK on Dakiki is significantly stronger than that of NK cells, but there is no significant difference between CAR-T and T cells in the cell killing effect of Dakiki. The above results indicate that CAR gene modification targeting CD19 can enhance the cell killing of T and NK cells against CD19 + Specific killing of B cells, and the specific killing effect of CAR-NK is more obvious.
[0126] In summary, CAR-T and CAR-NK targeting CD19 can significantly eliminate CD19 both in vivo and in vitro. + B cells are therefore expected to serve as a new treatment strategy for autoimmune diseases such as systemic lupus erythematosus (SLE), lupus nephritis, and IgA nephropathy.
[0127] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all belong to the protection scope of the present invention.
Claims
1. A method for preparing a chimeric antigen receptor modified cell drug, characterized in that: The method comprises the following steps: introducing a chimeric antigen receptor targeting B cells and / or plasma cells into in vitro or in vivo immune cells through a gene delivery system to obtain a cellular drug; wherein the targets of the targeted B cells and / or plasma cells include CD19, BCMA, CD20, CD22, CD38, CD138, GPRC5D, and SLAMF7.
2. The preparation method according to claim 1, characterized in that: The chimeric antigen receptor comprises a signal peptide, an antigen binding domain, a hinge region, a transmembrane domain, a co-stimulatory signaling region and a cell activation signaling domain; The nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence is shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8; The nucleotide sequence of the chimeric antigen receptor is a nucleotide sequence having at least 75% homology with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence is an amino acid sequence having at least 75% homology with the amino acid sequence shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.
8.
3. The preparation method according to claim 2, characterized in that: The signal peptides include CD8A, CD4, CD3, CD5, CD19, CD20, CD22, CD28, CD33, CD45, CD80, CD86, GM-CSFR, and PD-L1; among them, the nucleotide sequence of CD8A is shown as SEQ ID NO.9, and the amino acid sequence is shown as SEQ ID NO.10; the nucleotide sequence of GM-CSFR is shown as SEQ ID NO.11, and the amino acid sequence is shown as SEQ ID NO.
12.
4. The preparation method according to claim 2, characterized in that: The antigen binding domain is an antigen binding fragment Fab, an antigen binding fragment scFv, a ligand, a receptor or an antigen targeting B cells and / or plasma cells; The antigen-binding fragment Fab or antigen-binding fragment scFv is selected from at least one of FMC63, HI19α, 4G7, inelizumab, and tancitumomab targeting CD19, 11D5, FHVH33, 1D12G9, and 19F2 targeting BCMA, rituximab, ibritumomab tiuxetan, tositumomab, ofatumumab, ocrelizumab, and atuzumab targeting CD20, and epratuzumab, sucizumab, and RFB4 targeting CD22; Among them, the nucleotide sequence of the antigen-binding fragment scFv targeting CD19 is as shown in SEQ ID NO.13 or a nucleotide sequence having at least 75% homology to the nucleotide sequence shown in SEQ ID NO.13, and the amino acid sequence is as shown in SEQ ID NO.14 or an amino acid sequence having at least 75% homology to the amino acid sequence shown in SEQ ID NO.
14.
5. The preparation method according to claim 2, characterized in that: The hinge region is selected from at least one of CD8A, CD28, IgG1, IgG2, and IgG4; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.15, and its amino acid sequence is shown in SEQ ID NO.16; the nucleotide sequence of CD28 is shown in SEQ ID NO.17, and its amino acid sequence is shown in SEQ ID NO.
18.
6. The preparation method according to claim 2, characterized in that: The transmembrane domain is selected from one of CD8A, CD28, CD4, CD3, ICOS, CD5, CD9, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, TCRα, and TCRβ; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.19, and its amino acid sequence is shown in SEQ ID NO.20; the nucleotide sequence of CD28 is shown in SEQ ID NO.21, and its amino acid sequence is shown in SEQ ID NO.
22.
7. The preparation method according to claim 2, characterized in that: The co-stimulatory signal transduction region is an intracellular domain of a co-stimulatory molecule, and the co-stimulatory molecule is selected from at least one of CD27, CD28, 4-1BB, OX40, ICOS, CD40, lymphocyte function-associated antigen-1, CD30, CD49a, CD49D, CD49f, CD69, CD84, CD96, CD100, CD103, SLAM, CD160, SELPLG, DNAM1, Ly9, SLAMF4, CEACAM1, CDS, CRTAM, DAP10, GADS, GITR, HVEM, IA4, ICAM-1, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, KIRDS2, and LAT; Among them, the nucleotide sequence of 4-1BB is shown in SEQ ID NO.23, and the amino acid sequence is shown in SEQ ID NO.24; the nucleotide sequence of CD28 is shown in SEQ ID NO.25, and the amino acid sequence is shown in SEQ ID NO.
26.
8. The preparation method according to claim 2, characterized in that: The cell activation signaling domain is selected from at least one of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d; Among them, the nucleotide sequence of CD3ζ is shown in SEQ ID NO.27, and the amino acid sequence is shown in SEQ ID NO.
28.
9. A chimeric antigen receptor modified cell drug prepared by the preparation method according to any one of claims 1 to 8, characterized in that: The in vivo immune cells include T lymphocytes, NK cells, macrophages, NKT cells, tumor infiltrating lymphocytes, lymphokine-activated killer cells, and cytokine-induced killer cells.
10. Use of the cell medicine according to claim 9 in preparing a medicine for treating autoimmune diseases, characterized in that: The autoimmune diseases include systemic lupus erythematosus, lupus nephritis, IgA nephropathy, myasthenia gravis, multiple sclerosis, idiopathic thrombocytopenic purpura, neuromyelitis optica spectrum disorder, alveolar proteinosis, idiopathic inflammatory myopathy, anti-N-methyl-D-aspartate receptor encephalitis, systemic sclerosis, primary Sjögren's syndrome, rheumatoid arthritis, granulomatosis with polyangiitis, pemphigus vulgaris, primary sclerosing cholangitis, inflammatory bowel disease, ankylosing spondylitis, psoriasis, type 1 diabetes, and Crohn's disease.
Citation Information
Cited By
Chimeric antigen receptor-modified cell drug, preparation method therefor, and use thereof
WO2026157129A1