Self-replicating RNA (Ribonucleic Acid) vector, gene delivery system and application thereof

Abstract

The invention relates to the field of biological medicines, in particular to a self-replicating RNA (Ribonucleic Acid) vector, a gene delivery system and application of the gene delivery system. By systematically optimizing the 5 'UTR end structure of the self-replicating RNA, the innate immune response of the self-replicating RNA can be regulated and controlled, the replication characteristic of the self-replicating RNA is maintained, the cytotoxicity is reduced, the efficient expression characteristic is maintained, and a new strategy is provided for developing a low-toxicity and efficient gene therapy vector.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a self-replicating RNA vector, a gene delivery system and applications thereof. Background Art

[0002] In the field of tumor treatment, traditional linear non-replicating mRNA can only mediate short-term high expression of target proteins in cells. It has shortcomings in expression duration and expression efficiency, and cannot meet the needs of long-term and stable expression of target proteins in tumor cells with rapid proliferation ability. Self-replicating mRNA (saRNA) can achieve the same protein expression level as traditional linear mRNA at a lower dose due to its self-replication ability, and can prolong the presence of target proteins in the body. This feature can reduce the dose and number of injections used in mRNA therapy for tumor applications. The advantage is that at low doses, high expression of related tumor suppressor factors or cytokines in tumor cells can be achieved, thereby achieving the purpose of tumor treatment.

[0003] When saRNA is delivered into cells, it forms double-stranded RNA during its self-replication process. These double-stranded RNAs are similar to replicating viral RNA and may stimulate the cell's innate immune response, which may further enhance the drug's effect. However, the immune response stimulated by saRNA self-replication is a "double-edged sword." As a drug, it may achieve the effect of promoting immune response, but the stimulated immune response may also cause side effects. Moreover, if the stimulated innate immune response is too strong, it may lead to the inhibition of saRNA expression, which in turn affects the drug's efficacy. Therefore, the immunogenicity of saRNA requires precise design and adjustment. Existing solutions (such as nucleotide modification and UTR optimization) can partially reduce immunogenicity. For example, nucleoside modification reduces mRNA immunogenicity. However, exogenous nucleotide modification cannot fundamentally solve the loss of expression efficiency because there are no exogenous nucleotides in the cells in the body (Karikó K, et al. Immunity (2005)). The literature (Kulasegaran-Shylini et al. Virology. 2009 Apr 25;387(1):211-21) also pointed out that in the structure of the original Venezuelan equine encephalitis virus, replacing A3 on 5U with G3 and making point mutations in the replication sequence element NSP2 can improve the toxicity of the virus to cells and further enhance the expression of the target protein.

[0004] In addition, in the prior art, there are several published patents involving RNA replicons. For example, CN116096409A discloses an RNA replicon that encodes a stabilized SARS-CoV-2 spike protein and contains elements such as the alphavirus 5'UTR, nonstructural genes, a subgenomic promoter, and a 3'UTR. While capable of inducing a certain immune response, the IgG level of the drug described only reached a maximum of 10^3.96 on day 42. US2021290756A1 also discloses an RNA molecule containing an alphavirus 5'UTR sequence, equipped with a cap structure (Cap1, Cap0, etc.) for vaccine applications, but this is not a self-replicating structure that is both safe and effective. To expand the potential application prospects of self-replicating RNA constructed from alphavirus self-replicating vectors in oncology drugs or vaccines, it is necessary to further ensure safety while also ensuring high efficacy.

[0005] In summary, self-replicating RNA technology has shown promising prospects in areas such as vaccines and tumor therapy. Existing literature and patents primarily focus on alphavirus-derived RNA replicons and the application of different capping methods. However, there are no reports on a novel self-replicating RNA vector, gene delivery system, and its application that is compatible with multiple capping strategies and reduces innate immune responses. Summary of the Invention

[0006] The present invention differs from previous approaches based solely on alphavirus-derived RNA replicons and different capping strategies. By modifying the structure of the VEEV TC-83 5'UTR, the present invention provides a novel self-replicating RNA vector that is compatible with multiple capping strategies and reduces innate immune responses. While maintaining the replication properties of saRNA, it also reduces saRNA cytotoxicity and maintains efficient expression.

[0007] The present invention is mainly based on the viral saRNA sequence of the alphavirus (VEEV) backbone (GenBank: L01443.1, whose nucleotide sequence is shown in SEQ ID NO. 16), and modifies the 5'UTR to achieve a balance between cytotoxicity and expression efficiency. The modified sequence of the 5'UTR of the present invention is shown in the following general formula:

[0008] [ (N1) x (N2) y ] z (N3) w ataggcggcgcatgagagaagcccagaccaattacctacccaaa,

[0009] The research of the present invention involves two stages. The first stage designs the leader sequence - that is, different modifications of the 5'UTR and synthesizes the corresponding saRNA, and then verifies its expression level in cells, so as to preliminarily screen out the preferred modified saRNA and further verify the modification effect.

[0010] The general formula for the 5'UTR of the leader sequence design is: N1 = A, x = 0 or 1; N2 = G, y = 1; z = 1-5; N3 = A or G, w = 0-5. Following this general formula, the following 5'UTR sequences were designed and the corresponding saRNAs were synthesized. Protein expression (HNF4a protein) was then assayed in cells to preliminarily evaluate the protein expression of the modified saRNAs. Seq lead-1 represents the wild-type VEEV backbone 5'UTR, while Seq lead-2 through Seq lead-13 represent 5'UTR mutants. The saRNAs contained in Seq lead-1 through Seq lead-6 were synthesized using the vaccinia virus capping enzyme method. Seq lead-7 through Seq lead-13 were synthesized using the co-transcriptional one-step capping method. The modified sequences of the present invention are shown in Table 1 below:

[0011] Table 1: 5'UTR sequence list

[0012]

[0013] After evaluating the cellular expression of the self-replicating RNA based on the above sequence, the inventors screened the following preferred 5'UTR sequences, as shown in Table 2. Then, saRNAs carrying different target genes were synthesized to further evaluate cytotoxicity, target protein expression in cells in vitro, and drug efficacy in vivo to confirm the efficacy of the modification.

[0014] Table 2: 5'UTR sequence list

[0015]

[0016] In a first aspect of the present invention, a saRNA vector is provided, which comprises a 5' non-coding region (5'UTR) Nsp1-Nsp4 non-structural protein gene, a target gene, a 3' non-coding region (3'UTR) and a polyA tail, wherein the sequence of the 5' non-coding region is shown in the following general formula:

[0017] [ (N1) x (N2) y ] z (N3) w ataggcggcgcatgagagaagcccagaccaattacctacccaaa,

[0018] Where N1=A, x=0 or 1; N2=G, y=1; z=1-5; N3=A or G, w=0-5; and, when x=0, z=2-5.

[0019] Preferably, in the 5' non-coding region sequence, N1=A, x=1; N2=G, y=1; z=1-3, N3=A or G, w=0-5.

[0020] Preferably, in the 5' non-coding region sequence, N1=A, x=0; N2=G, y=1; z=2 or 3, w=0.

[0021] Preferably, the 5' non-coding region has a sequence selected from the group consisting of:

[0022] The nucleotide sequence shown in any one of SEQ ID NOs. 3, 4, 7, 8, 9, 12, 13, or a complementary sequence thereof;

[0023] or a nucleotide sequence having at least 80% homology to the nucleotide sequence shown in any one of SEQ ID NOs. 3, 4, 7, 8, 9, 12, 13 or a complementary sequence thereof;

[0024] or a nucleotide sequence having at least 85% homology to the nucleotide sequence shown in any one of SEQ ID NOs. 3, 4, 7, 8, 9, 12, 13 or a complementary sequence thereof;

[0025] Or a nucleotide sequence having at least 90% homology to the nucleotide sequence shown in any one of SEQ ID NOs. 3, 4, 7, 8, 9, 12, 13 or a complementary sequence thereof.

[0026] More preferably, the sequence composition of the 5' non-coding region is as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0027] More preferably, the sequence composition of the 5' non-coding region is as shown in SEQ ID NO.7 to SEQ ID NO.9.

[0028] More preferably, the sequence composition of the 5' non-coding region is as shown in SEQ ID NO.12 and SEQ ID NO.13.

[0029] Preferably, the self-replicating RNA vector further comprises a 5' end cap, a non-structural gene, a 26S subunit group promoter, a 3' end non-coding region (3'UTR) and a polyadenylation tail.

[0030] Preferably, the self-replicating RNA is based on an engineered alphavirus genome.

[0031] More preferably, the self-replicating RNA is based on the VEEA genome.

[0032] In a preferred embodiment of the present invention, the nucleotide sequence of the self-replicating RNA vector is shown as SEQ ID NO. 17-32.

[0033] In a second aspect of the present invention, a gene delivery system is provided, which is composed of the self-replicating RNA vector and the delivery vehicle as described above, and the target gene expresses mammalian cell protein, viral protein, bacterial protein, fungal protein, protozoan protein, or parasite protein.

[0034] Preferably, the mammalian cell protein is a nucleoprotein.

[0035] Preferably, the nuclear protein is a transcription factor, and more preferably, the transcription factor is HNF4α.

[0036] Preferably, the viral protein is a coronavirus protein. More preferably, the coronavirus protein is RBD.

[0037] Preferably, the delivery vehicle is a lipid-based nanoparticle (LNP).

[0038] Preferably, the lipids include:

[0039] 1,2-distearate-sn-glycerophosphocholine, molar ratio 5%-20%;

[0040] Cholesterol, molar ratio 30%-55%;

[0041] 1,2-diacinoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000, molar ratio 0.5%-3%;

[0042] Ionizable lipids, molar ratio 30%-60%.

[0043] Preferably, the N:P ratio of the lipid-based nanoparticles ranges from 5:1 to 10:1, and the particle size of the nanoparticles is 40-300 nm.

[0044] More preferably, the lipid-based nanoparticles (LNPs) comprise an ionizable lipid (Sinobond, ALC-0315), 1,2-distearate-sn-glycerophosphocholine (DSPC) (Avanti, 850365P), cholesterol (Sigma-Aldrich, C8667) and 1,2-diacinoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (NOF, GM020).

[0045] The third aspect of the present invention provides a use of the self-replicating RNA vector or gene delivery system as described above in the preparation of drugs or vaccines for treating tumors.

[0046] Preferably, the tumor is liver cancer, pancreatic cancer, intestinal cancer, or gastric cancer.

[0047] Preferably, the vaccine is a new coronavirus vaccine.

[0048] In a fourth aspect, the present invention provides a pharmaceutical composition comprising the self-replicating RNA vector or the gene delivery system as described above.

[0049] The advantages of the present invention are:

[0050] Unlike previous approaches based solely on alphavirus-derived RNA replicons and different capping strategies, this invention modifies the VEEV TC-83 5'UTR structure to provide a novel self-replicating RNA vector compatible with multiple capping strategies and capable of mitigating innate immune responses. While maintaining the replication properties of saRNA, it also reduces saRNA cytotoxicity and maintains efficient expression. Based on the Venezuelan equine encephalitis virus (VEEV) backbone, seven 5'UTR mutants (SEQ ID NOs. 3, 4, 7, 8, 9, 12, and 13) were designed and synthesized with two different target proteins for testing. Compared with the original structure (CN116096409A / SEQ ID NO. 1), the 5'UTR mutant saRNA can reduce the expression levels of IFNβ1 and RIG-I for the target protein HNF4α (SEQ ID NOs. 3, 4, 7, and 8 decreased by 40-60%, P < 0.01), while maintaining long-term expression of HNF-4α protein. Western blotting data 3 days after transfection showed that the optimized structure can maintain high-level expression of the target protein, indicating that the 5'UTR mutant reduces the cytotoxicity of saRNA while maintaining efficient expression characteristics while maintaining the replication properties of saRNA. saRNA targeting the target protein RBD reduced IFNβ1 and RIG-I expression levels (SEQ ID NOs. 3, 4, 7, 8, 9, 12, and 13 to 20-40% of SEQ ID NO. 1, P < 0.01), while also maintaining efficient RBD protein expression. This suggests that 5'UTR mutants can reduce innate immune responses. Immunization of mice with saRNA targeting the modified 5'UTR significantly increased IgG levels (IgG titers exceeded 10^5 on day 42, compared to a maximum of 10^3.96 on day 42 for the drug cited in CN116096409A). Furthermore, RNA structure prediction (mfold) revealed that the 5'UTR of SEQ ID NO. 3 formed a stable hairpin structure (ΔG = -12.3 kcal / mol), potentially masking the immune recognition motif. In vivo experiments showed that intratumoral injection of SEQ ID NOs. 3, 4, 7, and 8 HNF4α-saRNA-LNPs (target protein HNF4α) resulted in a higher tumor inhibition rate against liver cancer cell-transplanted mice than SEQ ID NO. 1. Furthermore, intramuscular injection increased the number of negative-strand RNA copies, suggesting longer-lasting expression. Similarly, intramuscular injection of SEQ ID NOs. 3, 4, 7, 8, 9, 12, and 13 RBD-saRNA-LNPs (target protein RBD) produced higher titers of enzyme-labeled specific binding antibodies (original strain RBD) than SEQ ID NO. 1. Intramuscular injection in mice also showed an increase in negative-strand RNA copies, suggesting longer-lasting expression, which was also correlated with the production of higher titers of IgG-binding antibodies in the animals.

[0051] In summary, the present invention modulates the 5'UTR by inserting a G-rich region into the 5'UTR, which can regulate the innate immune response of saRNA and provide a new strategy for the development of low-toxic and high-efficiency gene therapy vectors. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 . Schematic diagram of saRNA plasmid structure.

[0053] Figure 2 .eq lead1-13 Agarose gel electrophoresis of in vitro transcribed HNF4α-saRNA with different 5'UTRs.

[0054] Figure 3 . HNF-4α protein expression level after cells were transfected with HNF-4α-saRNA with Seq lead 1~13 structures (Day 1).

[0055] Figure 4 Agarose gel electrophoresis of HNF4α-saRNA transcribed in vitro with different 5'UTRs of Seq1-8.

[0056] Figure 5 Agarose gel electrophoresis of in vitro transcribed RBD-saRNA with different 5'UTRs of Seq1-8.

[0057] Figure 6 . HNF-4α protein expression level after cells were transfected with HNF-4α-saRNA-LNP with Seq1-8 structure (Day 1 and Day 3).

[0058] Figure 7 . RBD protein expression level after cells were transfected with RBD-saRNA-LNP of Seq1-8 structure (Day1 and Day3).

[0059] Figure 8 Cytoscopy images of cells after transfection with HNF-4α-saRNA-LNP of Seq1-8 structure (Day 1 and Day 3).

[0060] Figure 9 Cytoscopy images of cells after transfection with RBD-saRNA-LNP of Seq1-8 structure (Day 1 and Day 3).

[0061] Figure 10 Inflammatory factors (293T cells) after cells were transfected with 5'UTR HNF4α-saRNA-LNP.

[0062] Figure 11. Inflammatory factors after 5'UTR RBD-saRNA transfection of cells (293T cells).

[0063] Figure 12 . Positive strand genomic copy number in muscle for HNF4a-saRNA-LNP of different structure 5'UTR.

[0064] Figure 13 . Positive strand genomic copy number in muscle for RBD-saRNA-LNP of different structure 5'UTR.

[0065] Figure 14 . Negative strand genomic copy number in muscle for HNF4a-saRNA-LNP of different structure 5'UTR.

[0066] Figure 15 . Negative strand genomic copy number in muscle for RBD-saRNA-LNP of different structure 5'UTR.

[0067] Figure 16 . Growth curve of subcutaneous xenografts in mice inoculated with HNF4a-saRNA-LNP of different structure 5'UTR.

[0068] Figure 17 . D5 tumor weight of subcutaneous xenografts in mice injected intratumorally with HNF4a-saRNA-LNP of different structure 5'UTR.

[0069] Figure 18 . IgG antibody in serum of RBD-saRNA-LNP immunized mice detected by Elisa. DETAILED DESCRIPTION

[0070] The specific embodiments of the present application provided in the following examples will be described in detail. The advantages and features of the present application will become more apparent with the description. However, these examples are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications and replacements all fall within the protection scope of the present application.

[0071] Unless otherwise described, the examples of the present application will employ conventional techniques of molecular biology, cell biology and immunology, which are known to those skilled in the art. These techniques are fully described in the following documents: for example, Molecular Cloning: A Laboratory Manual, 4th Edition (2017); Short Protocols in Cell Biology: A Compendium of Methods from Tissue Culture to Neuron Electrophysiology (2007); Short Protocols in Immunology: A Compendium of Methods from Tissue Culture to Neuron Electrophysiology (2010). Alternatively, they can be performed according to the instructions provided by the reagent manufacturers.

[0072] Unless otherwise indicated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0073] Example:

[0074] 1. Experimental methods:

[0075] Initial screening of lead sequences Seq lead1-13 and confirmation of protein expression levels in cells with different saRNA structures.

[0076] 1. Construction of plasmids for saRNAs with different 5'UTR structures (Seq lead 1-13):

[0077] The saRNA backbone is derived from an engineered alphavirus (VEEV) genome, which contains genes encoding nonstructural proteins that enable RNA replication. The structural protein sequences are replaced by the target gene (GOI) sequence. The saRNA sequence consists of a 5' cap, a 5' untranslated region (UTR), four nonstructural genes (NSP1-4), a 26S subunit promoter, the target gene (GOI) HNF4α, a 3' untranslated region (UTR), and a polyadenylation tail. The original plasmid sequence was synthesized by an external company. A point mutagenesis kit (Yisheng, 11003ES10) was used to construct plasmids containing saRNAs with different 5' UTRs. The plasmids were then transformed into DH5-a competent cells (Yisheng, 11802ES80). After sequencing, the cells were maintained for subsequent testing.

[0078] The HNF4α, GENBANK No.: NM_000457.6, has a nucleotide sequence as shown in Seq-9 (SEQ ID NO.14).

[0079] 2. Preparation of saRNA with different 5'UTR structures:

[0080] saRNA production begins with a linear template. To prepare the linear template for saRNA transcription, plasmid DNA was restriction digested with BspQI (New England Biolabs, R0712L) and purified using the PureLink® PCR Purification Kit (Invitrogen, K310002). Transcription was performed using a mixture of T7 RNA polymerase (Promega, P1300), 1000 U / ml RNase inhibitor (New England Biolabs, M0314L), 2 U / ml inorganic pyrophosphatase (New England Biolabs, M2403L), 5 mM NTPs (New England Biolabs, N0466S), and a cap analog (Shenji, 5011). The mixture was incubated at 37°C for 2 hours to perform in vitro transcription. Following the completion of the transcription reaction, DNase I (1 U / μg DNA) was added and incubated at 37°C for 30 minutes to remove the DNA template. The transcribed RNA was then purified and recovered by LiCl precipitation. Seq leads 1-6 were prepared using a two-step capping reaction using vaccinia virus capping enzyme. Seq leads 7-13 were prepared using a one-step capping method using cap analogs for co-transcription. The saRNAs for Seq leads 1-13 (targeting HNF4α) were obtained as follows:

[0081] 3. Detection of target protein expression after transfection of saRNA with different 5'UTR structures into cells using transfection reagents:

[0082] Huh7 hepatoma cells were cultured at 3×10 5 Cells were seeded into 6-well plates and cultured overnight. SaRNAs targeting different 5'UTRs were diluted in Opti-MEM and mixed with Lipo-3000 (Thermo) transfection reagent. After 6 hours of culture, 1 mL of DMEM medium supplemented with 20% FBS was added. On the first day, transfected cells were harvested using RIPA buffer for protein extraction, and intracellular HNF4α protein expression was assessed by Western blot.

[0083] 4. Through the screening of pilot experiments, Seq2-8 were selected as shown in Table 2. The cytotoxicity, target protein expression in vitro and in vivo effects were further evaluated to confirm the effect of the modification. Construction of plasmids with different 5'UTR structures and carrying two target genes:

[0084] The saRNA backbone is derived from an engineered alphavirus (VEEV) genome, which contains genes encoding non-structural proteins that enable RNA replication, while the structural protein sequences are replaced by the target gene (GOI) sequence. The saRNA sequence structure includes a 5' cap, a 5' UTR, four non-structural genes (NSP1-4), a 26S subunit group promoter, and the target genes (GOI) are HNF4α, the original strain RBD of the new coronavirus, a 3' UTR, and a polyadenylation tail. The original plasmid sequence was synthesized by an external company. A point mutagenesis kit (Yisheng, 11003ES10) was used to construct plasmids with different 5'UTR saRNAs on the original plasmid by point mutagenesis. The plasmids were then transformed into DH5-a competent cells (Yisheng, 11802ES80) to synthesize different target gene sequences. The restriction endonucleases ApaI and NotI were used for double enzyme digestion and molecular cloning. The different target gene fragments were ligated to vectors containing different 5'UTR saRNAs using T4 ligase. The resulting fragments were then transformed into DH5-a competent cells (Yisheng, 11802ES80). After correct sequencing, the cells were incubated for subsequent testing.

[0085] The HNF4α has a GENBANK number of NM_000457.6 and a nucleotide sequence as shown in SEQ ID NO.14.

[0086] The RBD has a GENBANK number of OP896053.1 and a nucleotide sequence as shown in SEQ ID NO. 15.

[0087] 5. Preparation of saRNA with different 5'UTR structures:

[0088] Preparation of saRNA starts from linear template. To prepare linear template for saRNA transcription, plasmid DNA was digested with BspQI enzyme (New England Biolabs, R0712L) and purified with PureLink PCR Purification Kit (Invitrogen, K310002). T7 RNA polymerase (Promega, P1300), 1000 U / ml RNase inhibitor (New England Biolabs, M0314L), 2 U / ml Inorganic Pyrophosphatase (New England Biolabs, M2403L), 5 mM NTPs (New England Biolabs, N0466S), cap analog (Shengji, 5011) were mixed to prepare transcription mixture. The mixture was incubated at 37°C for 2 hours for in vitro transcription of the template. After the transcription reaction, DNase I (1 U / μg DNA) was added and incubated at 37°C for 30 minutes to remove the DNA template. Then the obtained RNA was purified using LiCl precipitation method. Seq-1, Seq-2, Seq-3 were prepared by two-step capping reaction using vaccinia virus capping enzyme. Seq-4, Seq-5, Seq-6, Seq-7, Seq-8 were prepared by one-step capping reaction using cap analog co-transcription method. Thus, saRNA of Seq-1~Seq-8 (target protein HNF4a) and saRNA of Seq-1~Seq-8 (target protein novel coronavirus original strain RBD) were obtained:

[0089] Seq-12: HNF4a saRNA sequence of Seq-1 5’UTR (SEQ ID NO. 17)

[0090] Seq-13: HNF4a saRNA sequence of Seq-2 5’UTR (SEQ ID NO. 18)

[0091] Seq-14: HNF4a saRNA sequence of Seq-3 5’UTR (SEQ ID NO. 19)

[0092] Seq-15: HNF4a saRNA sequence of Seq-4 5’UTR (SEQ ID NO. 20)

[0093] Seq-16: HNF4a saRNA sequence of Seq-5 5’UTR (SEQ ID NO. 21)

[0094] Seq-17: Seq-6 5'UTR HNF4α saRNA sequence (SEQ ID NO. 22)

[0095] Seq-18: HNF4α saRNA sequence of Seq-7 5'UTR (SEQ ID NO. 23)

[0096] Seq-19: HNF4α saRNA sequence of Seq-8 5'UTR (SEQ ID NO. 24)

[0097] Seq-20: Seq-1 5'UTR RBD saRNA sequence (SEQ ID NO. 25)

[0098] Seq-21: Seq-2 5'UTR RBD saRNA sequence (SEQ ID NO. 26)

[0099] Seq-22: Seq-3 5'UTR RBD saRNA sequence (SEQ ID NO. 27)

[0100] Seq-23: Seq-4 5'UTR RBD saRNA sequence (SEQ ID NO. 28)

[0101] Seq-24: Seq-5 5'UTR RBD saRNA sequence (SEQ ID NO. 29)

[0102] Seq-25: Seq-6 5'UTR RBD saRNA sequence (SEQ ID NO. 30)

[0103] Seq-26: Seq-7 5'UTR RBD saRNA sequence (SEQ ID NO. 31)

[0104] Seq-27: Seq-8 5'UTR RBD saRNA sequence (SEQ ID NO. 32).

[0105] 6. LNP-encapsulated saRNAs with different 5'UTR structures:

[0106] Lipid nanoparticles were synthesized by rapid mixing of ethanolic and aqueous phases in a microfluidic device (Nanofluidics). The aqueous phase contained purified saRNA in 50 mM citrate buffer (pH 5.5). The ethanolic phase contained an ionizable lipid (CynoBonfer, ALC-0315), 1,2-distearoyl-sn-glycerophosphocholine (DSPC) (Avanti, 850365P), cholesterol (Sigma-Aldrich, C8667), and 1,2-diasuccinoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DMG-PEG 2000) (NOF, GM020). mRNA-LNPs were assembled using a molar ratio of 9.4:42.5:1.8:46.3 (DSPC:cholesterol:DMG-PEG 2000:ALC-0315), with an N / P ratio of 6. The saRNA-LNPs formed by this formula were tested for particle size, PDI, saRNA concentration and encapsulation rate.

[0107] 7. Detection of target protein expression and examination of cell status after transfection of cells with saRNA-LNPs of different 5'UTR structures:

[0108] Huh7 hepatoma cells were cultured at 3×10 5 Cells were seeded into 6-well plates and cultured overnight. SaRNA-LNPs with different 5'UTRs were added, diluted in Opti-MEM. After 6 hours of culture, 1 mL of DMEM medium supplemented with 20% FBS was added. On days 1 and 3 after transfection, proteins were harvested using RIPA lysis buffer and analyzed by Western blot for intracellular RBD or HNF4α protein expression. Cells were photographed on days 1 and 3 after saRNA transfection to monitor their status.

[0109] 8. Detection of changes in inflammatory factors after transfection of cells with saRNA-LNPs containing different 5'UTR structures:

[0110] 293T cells were cultured at 3 × 10 5 Cells were seeded / well into 6-well plates and cultured overnight. The cells were washed with PBS and saRNA-LNPs with different 5'UTRs were added at varying concentrations diluted in Opti-MEM. After 6 hours of culture, 1 mL of DMEM medium supplemented with 20% FBS was added. Twenty-four hours after transfection, cells were harvested and RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). RNA was reverse-transcribed into cDNA and quantitative PCR was used to analyze the expression of innate immune response-related genes, such as IFNβ1 and RIG-I.

[0111] qPCR primers are as follows:

[0112] GAPDH-F primer: 5'-GCACCGTCAAGGCTGAGAAC-3' (SEQ ID NO.33)

[0113] GAPDH-R primer: 5'-GCCTTCTCCATGGTGGTGAA-3' (SEQ ID NO.34)

[0114] IFNβ1-F primer: 5'-GCTTGGATTCCTACAAAGAAGCA-3' (SEQ ID NO.35)

[0115] IFNβ1-R primer: 5'-ATAGATGGTCAATGCGGCGTC-3' (SEQ ID NO.36)

[0116] RIG-IF primer: 5'-TGGCATATTGACTGGACGTG-3' (SEQ ID NO.37)

[0117] RIG-IR primer: 5'-AGGATGACAAGATTGCACTG-3' (SEQ ID NO.38)

[0118] 9. After intramuscular injection of saRNA-LNPs with different 5'UTR structures into mice, tissues at the inoculation site were collected to test the replication efficiency of self-replicating RNA:

[0119] During the replication process, saRNA uses the positive-strand genome as a template to replicate the negative-strand genome, and then uses the negative-strand genome as a template to replicate a new positive-strand genome. If the presence of the negative-strand genome can be detected, it can be proved that srRNA is continuously replicating, thereby maintaining the continued existence of srRNA.

[0120] Experiment 1: saRNA-LNPs (SEQ ID NOs. 17-21, target protein HNF4α) with different 5'UTR structures (Seq-1 to Seq-5 in Table 2) were injected into mice to detect the translation and replication efficiency of self-replicating RNA in vivo: A total of 45 C57BL / 6 mice were divided into 5 groups, with 9 mice in each group; each mouse was injected with 3 μg of saRNA-LNPs of Seq1 to 5 on day 0.

[0121] Experiment 2: saRNA-LNPs (SEQ ID NOs. 25-32, target protein 2019-nCoV RBD) with different 5'UTR structures (Seq-1 to Seq-8 in Table 2) were injected into mice to detect the translation and replication efficiency of self-replicating RNA in vivo: A total of 72 C57BL / 6 mice were divided into 8 groups, with 9 mice in each group; each mouse was injected with 3 μg of saRNA-LNPs of Seq1 to 8 on day 0.

[0122] On days 1, 3, and 7 after injection, muscle tissue was collected from the injection site of the mice. After tissue grinding, RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). RNA was reverse transcribed. Two reverse transcription sets were performed for each sample: one using SRT as a reverse transcription primer to obtain cDNA from the positive-strand srRNA genome in total RNA; the other using ART as a reverse transcription primer to obtain cDNA from the negative-strand srRNA genome in total RNA. After reverse transcription into cDNA, the saRNA genome copy number was determined by quantitative PCR.

[0123] The reverse transcription primers are as follows:

[0124] Forward strand specific primer (SRT): 5'-TACTGCCTTGCACAGCTC -3' (SEQ ID NO. 39)

[0125] Minus strand specific primer (ART): 5'-CAGGTCACTGATAATGACC -3' (SEQ ID NO. 40)

[0126] 10. Intratumoral injection of HNF4α-saRNA-LNP (target protein HNF4α) with different 5'UTR structures and subcutaneous tumor inhibition experiments in mice:

[0127] To evaluate the in vivo efficacy of saRNA-LNPs with different 5'UTR structures (Seq-1 to Seq-5 in Table 2), five saRNA-LNPs expressing the target protein HNF4α (Seq-12 to Seq-16, SEQ ID NOs. 17-21) were injected intratumorally into nude mice bearing subcutaneous liver tumors (Huh7). The animals were 6-8 week old male nude mice (BALB / c immunodeficient strain) purchased from Shanghai BK / KY Biotechnology Co., Ltd. and housed in a specific pathogen-free environment with a 12-hour on-off light cycle. 1×10 6 Huh-7 cells were subcutaneously injected into the right axilla of male nude mice. Tumor size was measured in two dimensions using a vernier caliper, and volume was calculated using the following formula: Volume = length × (width) 2× 1 / 2. When the average tumor volume reaches about 100mm 3 Mice were randomly divided into six groups (six animals per group). They were administered with a dose of 10 μg / 100 μl saline (Seq 1–5) and 100 μl saline (vehicle control). Tumor volumes were measured before dosing (D0) and on D1, D2, and D4 after dosing, and tumor growth curves were plotted. On day 5 after injection, mice were sacrificed, and tumors were excised and weighed. Tumor inhibition rates were also calculated.

[0128] 11. Study on humoral immune response in mice injected with RBD-saRNA-LNP (target protein RBD of the original strain of novel coronavirus) with different 5'UTR structures:

[0129] To evaluate the in vivo efficacy of saRNA-LNPs (Seq-20 to Seq-27, SEQ ID NOs. 25-32) with different 5'UTR structures (Seq-1 to Seq-8 in Table 2), eight saRNA-LNPs expressing the target protein RBD were injected intramuscularly into BALB / c mice. Six- to eight-week-old female BALB / c mice were purchased from Shanghai BK / KY Biotechnology Co., Ltd. and housed in a specific pathogen-free environment with a 12-hour on-off light cycle. After acclimation, mice were injected intramuscularly with 5 μg / 100 μL of saRNA LNPs and 100 μL of saline (vehicle control) twice, 35 days after immunization. Blood was collected 7 days after the final injection. Serum samples were processed and assayed for IgG antibody levels produced by immunization using ELISA.

[0130] 2. Experimental results:

[0131] Initial screening of lead sequences Seq lead1-13, confirmation of protein expression levels of self-replicating RNAs with different 5U structures in cells.

[0132] 1. The self-replicating RNA plasmid structure used in this example is as follows Figure 1 As shown, it contains a 5' cap, 5' UTR nonstructural proteins 1-4 (NSP 1-4), a subgenomic promoter (sgp), a foreign gene insertion region (GOI), a 3' UTR, and a polyadenylation tail. This study used saRNA expressing hepatocyte nuclear factor 4α as a pilot model to evaluate in vitro protein expression of self-replicating RNA with different 5' UTRs. Different 5' UTR sequences were constructed into plasmids through point mutagenesis. After sequencing was confirmed, plasmids were amplified and glycerol bacteria were inoculated into culture medium at a 1:1000 ratio and cultured overnight at 37°C. The desired plasmid was then extracted using a plasmid extraction kit.

[0133] 2. Preparation of self-replicating RNA:

[0134] The plasmid was linearized using BspQI restriction endonuclease according to the recommended system. The linearized template was recovered by PCR purification kit and synthesized saRNA by in vitro transcription. The quality of the synthesized saRNA was tested by agarose gel electrophoresis. The test results were as follows: Figure 2 The synthesized self-replicating RNA bands were of the correct size, and the purity of the saRNAs with 13 different 5'UTRs was similar, all meeting the requirements of subsequent experiments.

[0135] 3. Detection of protein expression after transfection of cells with different 5'UTR saRNA structures:

[0136] Huh-7 liver cancer cells were transfected with Seq lead1-13 HNF4α-saRNA using a transfection reagent. Protein samples were collected using RIPA lysis buffer on D1, and the protein level of HNF4α in the cells was detected by Western blot. Figure 3 ), compared with the original self-replicating RNA sequence vector, it can be seen that the expression level of HNF4α-saRNA target protein in Seq lead 3, 4, 7, 8, 9, 12, and 13 structures is higher, so these sequence vectors were selected and renamed Seq2-8 (Table 2).

[0137] The optimized Seq2-8 further confirmed the safety and effectiveness of the self-replicating RNA after the modified UTR.

[0138] 4. The self-replicating RNA plasmid structure used in this example is as follows Figure 1 As shown, it contains a 5' cap, 5' UTR nonstructural proteins 1-4 (NSP 1-4), a subgenomic promoter (sgp), a foreign gene insertion region (GOI), a 3' UTR, and a polyadenylation tail. This study used saRNA expressing hepatocyte nuclear factor 4α and the RBD of the original novel coronavirus strain as models to evaluate self-replicating RNAs with different 5' UTRs. Different 5' UTR sequences were constructed into plasmids through point mutagenesis. After correct sequencing, plasmids were amplified and glycerol bacteria were inoculated into culture medium at a 1:1000 ratio and cultured overnight at 37°C. The desired plasmid was then extracted using a plasmid extraction kit.

[0139] 5. Preparation of self-replicating RNA:

[0140] The plasmid was linearized using BspQI restriction endonuclease according to the recommended system. The linearized template was recovered by PCR purification kit and synthesized saRNA by in vitro transcription. The quality of the synthesized saRNA was tested by agarose gel electrophoresis. The test results were as follows: Figure 4 、 Figure 5The size of the synthesized self-replicating RNA band was correct, and the purity of the saRNAs of 8 different 5'UTRs of 2 GOIs was close, which met the requirements of subsequent experiments.

[0141] 6. LNP encapsulated saRNA with different 5'UTR structures:

[0142] saRNA was mixed with a liposome solution using a microfluidic device. sRNA-LNPs were assembled using a molar ratio of 9.4:42.5:1.8:46.3 (DSPC: cholesterol: DMG-PEG 2000: LP-1), with an N / P ratio of 6. After lipid nanoparticle synthesis, the encapsulation solution was displaced into formulation buffer by dialysis (100 kD). After dialysis, the LNPs were characterized. Ribogreen was used to determine the encapsulation efficiency and RNA concentration. A nanoparticle size analyzer (DLS principle) was used to determine the particle size and PDI (Phys-Dispersity Index). The results are shown in Tables 3 and 4. All eight saRNAs for the two GOIs prepared formed lipid nanoparticles that met the requirements. After dialysis, the particle size was 60-70 nm, the PDI was <0.3, the concentration was 100 ± 10%, and the encapsulation efficiency was >95%, meeting the requirements for subsequent cell and animal evaluations and demonstrating good drug consistency.

[0143] Table 3. Particle size, PDI, concentration, and encapsulation rate of Seq12-19 different 5'UTR HNF4α-saRNA-LNPs after dialysis

[0144]

[0145] Table 4. Particle size, PDI, concentration, and encapsulation rate of Seq20-27 different 5'UTR RBD-saRNA-LNPs after dialysis

[0146]

[0147] 7. Detection of protein expression and observation of cell status after transfection of cells with different 5'UTR saRNA-LNP structures:

[0148] Huh-7 liver cancer cells were transfected with Seq1-8 HNF4α-saRNA-LNP (Seq12-19) on D1 and D3, and protein samples were collected using RIPA lysis buffer. The protein level of HNF4α in the cells was detected by Western blot ( Figure 6 ), it can be seen that the expression level of the target protein of HNF4α-saRNA-LNP (Seq13-19) with Seq2~8 structures is high, and it is still highly expressed at D3, indicating that the protein expression is maintained for a long time. The morphological observation of cells transfected with different HNF4α-saRNA-LNPs before sampling ( Figure 8 ) It can be seen that cells showed a large range of apoptosis on the third day after transfection with Seq1 HNF4α-saRNA-LNP, indicating that it has stronger cytotoxicity, while other structures showed weaker cytotoxicity after transfection. This result showed a certain correlation with the protein expression level of HNF4α.

[0149] Huh-7 liver cancer cells were transfected with Seq1-8 RBD-saRNA-LNP (Seq20-27) on D1 and D3, and protein samples were collected using RIPA lysis buffer. The protein level of RBD in the cells was detected by Western blot ( Figure 7 ), it can be seen that the expression level of the target protein of Seq2~8 structure RBD-saRNA-LNP (Seq21-27) is high, and it is still highly expressed at D3, which shows that the protein expression lasts for a long time. From the morphological observation of cells transfected with different RBD-saRNA-LNPs before sampling ( Figure 9 ) It can be seen that cells showed a large range of apoptosis on the third day after transfection with Seq-1 RBD-saRNA-LNP, indicating that it has stronger cytotoxicity, while other structures showed weaker cytotoxicity after transfection. This result showed a certain correlation with the protein expression level of RBD.

[0150] 8. Results of inflammatory factor level detection after cell transfection with different 5'UTR saRNA-LNP structures:

[0151] Cells were transfected with HNF4α-saRNA-LNP from Seq1 to 8 (Seq12-19, target protein HNF4α) for 24 h and then collected using the MolPure® Cell RNA Kit (Yisheng, 19231ES50) to extract RNA. RNA was then reverse transcribed into cDNA and quantitative PCR was used to detect the levels of innate immune response-related genes IFNβ1 and RIG-I. Each sample was repeated three times. The test results are shown in the table. Figure 10 The results show that after Seq-1 HNF4α-saRNA-LNP transfection of cells, it will stimulate a higher innate immune response, while the levels of inflammatory factors induced by Seq2~Seq8 are lower.

[0152] Cells were transfected with RBD-saRNA-LNPs from Seq1 to 8 (Seq20-27, target protein RBD) for 24 h and collected using the MolPure® Cell RNA Kit (Yisheng, 19231ES50) to extract RNA. RNA was reverse transcribed into cDNA and quantitative PCR was used to detect the levels of innate immune response-related genes IFNβ1 and RIG-I. Each sample was repeated three times. The test results are shown in the table. Figure 11The results show that after Seq-1 RBD-saRNA-LNP transfection of cells, it will stimulate a higher innate immune response, while the levels of inflammatory factors induced by Seq2~Seq8 are lower.

[0153] 9. After intramuscular injection of saRNA-LNPs with different 5'UTR structures into mice, tissues at the inoculation site were collected to test the replication efficiency of self-replicating RNA. Results:

[0154] A total of 45 C57BL / 6 mice were divided into 5 groups, with 9 mice in each group; each mouse was injected with 3 μg of saRNA-LNP of Seq1~5 (Seq12-16, target protein HNF4α). On the 1st, 3rd, and 7th days after injection, the muscle tissue of the injection site of the mice was collected. After the tissue was ground, RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). The RNA was reverse transcribed. Two sets of reverse transcription were performed for each sample. One set used SRT as the reverse transcription primer to obtain cDNA of the srRNA positive-strand genome in the total RNA; the other set used ART as the reverse transcription primer to obtain cDNA of the srRNA negative-strand genome in the total RNA. After reverse transcription into cDNA, quantitative PCR was used to detect the saRNA genome copy number. The results of the positive and negative-strand genome copy numbers are shown in the table. Figure 12 , Figure 14 The saRNA was injected into mice intramuscularly, and the levels of negative-strand genomes at the injection site were detected. Seq2-5 saRNAs were found to have higher levels of negative-strand genes on days 3 and 5, indicating that these saRNAs had better replication persistence than the original sequence Seq-1.

[0155] A total of 72 C57BL / 6 mice were divided into 8 groups, with 9 mice in each group; each mouse was injected with 3 μg of saRNA-LNP of Seq1~8 (Seq20-27, target protein RBD). On the 1st, 3rd, and 7th day after injection, the muscle tissue of the injection site of the mice was collected. After the tissue was ground, RNA was extracted using the MolPure® Cell RNA Kit (Yisheng, 19231ES50). The RNA was reverse transcribed. Two sets of reverse transcription were performed for each sample. One set used SRT as the reverse transcription primer to obtain cDNA of the srRNA positive-strand genome in the total RNA; the other set used ART as the reverse transcription primer to obtain cDNA of the srRNA negative-strand genome in the total RNA. After reverse transcription into cDNA, quantitative PCR was used to detect the copy number of the saRNA genome. The results of the positive and negative-strand genome copy numbers are shown in the table. Figure 13 , Figure 15The saRNA was injected into mice by intramuscular injection, and the levels of negative-strand genomes at the injection site were detected. Among them, saRNAs of Seq2~8 could be detected at higher levels of negative-strand genes on the 3rd and 5th days, indicating that these saRNAs have better replication persistence than the original sequence Seq-1.

[0156] 10. Results of the subcutaneous tumor inhibition experiment in mice injected with HNF4α-saRNA-LNPs with different 5'UTR structures:

[0157] SaRNA-LNPs (Seq12-16, target protein HNF4α) with different 5'UTR structures (Seq-1 to Seq-5 in Table 2) were injected into tumor-bearing mice. Subcutaneous tumor volume was measured after injection, and tumor growth curves were plotted (see Figure 16 ). Five days after saRNA injection, the mice were sacrificed, and the tumors were removed and weighed. Figure 17 The tumor inhibition rate was also calculated, as shown in Table 5. The results showed that intratumoral injection of saRNA-LNPs from Seq1 to 5 slowed tumor growth, with tumor inhibition rates exceeding 50%. Seq-1 had a relatively weak inhibitory effect on tumor growth, while saRNAs from Seq2 to Seq5 all showed a significantly better inhibition rate. These results suggest that saRNAs from Seq2 to Seq5 should be able to effectively induce more sustained HNF-4α expression in vivo, thereby inhibiting the growth of liver cancer implants in mice.

[0158] Table 5 Tumor inhibition rate of subcutaneous tumors implanted in mice after intratumoral injection of HNF4α-saRNA-LNP with different 5'UTR structures

[0159] Tumor inhibition rate (TGI) = (1-tumor weight of experimental group / tumor weight of control group) × 100%

[0160]

[0161] 11. Study on humoral immune response in mice injected with RBD-saRNA-LNPs with different 5'UTR structures:

[0162] To evaluate the in vivo immunization efficacy of RBD-saRNA-LNPs (Seq20-27, target protein RBD) with different 5'UTR structures (Seq-1 to Seq-8 in Table 2), eight RBD-saRNA-LNPs expressing the target protein RBD were injected intramuscularly into BALB / c mice. Immunizations were performed twice, with a 35-day interval between immunizations. Blood samples were collected before the second injection (D35) and on day 7 after the second injection. Serum samples were processed and the levels of specific IgG antibodies (original strain RBD) produced by immunization were measured using ELISA. The results are shown in Figure 2. Figure 18 The results showed that intramuscular injection of Seq-2 to Seq-8 RBD-saRNA-LNPs produced higher titers of enzyme-labeled specific binding antibodies (original strain RBD) than Seq-1 RBD-saRNA-LNPs, and intramuscular injection in mice showed an increase in the number of negative-strand RNA copies, indicating longer-lasting expression.

[0163] 3. Conclusion

[0164] Self-replicating RNA (saRNA) has shown promise in tumor vaccines and gene therapy due to its long-lasting protein expression, but its inherent immunogenicity and cytotoxicity limit its clinical application. This study systematically optimized the 5'UTR structure of saRNAs to balance replication efficiency and immunogenicity. Based on the Venezuelan equine encephalitis virus (VEEV) backbone, 12 5'UTR mutants (Seq lead-2 to Seq lead-13) were initially designed. Seven 5'UTR mutants (Seq-2 to Seq-8) were selected based on protein expression. Two different target proteins were synthesized and tested accordingly. Compared with the original construct, saRNAs targeting the target protein HNF4α reduced IFNβ1 and RIG-I expression by 40-60% (Seq-2 to Seq-5, P < 0.01), while maintaining efficient HNF-4α protein expression, demonstrating that 5'UTR mutants can reduce innate immune responses. saRNA targeting the target protein RBD reduced IFNβ1 and RIG-I expression (from Seq-2 to Seq-8 to 20-40% of Seq-1, P < 0.01) while maintaining efficient RBD protein expression. This also demonstrates that 5'UTR mutants can reduce innate immune responses. RNA structure prediction (mfold) also revealed that the 5'UTR of Seq-2 forms a stable hairpin structure (ΔG = -12.3 kcal / mol), potentially masking the immune recognition motif. In vivo experiments showed that intratumoral injection of Seq-2 to Seq-5 HNF4α-saRNA-LNP (targeting HNF4α) resulted in a higher tumor inhibition rate in mice with hepatocellular carcinoma cells than Seq-1. Furthermore, intramuscular injection increased negative-strand RNA copy number, suggesting longer-lasting expression. Similarly, Seq-2 to Seq-8 RBD-saRNA-LNP (target protein RBD) can produce higher titers of enzyme-labeled specific binding antibodies (original strain RBD) than Seq-1 after intramuscular injection, and the number of negative-strand RNA copies increased after intramuscular injection in mice, indicating longer-term expression, which is also related to the production of higher titers of IgG binding antibodies in the animals.

[0165] In summary, the present invention modulates the 5'UTR by inserting a G-rich region into the 5'UTR, which can regulate the innate immune response of saRNA and provide a new strategy for the development of low-toxic and high-efficiency gene therapy vectors.

[0166] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art may make various equivalent modifications or substitutions without departing from the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. A self-replicating RNA vector, characterized in that It includes a 5' non-coding region and a target gene, and the sequence of the 5' non-coding region is shown in the following general formula: [ (N1) x (N2) y ] z (N3) w ataggcggcgcatgagagaagcccagaccaattacctacccaaa, Where N1=A, x=0 or 1; N2=G, y=1; z=1-5; N3=A or G, w=0-5; and, when x=0, z=2-5.

2. The self-replicating RNA vector according to claim 1, characterized in that In the 5' non-coding region sequence, N1=A, x=1, N2=G, y=1, z=1-3, N3=A or G, and w=0-5.

3. The self-replicating RNA vector according to claim 1, characterized in that In the 5' non-coding region sequence, N1=A, x=0, N2=G, y=1, z=2 or 3, and w=0.

4. The self-replicating RNA vector according to claim 1, characterized in that The 5' non-coding region sequence is the nucleotide sequence shown in SEQ ID NO. 3 or its complementary sequence.

5. The self-replicating RNA vector according to claim 1, characterized in that The 5' non-coding region sequence is composed of the nucleotide sequence shown in SEQ ID NO. 4 or its complementary sequence.

6. The self-replicating RNA vector according to claim 1, characterized in that The 5' non-coding region sequence is composed of the nucleotide sequence shown in SEQ ID NO. 7 or its complementary sequence.

7. The self-replicating RNA vector according to claim 1, characterized in that The 5' non-coding region sequence is composed of the nucleotide sequence shown in SEQ ID NO. 8 or its complementary sequence.

8. The self-replicating RNA vector according to claim 1, wherein The 5' non-coding region sequence is composed of the nucleotide sequence shown in SEQ ID NO. 9 or its complementary sequence.

9. The self-replicating RNA vector according to claim 1, characterized in that The 5' non-coding region sequence is composed of the nucleotide sequence shown in SEQ ID NO. 12 or its complementary sequence.

10. The self-replicating RNA vector according to claim 1, characterized in that The 5' non-coding region sequence is composed of the nucleotide sequence shown in SEQ ID NO. 13 or its complementary sequence.

11. The self-replicating RNA vector according to any one of claims 1 to 10, characterized in that The self-replicating RNA vector further comprises a 5' end cap, a non-structural gene, a 26S subunit group promoter, a 3' end non-coding region and a polyadenylic acid tail.

12. The self-replicating RNA vector according to claims 1-10, characterized in that The self-replicating RNA is based on an engineered alphavirus genome.

13. The self-replicating RNA vector according to claim 10, characterized in that The self-replicating RNA is based on the VEEA genome.

14. A gene delivery system, characterized in that The gene delivery system is composed of a self-replicating RNA vector as described in any one of claims 1 to 13 carrying a target gene and a delivery vehicle, wherein the target gene expresses mammalian cell proteins, viral proteins, bacterial proteins, fungal proteins, protozoan proteins, or parasite proteins.

15. The gene delivery system according to claim 14, wherein The mammalian cell protein is a nucleoprotein.

16. The gene delivery system according to claim 15, characterized in that The nuclear protein is a transcription factor.

17. The gene delivery system according to claim 16, wherein The transcription factor is HNF4α.

18. The gene delivery system according to claim 14, wherein The viral protein is a coronavirus protein.

19. The gene delivery system according to claim 18, wherein The coronavirus protein is RBD.

20. The gene delivery system according to claim 14, characterized in that The delivery vehicle is lipid-based nanoparticles.

21. The gene delivery system according to claim 20, wherein The lipids include: 1,2-distearate-sn-glycerophosphocholine, molar ratio 5%-20%; Cholesterol, molar ratio 30%-55%; 1,2-diacinoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000], molar ratio 0.5%-3%; Ionizable lipids, molar ratio 30%-60%.

22. The gene delivery system according to claim 21, wherein The N:P ratio in the lipid-based nanoparticles ranged from 5:1 to 10:1, and the particle size of the nanoparticles was 40-300 nm.

23. Use of the self-replicating RNA vector according to any one of claims 1 to 13 or the gene delivery system according to any one of claims 14 to 22 in the preparation of a drug or vaccine for treating tumors.

24. The use according to claim 23, characterized in that The tumors are liver cancer, pancreatic cancer, intestinal cancer, and gastric cancer.

25. The use according to claim 23, characterized in that The vaccine is a coronavirus vaccine.

26. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the self-replicating RNA vector according to any one of claims 1 to 13, or the gene delivery system according to any one of claims 14 to 22.

Images