Compounds and methods for modulating angiotensinogen expression
By reducing the expression of angiotensin (AGT) RNA and proteins, compounds and pharmaceutical compositions improve the therapeutic effect of RAAS pathway-related diseases, addressing the limitations of the treatment of hypertension and RAAS pathway diseases in the prior art, especially in the treatment of refractory hypertension and renal disease.
Patent Information
- Application Number
- CN202510240799.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2021-08-11
- Filing Date
- 2021-11-18
- Publication Date
- 2025-06-10
AI Technical Summary
The prior art has limitations in the treatment of hypertension and RAAS pathway-related diseases, especially in patients with refractory hypertension and nephropathy, and certain antihypertensive drugs may impair renal function.
A compound, method and pharmaceutical composition are provided for reducing the amount or activity of angiotensin (AGT) RNA in a cell or subject and in certain embodiments reduce the expression of the AGT protein. These compounds include oligomeric compounds and modified oligonucleotides for improving diseases or symptoms associated with the RAAS pathway.
By reducing the expression of AGT RNA and proteins, compounds and pharmaceutical compositions can improve diseases or symptoms associated with the RAAS pathway, including hypertension, refractory hypertension, Marfan syndrome and nephropathy without impairing renal function.
Smart Images

Figure BDA0005294076920000211 
Figure BDA0005294076920000221 
Figure BDA0005294076920000231
Abstract
Description
[0001] Cross - Reference to Related Applications
[0002] This application is a divisional application of a Chinese patent application with application number 202180077880.0, filing date November 18, 2021, and invention title "Compounds and Methods for Modulating Angiotensinogen Expression". The original application is the Chinese national phase application of a PCT patent application with international application number PCT / US2021 / 059896. This PCT patent application claims the priority of U.S. Provisional Patent Application Serial No. 63 / 115,499 filed on November 18, 2020 and U.S. Provisional Patent Application Serial No. 63 / 232,109 filed on August 11, 2021. The entire content of each of these patent applications is hereby incorporated by reference.
[0003] Sequence Listing
[0004] This application is filed together with a sequence listing in electronic format. The sequence listing is provided in the form of a file titled 088239 - 8007CN02 - seql.xml created on February 28, 2025, with a size of 62 KB. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field
[0005] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of angiotensinogen RNA in a cell or a subject and, in some cases, reducing the amount of angiotensinogen (AGT) in a cell or a subject. Such compounds and pharmaceutical compositions can be used to ameliorate at least one symptom or sign of a disease or disorder associated with the RAAS pathway. Such diseases and disorders include hypertension, hypertensive emergencies (i.e., malignant hypertension), refractory hypertension, kidney diseases (e.g., chronic kidney disease, polycystic kidney disease), pre - eclampsia, Marfan Syndrome, stroke, heart diseases (e.g., myocardial infarction, heart failure, congestive heart failure, heart valve diseases), vascular aneurysms, abdominal aneurysms, peripheral arterial disease, organ injury, pulmonary arterial hypertension, obesity, metabolic syndrome, NASH, NAFLD, and other RAAS - related diseases, disorders, and / or afflictions or their symptoms. Background Art
[0006] Angiotensinogen (AGT), also known as SERPINA8 or ANHU, is a member of the serine protease inhibitor (serpin) family and is a component of the renin-angiotensin-aldosterone system (RAAS). It is mainly produced in the liver and released into the circulation, where renin converts it into angiotensin I. Angiotensin I is then converted into angiotensin II by angiotensin-converting enzyme (ACE). Angiotensin II is a peptide hormone that causes vasoconstriction, which can then increase blood pressure. Angiotensin II also stimulates the adrenal cortex to secrete the hormone aldosterone. Aldosterone causes the kidneys to increase the reabsorption of sodium and water, resulting in an increase in the volume of fluid in the body, which can then increase blood pressure. Overstimulation or activation of the RAAS pathway can lead to hypertension. Chronic hypertension is called hypertension. The hypertension of hypertensive subjects requires the heart to work harder to circulate blood through the blood vessels.
[0007] Hypertension remains the leading cause of death and disability due to cardiovascular disease and stroke globally. Despite extensive research and the existence of multiple effective therapeutic interventions, hypertension remains an important public health challenge in the United States (Sigmund et al., Hypertension 2020, 75:902-917). Current therapies approved for the treatment of hypertension have limitations because a large proportion of all hypertensive patients do not achieve adequate blood pressure control. For example, drugs that target parts of the renin-angiotensin system (RAS) pathway, such as ACE inhibitors and angiotensin receptor blockers (ARBs), have limited ability to inhibit the RAAS pathway (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359). Additionally, certain antihypertensive drugs (such as ACE inhibitors) are contraindicated in hypertensive patients with kidney disease because they may damage the patient's kidney function.
[0008] Therefore, there is a need to find alternative treatments that inhibit the RAAS pathway and treat hypertension. Accordingly, the goal of the present invention is to provide compounds, methods, and pharmaceutical compositions for treating such diseases. SUMMARY OF THE INVENTION
[0009] The present disclosure provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of AGT RNA in a cell or subject and, in certain embodiments, reducing the expression of AGT protein. In certain embodiments, the subject has a cardiovascular disease. In certain embodiments, the subject has hypertension. In certain embodiments, the subject has resistant hypertension. In certain embodiments, the subject has Marfan syndrome. In certain embodiments, the subject has a kidney disease. In certain embodiments, the compound useful for reducing the amount or activity of AGT RNA is an oligomeric compound. In certain embodiments, the compound useful for reducing the amount or activity of AGT RNA is a modified oligonucleotide. In certain embodiments, the compound useful for reducing the expression of AGT protein is an oligomeric compound. In certain embodiments, the compound useful for reducing the expression of AGT protein is a modified oligonucleotide.
[0010] Also provided are methods for ameliorating at least one symptom or sign of a disease or indication associated with the RAAS pathway. In certain embodiments, the disease is hypertension. In certain embodiments, the disease is resistant hypertension. In certain embodiments, the disease is Marfan syndrome. In certain embodiments, the indication is heart failure. In certain embodiments, the symptom or sign includes hypertension, hypertensive emergency (i.e., malignant hypertension), preeclampsia, stroke, heart disease (e.g., myocardial infarction, heart failure, congestive heart failure, heart valve disease), vascular aneurysm, abdominal aneurysm, organ damage, pulmonary arterial hypertension, obesity, and other diseases, conditions, and / or disorders associated with the RAAS pathway or symptoms thereof. DETAILED DESCRIPTION
[0011] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. As used herein, the singular forms include the plural unless the context clearly dictates otherwise. As used herein, "or" means "and / or" unless stated otherwise. In addition, the use of the term "including" and other forms thereof, such as "includes" and "included," is not restrictive. Similarly, unless clearly stated otherwise, terms such as "element" or "component" cover elements and components that make up a unit as well as elements and components that make up more than one sub-unit.
[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including (but not limited to) patents, patent applications, articles, books, monographs, and GenBank, ENSEMBL, and NCBI reference sequences are hereby incorporated by reference in their entirety for the portion of the document discussed herein as well as in their entirety.
[0013] Definition
[0014] Unless otherwise provided with specific definitions, the nomenclatures, procedures, and techniques used in connection with analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry as described herein are those that are well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, as well as other data, mentioned throughout this disclosure are hereby incorporated by reference in their entirety.
[0015] Unless otherwise indicated, the following terms have the following meanings:
[0016] Definition
[0017] As used herein, "2'-deoxynucleoside" means a nucleoside that includes a 2'-H (H) deoxyfuranosyl sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).
[0018] As used herein, "2'-MOE" means 2'-OCH 2 CH 2 OCH 3 group replacing the 2'-OH group of the furanosyl sugar moiety. "2'-MOE sugar moiety" means 2'-OCH 2 CH 2 OCH 3 group replacing the 2'-OH group of the furanosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety has a β-D-ribosyl configuration. "MOE" means O-methoxyethyl.
[0019] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.
[0020] As used herein, "2'-OMe" means 2'-OCH 3 group replacing the 2'-OH group of the furanosyl sugar moiety. As used herein, "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" means 2'-OCH 3 group replacing the 2'-OH group of the furanosyl sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety has a β-D-ribosyl configuration.
[0021] As used herein, "2'-OMe nucleoside" means a nucleoside comprising a 2'-OMe sugar moiety.
[0022] As used herein, "2'-substituted nucleoside" means a nucleoside comprising a 2'-substituted sugar moiety. As used herein, "2'-substitution" with respect to a sugar moiety means that the sugar moiety comprises at least one 2'-substituent that is not H or OH.
[0023] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached to the 5-position. 5-Methylcytosine is a modified nucleobase.
[0024] As used herein, "about" means within ±10% of a value. For example, if the statement "the compound affects about 70% AGT inhibition" is made, it is meant that the AGT levels are inhibited in the range of 63% to 77%.
[0025] As used herein, "administer" means to provide a pharmaceutical agent to a subject.
[0026] As used herein, "angiotensinogen" and "AGT" are used interchangeably herein. Angiotensinogen is also known as SERPINA8 and ANHU.
[0027] As used herein, "antihypertensive agent" means a drug capable of reducing blood pressure. Examples of such drugs include (but are not limited to) RAAS inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists, and vasodilators. In one example, the antihypertensive agent captopril can be used in combination with the AGT compounds described herein to treat animals suffering from or at risk of suffering from a disease, disorder, and / or condition associated with the RAAS pathway.
[0028] As used herein, "antisense activity" means any detectable and / or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, the antisense activity is a decrease in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid compared to the level of the target nucleic acid or target protein in the absence of the antisense compound.
[0029] As used herein, "antisense compound" means an oligomeric compound or oligomeric duplex capable of achieving at least one antisense activity.
[0030] As used herein, "improvement" with respect to treatment means that at least one symptom is improved relative to the same symptom in the absence of the treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of the symptom, or a delay in the onset of the symptom or a slowing of the progression of its severity or frequency. The progression or severity of an indicator can be determined by subjective or objective measures known to those of skill in the art.
[0031] As used herein, "blood pressure" refers to the pressure of the blood on the walls of the blood vessels in the circulatory system. The blood pressure of an animal is mainly caused by the beating of the heart. During each heartbeat, the blood pressure varies between a maximum (systolic) blood pressure (SBP) and a minimum (diastolic) blood pressure (DBP). The mean arterial pressure (MAP) is the average arterial pressure during the cardiac cycle. Blood pressure can be measured by a blood pressuremeter (i.e., a sphygmomanometer). The blood pressure in a normal resting state has a systolic pressure of less than 120 mmHg and a diastolic pressure of less than 80 mmHg, and is typically expressed as systolic pressure (highest reading) / diastolic pressure (lowest reading) mmHg.
[0032] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that contains a bicyclic sugar moiety.
[0033] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety that contains two rings, where the second ring is formed by a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.
[0034] As used herein, "cEt" means that the 4'-to-2' bridge replaces the 2'-OH group of the ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH 3 )-O-2', and where the methyl group of the bridge is in the S configuration. "cEt sugar moiety" is a bicyclic sugar moiety in which the 4'-to-2' bridge replaces the 2'-OH group of the ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH 3 )-O-2', and where the methyl group of the bridge is in the S configuration. "cEt" means constrained ethyl.
[0035] As used herein, "cEt nucleoside" means a nucleoside that contains a cEt sugar moiety.
[0036] As used herein, "cleavable moiety" means a bond or atomic group that cleaves under physiological conditions, such as within a cell, a subject, an animal, or a human.
[0037] As used herein, "complementary" with respect to an oligonucleotide means that when the oligonucleotide is aligned with the nucleobase sequence of another nucleic acid in an opposite orientation, at least 70% of the nucleobases of the oligonucleotide or one or more of its portions are capable of hydrogen bonding with the nucleobases of the other nucleic acid or one or more of its portions. As used herein, "complementary nucleobases" means nucleobases capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) with thymine (T), adenine (A) with uracil (U), cytosine (C) with guanine (G), and 5-methylcytosine ( m C) with guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleobase complementarity at every nucleoside. Instead, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or target nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or if the oligonucleotides have the same length, at every nucleoside.
[0038] As used herein, "conjugating group" means a moiety that is directly or indirectly attached to an oligonucleotide. Conjugating groups include a conjugating moiety and a conjugation linker that attaches the conjugating moiety to the oligonucleotide.
[0039] As used herein, "conjugation linker" means a single bond or a moiety containing at least one bond that links the conjugating moiety to the oligonucleotide.
[0040] As used herein, "conjugating moiety" means a moiety that is attached to an oligonucleotide via a conjugation linker.
[0041] As used herein, "adjacent" in the context of an oligonucleotide means nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are next to each other. For example, "adjacent nucleobases" means nucleobases that are next to each other in a sequence.
[0042] As used herein, "chiral-enriched population" means a collection of molecules having the same molecular formula, where the number or percentage of molecules in the collection that contain a specific stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the collection that would be expected to contain the same specific stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom. A chiral-enriched population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds that include modified oligonucleotides.
[0043] As used herein, "chiral control" with respect to an internucleoside linkage means that chirality is enriched for a particular stereochemical configuration at the linkage.
[0044] As used herein, "deoxy region" means a region of 5 - 12 contiguous nucleotides where at least 70% of the nucleotides are 2'-β-D-deoxynucleotides. In certain embodiments, each nucleotide is selected from 2'-β-D-deoxynucleotides, bicyclic nucleotides, and 2'-substituted nucleotides. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or internal region of a gapmer.
[0045] As used herein, "gapmer" means a modified oligonucleotide comprising an internal region located between outer regions having one or more nucleotides, having a plurality of nucleotides that support RNase H cleavage, wherein the nucleotides constituting the internal region are chemically different from the one or more nucleotides constituting the outer regions. The internal region may be referred to as the "gap", and the outer regions may be referred to as the "wings". The internal region is the deoxy region. The position of the internal region or gap refers to the sequence of nucleotides of the internal region and is counted starting from the 5'-end of the internal region. Unless otherwise indicated, "gapmer" refers to the sugar motif. In certain embodiments, each nucleotide of the gap is a 2'-β-D-deoxynucleotide. In certain embodiments, the gap contains a 2'-substituted nucleotide at the 1, 2, 3, 4, or 5 position of the gap, and the remaining nucleotides of the gap are 2'-β-D-deoxynucleotides. As used herein, the term "MOE gapmer" indicates a gapmer having a gap comprising 2'-β-D-deoxynucleotides and wings comprising 2'-MOE nucleotides. As used herein, the term "mixed wing gapmer" indicates a gapmer having wings that comprise modified nucleotides containing at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleotide linkages and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified gapmer pattern.
[0046] As used herein, "hotspot region" is a series of nucleobases on a target nucleic acid that is susceptible to a decrease in the amount or activity of an oligomeric compound-mediated target nucleic acid.
[0047] As used herein, "hybridization" means the pairing or binding of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding.
[0048] As used herein, "hypertension" or "HTN" refers to a chronic medical condition in which the blood pressure of an animal is elevated. The elevated blood pressure requires the heart to work harder to circulate blood through the blood vessels. Hypertension is said to be present if the blood pressure remains at or above 130 / 80 mmHg (stage 1) or 140 / 90 mmHg (stage 2). Hypertension is classified as primary (primary / essential) or secondary. Primary hypertension has no clear cause and is thought to be related to genetics, diet, lack of exercise, and obesity. Secondary hypertension is caused by another medical condition. Hypertension is a major risk factor for shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, vascular aneurysms (such as aortic aneurysms), peripheral arterial disease, organ damage (such as heart enlargement or hypertrophy), and other cardiovascular diseases, disorders, and / or conditions or their symptoms. Antihypertensive medications, dietary changes, and lifestyle changes can reduce hypertension and the diseases, disorders, and / or conditions associated with hypertension. Hypertension may be resistant or non-resistant to drug intervention (i.e., controllable by commercially available drug therapies).
[0049] As used herein, "internucleoside linkage" means a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced by a sulfur atom.
[0050] As used herein, "linker nucleoside" means a nucleoside that directly or indirectly attaches an oligonucleotide to a conjugating moiety. The linker nucleoside is located within the conjugating linker of the oligomeric compound. The linker nucleoside is not considered part of the oligonucleotide portion of the oligomeric compound, even if it is adjacent to the oligonucleotide.
[0051] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification (such as a substituent) that does not form a bridge between two atoms of the sugar to form a second ring.
[0052] As used herein, "mismatch" or "non-complementary" means that when a first oligonucleotide is aligned with a second oligonucleotide, the nucleobase of the first oligonucleotide is not complementary to the corresponding nucleobase of the second oligonucleotide or the target nucleic acid.
[0053] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0054] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is a moiety other than unmodified A, T, C, U, or G that is capable of pairing with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" means the order of adjacent nucleobases in a target nucleic acid or oligonucleotide, which order is independent of any sugar or internucleoside linkage modification.
[0055] As used herein, "nucleoside" means a compound or compound fragment that contains a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside that contains a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides that are joined in an adjacent sequence (i.e., there are no other nucleosides between those linked nucleosides).
[0056] As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more additional features, such as a conjugating group or a terminal group. An oligomeric compound may or may not pair with a second oligomeric compound that is complementary to the first oligomeric compound. "Single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of the oligomeric duplex can be referred to as a "duplexed oligomeric compound".
[0057] As used herein, "oligonucleotide" means a chain of linked nucleosides joined via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 - 50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.
[0058] As used herein, "organ damage" or "end-organ damage" refers to damage that occurs in a major organ supplied by the circulatory system, such as the heart (e.g., myocardial hypertrophy, cardiac hypofunction, and / or heart failure), the kidney (e.g., albuminuria, proteinuria, renal hypofunction, and / or renal failure), the eye (e.g., hypertensive retinopathy), the brain (e.g., stroke), etc. Hypertension can damage the organs of an animal. In certain embodiments, heart damage is fibrosis, cardiac cell, and / or muscle hypertrophy, resulting in cardiac enlargement.
[0059] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to a subject. Certain such carriers enable formulation of a pharmaceutical composition, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0060] As used herein, "pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of a compound. The pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart undesired toxicological effects.
[0061] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition shows activity in a free uptake assay in certain cell lines.
[0062] As used herein, "prodrug" means a therapeutic agent that is converted in a subject or its cells into a different form than its in vitro form. Typically, the conversion of the prodrug in the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cell or tissue and / or by physiological conditions.
[0063] As used herein, "reduced amount or activity" refers to a reduction or blockade of transcriptional expression or activity relative to that in an untreated sample or a control sample, and does not necessarily indicate complete elimination of transcriptional expression or activity.
[0064] As used herein, "renin-angiotensin-aldosterone system", "renin-angiotensin-aldosterone system pathway", "RAAS pathway", or "RAAS" refers to a multi-component enzymatic pathway in which a precursor component (angiotensinogen) is converted by various enzymes (e.g., renin and the enzyme angiotensin-converting enzyme (ACE)) into downstream components, such as angiotensin I and angiotensin II. Angiotensin I stimulates the secretion of the steroid aldosterone in the pathway. The RAAS pathway regulates blood pressure and fluid balance.
[0065] As used herein, "renin-angiotensin system" or "RAS" or "RAS pathway" refers to a part of the RAAS pathway. Agonists or antagonists have targeted various components of this pathway to block the production of said components. For example, renin inhibitors, ACE inhibitors, angiotensin-receptor blockers (ARBs), etc. have been developed to inhibit or block the RAS pathway. However, due to various mechanisms or adverse effects, commercially available therapies targeting various RAS pathway components are ineffective in completely inhibiting or blocking the RAS pathway (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359).
[0066] As used herein, "RAAS-related diseases, disorders, and / or conditions" or "diseases, disorders, and / or conditions related to the RAAS pathway" refers to any disease, disorder, or condition in an animal that is related to the RAAS. Examples of RAAS-related diseases, disorders, and / or conditions include shortened life expectancy, hypertension (e.g., non-resistant hypertension, resistant hypertension), kidney diseases (e.g., chronic kidney disease, polycystic kidney disease), stroke, heart diseases (e.g., myocardial infarction, heart failure, heart valve disease), vascular aneurysms (e.g., aortic aneurysm), peripheral arterial disease, organ damage (e.g., heart injury or hypertrophy), tissue fibrosis, and other cardiovascular diseases, disorders, and / or conditions or symptoms thereof. In certain embodiments, RAAS-related diseases, disorders, and / or conditions do not include hypertension.
[0067] As used herein, "resistant hypertension" or "RHTN" is defined as a) blood pressure remaining above the treatment target (usually ≥130 / 80 mmHg) despite the concurrent use of 3 or more antihypertensive agents from different drug classes and administered at maximum tolerated doses; or b) blood pressure being controlled at or below the treatment target only after administering at least 4 different classes of antihypertensive agents to achieve control.
[0068] Unless otherwise specified, as used herein, "RNA" means an RNA transcript and includes pre-mRNA and mature mRNA.
[0069] As used herein, "RNAi compound" means an antisense compound that acts at least in part via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include (but are not limited to) double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimics. In certain embodiments, the RNAi compound regulates the amount, activity, and / or splicing of the target nucleic acid. The term RNAi compound does not include antisense compounds that act via RNase H.
[0070] As used herein, "self-complementary" with respect to an oligonucleotide means that the oligonucleotide hybridizes at least in part to itself.
[0071] As used herein, "standard in vitro assay" means the assays set forth in the Examples and reasonable variations thereof.
[0072] As used herein, "standard in vivo assay" means the assays set forth in the Examples and reasonable variations thereof.
[0073] As used herein, "atropisomeric chiral center" means, in the context of a population of molecules having the same molecular formula, a chiral center having a random stereochemical configuration. For example, in a population of molecules containing an atropisomeric chiral center, the number of molecules having the (S) configuration at the atropisomeric chiral center may be the same as the number of molecules having the (R) configuration at the atropisomeric chiral center, but not necessarily so. A chiral center may be considered random when its stereochemical configuration is the result of a synthetic method not designed to control stereochemistry. In certain embodiments, the atropisomeric chiral center is an atropisomeric phosphorothioate internucleoside linkage.
[0074] As used herein, "subject" means a human or non-human animal.
[0075] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH(H)β-D-ribosyl moiety as found in RNA ("unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA ("unmodified DNA sugar moiety"). The unmodified sugar moiety has a hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar surrogate.
[0076] As used herein, "sugar surrogate" means a modified sugar moiety having a moiety other than a furanosyl moiety by which a nucleobase can be linked to another group, such as an internucleoside linkage, a conjugating group, or a terminal group in an oligonucleotide. A modified nucleoside containing a sugar surrogate can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides are capable of hybridizing to a complementary oligomeric compound or a target nucleic acid.
[0077] As used herein, "symptom" or "sign" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the sign is apparent upon performing an invasive diagnostic test including, but not limited to, a post-mortem test.
[0078] As used herein, "target nucleic acid" and "target RNA" mean a nucleic acid that an antisense compound is designed to affect.
[0079] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0080] As used herein, "terminal group" means a chemical group or moiety covalently attached to the end of an oligonucleotide.
[0081] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount ameliorates the symptoms of a disease.
[0082] Certain embodiments
[0083] The present disclosure provides the following non-limiting numbered embodiments:
[0084] Embodiment 1: An oligomeric compound comprising a modified oligonucleotide composed of 14 to 30 linked nucleosides and having a nucleobase sequence of at least 14, at least 15, or 16 contiguous nucleobases comprising any one of the nucleobase sequences of SEQ ID NOs: 12 - 15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0085] Embodiment 2: An oligomeric compound comprising a modified oligonucleotide composed of 14 to 30 linked nucleosides and having a nucleobase sequence of at least 14, at least 15, or at least 16 contiguous nucleobases complementary to:
[0086] An equi-length portion of nucleobases 2046 - 2061 of SEQ ID NO: 1;
[0087] An equi-length portion of nucleobases 2271 - 2286 of SEQ ID NO: 1;
[0088] An equi-length portion of nucleobases 2272 - 2287 of SEQ ID NO: 1;
[0089] Wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0090] Embodiment 3: An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:12, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0091] Embodiment 4: An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:13, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0092] Embodiment 5: An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:14, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0093] Embodiment 6: An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:15, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0094] Embodiment 7: The oligomeric compound according to any one of Embodiments 1-6, wherein when measured over the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequence of either SEQ ID NO:1 or SEQ ID NO:2.
[0095] Embodiment 8: The oligomeric compound according to any one of Embodiments 1-7, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.
[0096] Embodiment 9: The oligomeric compound according to Embodiment 8, wherein the bicyclic sugar moiety has a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH 2 -O- and -CH(CH3 )-O-.
[0097] Embodiment 10: An oligomeric compound as described in any one of Embodiments 1-9, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.
[0098] Embodiment 11: An oligomeric compound as described in Embodiment 10, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
[0099] Embodiment 12: An oligomeric compound as described in any one of Embodiments 1-11, wherein the modified oligonucleotide comprises at least one sugar surrogate.
[0100] Embodiment 13: An oligomeric compound as described in Embodiment 12, wherein the sugar surrogate is any one of morpholino, modified morpholino, PNA, THP, and F-HNA.
[0101] Embodiment 14: An oligomeric compound as described in any one of Embodiments 1-13, wherein the modified oligonucleotide is a gapmer.
[0102] Embodiment 15: An oligomeric compound as described in Embodiment 14, wherein the modified oligonucleotide has a sugar motif comprising:
[0103] A 5' region consisting of 1-6 linked 5'-region nucleosides;
[0104] A central region consisting of 6-10 linked central-region nucleosides; and
[0105] A 3' region consisting of 1-6 linked 3'-region nucleosides; wherein
[0106] each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety, and at least 6 of the central-region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
[0107] Embodiment 16: An oligomeric compound as described in Embodiment 14, wherein the modified oligonucleotide has a sugar motif comprising:
[0108] A 5' region consisting of 1-6 linked 5'-region nucleosides;
[0109] A central region consisting of 6-10 linked central-region nucleosides; and
[0110] A 3' region consisting of 1-6 linked 3'-region nucleosides; wherein
[0111] Each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety.
[0112] Embodiment 17: The oligomeric compound according to Embodiment 14, wherein the modified oligonucleotide has a sugar motif comprising:
[0113] A 5'-region, which consists of 3 linked 5'-region nucleosides;
[0114] A central region, which consists of 10 linked central region nucleosides; and
[0115] A 3'-region, which consists of 3 linked 3'-region nucleosides; wherein
[0116] Each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a 2'-MOE sugar moiety or a sugar moiety modified with cEt, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.
[0117] Embodiment 18: The oligomeric compound according to Embodiment 14, wherein the modified oligonucleotide has a sugar motif comprising:
[0118] A 5'-region, which consists of 3 linked 5'-region nucleosides;
[0119] A central region, which consists of 10 linked central region nucleosides; and
[0120] A 3'-region, which consists of 3 linked 3'-region nucleosides; wherein
[0121] Each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a sugar moiety modified with 2'-MOE or a sugar moiety modified with cEt, and at least 6 of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
[0122] Embodiment 19: The oligomeric compound according to any one of Embodiments 1-18, wherein the modified oligonucleotide has a sugar motif selected from the following (5' to 3'): eek ddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddyddd ddddkkk, kkkdddyddddddkkk, kkkddddddddddkkk or eeeeeeddddddddd deeeee; wherein 'e' represents a 2'-MOE sugar moiety, 'k' represents a cEt sugar moiety, 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'y' represents a 2'-OMe sugar moiety.
[0123] Embodiment 20: An oligomeric compound as described in any one of Embodiments 1-19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
[0124] Embodiment 21: An oligomeric compound as described in Embodiment 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
[0125] Embodiment 22: An oligomeric compound as described in Embodiment 20 or Embodiment 21, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
[0126] Embodiment 23: An oligomeric compound as described in any one of Embodiments 20 and 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
[0127] Embodiment 24: An oligomeric compound as described in any one of Embodiments 20, 22, and 23, wherein each internucleoside linkage is a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0128] Embodiment 25: An oligomeric compound as described in Embodiment 21, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
[0129] Embodiment 26: An oligomeric compound as described in any one of Embodiments 1-20 or 22-24, wherein the modified oligonucleotide has an internucleoside linkage motif of soossssssssssos; wherein,
[0130] s = phosphorothioate internucleoside linkage and o = phosphodiester internucleoside linkage.
[0131] Embodiment 27: An oligomeric compound as described in any one of Embodiments 1-26, wherein the modified oligonucleotide comprises at least one modified nucleobase.
[0132] Embodiment 28: An oligomeric compound as described in Embodiment 27, wherein the modified nucleobase is 5-methylcytosine.
[0133] Embodiment 29: An oligomeric compound as described in any one of Embodiments 1-28, wherein the modified oligonucleotide is composed of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, or 16-20 linked nucleosides.
[0134] Embodiment 30: An oligomeric compound as described in any one of Embodiments 1-28, wherein the modified oligonucleotide consists of 16 linked nucleosides.
[0135] Embodiment 31: An oligomeric compound as described in any one of Embodiments 1-30, the oligomeric compound comprising a conjugating group.
[0136] Embodiment 32: The oligomeric compound as described in Embodiment 31, wherein the conjugating group comprises a GalNAc cluster containing 1-3 GalNAc ligands.
[0137] Embodiment 33: The oligomeric compound as described in any one of Embodiments 31 and 32, wherein the conjugating group comprises a conjugation linker consisting of a single bond.
[0138] Embodiment 34: The oligomeric compound as described in any one of Embodiments 31-33, wherein the conjugating group comprises a cleavable linker.
[0139] Embodiment 35: The oligomeric compound as described in any one of Embodiments 31-34, wherein the conjugating group comprises a conjugation linker containing 1-3 linker nucleosides.
[0140] Embodiment 36: The oligomeric compound as described in any one of Embodiments 31-35, wherein the conjugating group is linked to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.
[0141] Embodiment 37: The oligomeric compound as described in any one of Embodiments 31-35, wherein the conjugating group is linked to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.
[0142] Embodiment 38: The oligomeric compound as described in any one of Embodiments 1-37, wherein the oligomeric compound is a single-stranded oligomeric compound.
[0143] Embodiment 39: The oligomeric compound as described in any one of Embodiments 1-30 or 38, the oligomeric compound consisting of the modified oligonucleotide.
[0144] Embodiment 40: An oligomeric duplex comprising the oligomeric compound as described in any one of Embodiments 1-37.
[0145] Embodiment 41: An antisense compound comprising, consisting of, or consisting essentially of the oligomeric compound as described in any one of Embodiments 1-39 or the oligomeric duplex as described in Embodiment 40.
[0146] Embodiment 42: A pharmaceutical composition comprising the oligomeric compound according to any one of Embodiments 1-39 or the oligomeric duplex according to Embodiment 40 and a pharmaceutically acceptable carrier or diluent.
[0147] Embodiment 43: A compound having the following chemical structure:
[0148]
[0149] (SEQ ID NO:12), or a salt thereof.
[0150] Embodiment 44: A compound having the following chemical structure:
[0151]
[0152] (SEQ ID NO:12).
[0153] Embodiment 45: A compound having the following chemical structure:
[0154]
[0155] (SEQ ID NO:13), or a salt thereof.
[0156] Embodiment 46: A compound having the following chemical structure:
[0157]
[0158] (SEQ ID NO:13).
[0159] Embodiment 47: A compound having the following chemical structure:
[0160]
[0161] (SEQ ID NO:14), or a salt thereof.
[0162] Embodiment 48: A compound having the following chemical structure:
[0163]
[0164] (SEQ ID NO:14).
[0165] Embodiment 49: A compound having the following chemical structure:
[0166]
[0167] (SEQ ID NO:15), or a salt thereof.
[0168] Embodiment 50: A compound according to the following chemical structure:
[0169]
[0170] (SEQ ID NO:15).
[0171] Embodiment 51: A modified oligonucleotide as described in any one of Embodiments 43, 45, 47, and 49, wherein the modified oligonucleotide is a sodium or potassium salt of the chemical structure.
[0172] Embodiment 52: A pharmaceutical composition comprising the modified oligonucleotide described in any one of Embodiments 43 - 51 and a pharmaceutically acceptable carrier or diluent.
[0173] Embodiment 53: A compound comprising a modified oligonucleotide according to the following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e (SEQ ID NO:12), wherein:
[0174] A = adenine nucleobase,
[0175] m C = 5 - methylcytosine nucleobase,
[0176] G = guanine nucleobase,
[0177] T = thymine nucleobase,
[0178] e = 2'-β - D - MOE sugar moiety,
[0179] k = cEt sugar moiety,
[0180] d = 2'-β - D - deoxyribosyl sugar moiety,
[0181] s = phosphorothioate internucleoside linkage, and
[0182] o = phosphodiester internucleoside linkage.
[0183] Embodiment 54: A compound comprising a modified oligonucleotide according to the following chemical notation: T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T e (SEQ ID NO:13), wherein:
[0184] A = adenine nucleobase,
[0185] m C = 5-methylcytosine nucleobase,
[0186] G = guanine nucleobase,
[0187] T = thymine nucleobase,
[0188] e = 2'-β-D-MOE sugar moiety,
[0189] k = cEt sugar moiety,
[0190] d = 2'-β-D-deoxyribosyl sugar moiety,
[0191] s = phosphorothioate internucleoside linkage, and
[0192] o = phosphodiester internucleoside linkage.
[0193] Embodiment 55: A compound comprising a modified oligonucleotide according to the following chemical notation: G ks T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks Tks T k (SEQ ID NO:15), wherein:
[0194] A = adenine nucleobase,
[0195] m C = 5 - methylcytosine nucleobase,
[0196] G = guanine nucleobase,
[0197] T = thymine nucleobase,
[0198] k = cEt sugar moiety,
[0199] d = 2'-β - D - deoxyribosyl sugar moiety,
[0200] y = 2'-OMe ribose moiety, and
[0201] s = phosphorothioate internucleoside linkage.
[0202] Embodiment 56: A compound comprising a modified oligonucleotide according to the following chemical notation: T ks m C ko G ko G ds U ys T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T k (SEQ ID NO:14), wherein:
[0203] A = adenine nucleobase,
[0204] m C = 5 - methylcytosine nucleobase,
[0205] G = guanine nucleobase,
[0206] T = thymine nucleobase,
[0207] U = uracil nucleobase,
[0208] k = cEt sugar moiety,
[0209] d = 2'-β - D - deoxyribosyl sugar moiety,
[0210] y = 2'-OMe ribose moiety,
[0211] s = phosphorothioate internucleoside linkage, and
[0212] o = phosphodiester internucleoside linkage.
[0213] Embodiment 57: A compound as described in any one of Embodiments 53 - 56, the compound comprising the modified oligonucleotide covalently linked to a conjugating group.
[0214] Embodiment 58: A pharmaceutical composition as described in any one of Embodiments 53 - 56, and a pharmaceutically acceptable diluent or carrier.
[0215] Embodiment 59: A chiral enriched population of a modified oligonucleotide as described in any one of Embodiments 53 - 56, wherein the population is enriched in modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.
[0216] Embodiment 60: The chiral enriched population as described in Embodiment 59, wherein the population is enriched in modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.
[0217] Embodiment 61: The chiral enriched population as described in Embodiment 59, wherein the population is enriched in modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.
[0218] Embodiment 62: The chiral enriched population as described in Embodiment 59, wherein the population is enriched in modified oligonucleotides having a specifically and independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
[0219] Embodiment 63: The chiral enriched population as described in Embodiment 59, wherein the population is enriched in modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or enriched in modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.
[0220] Embodiment 64: The chiral enriched population as described in Embodiment 59, wherein the population is enriched in modified oligonucleotides having an (Rp) configuration at one specific phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
[0221] Embodiment 65: A chirally enriched population as described in Embodiment 59, wherein the population is enriched in modified oligonucleotides having at least 3 adjacent phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations in the 5' to 3' direction.
[0222] Embodiment 66: A population of modified oligonucleotides as described in any one of Embodiments 59 - 65, wherein all phosphorothioate internucleoside linkages of the modified oligonucleotides are atactic.
[0223] Embodiment 67: A method comprising administering to an individual a pharmaceutical composition as described in any of the foregoing embodiments.
[0224] Embodiment 68: A method of treating a disease associated with the RAAS pathway, the method comprising administering to an individual having or at risk of having a disease associated with the RAAS pathway a therapeutically effective amount of a pharmaceutical composition as described in any of the foregoing embodiments, thereby treating the disease associated with the RAAS pathway.
[0225] Embodiment 69: The method as described in Embodiment 68, wherein the disease is a cardiovascular disease.
[0226] Embodiment 70: The method as described in any one of Embodiments 68 and 69, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.
[0227] Embodiment 71: The method as described in any one of Embodiments 68 - 70, wherein at least one symptom or marker of the disease is improved.
[0228] Embodiment 72: The method as described in Embodiment 71, wherein the symptom or marker is any one of the following: hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, preeclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, or pulmonary hypertension.
[0229] Embodiment 73: The method as described in any one of Embodiments 67 - 72, wherein the pharmaceutical composition is administered systemically.
[0230] Embodiment 74: The method as described in any one of Embodiments 73, wherein the pharmaceutical composition is administered either subcutaneously or intramuscularly.
[0231] Embodiment 75: Use of an oligomeric compound as described in any one of Embodiments 1 - 37 or an oligomeric duplex as described in Embodiment 40 for reducing AGT expression in cells.
[0232] Embodiment 76: The use as described in Embodiment 75, wherein the level of AGT RNA is reduced.
[0233] Embodiment 77: The use as described in Embodiment 75, wherein the level of AGT protein is reduced.
[0234] Embodiment 78. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or at least 16 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 12 - 15, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0235] Embodiment 79. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or at least 16 contiguous nucleobases complementary to:
[0236] a. An equi - length portion of nucleobases 2046 - 2061 of SEQ ID NO: 1;
[0237] b. An equi - length portion of nucleobases 2271 - 2286 of SEQ ID NO: 1;
[0238] c. An equi - length portion of nucleobases 2272 - 2287 of SEQ ID NO: 1;
[0239] wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0240] Embodiment 80. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 12, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0241] Embodiment 81. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 13, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
[0242] Embodiment 82. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:14, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0243] Embodiment 83. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:15, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
[0244] Embodiment 84. The oligomeric compound according to any one of Embodiments 78 - 83, wherein when measured over the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequence of either SEQ ID NO:1 or SEQ ID NO:2.
[0245] Embodiment 85. The oligomeric compound according to any one of Embodiments 78 - 84, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.
[0246] Embodiment 86. The oligomeric compound according to Embodiment 85, wherein the bicyclic sugar moiety has a 4'-2' bridge, and the 4'-2' bridge is selected from -CH 2 -O- and -CH(CH 3 )-O-.
[0247] Embodiment 87. The oligomeric compound according to any one of Embodiments 78 - 86, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.
[0248] Embodiment 88. The oligomeric compound according to Embodiment 87, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
[0249] Embodiment 89. The oligomeric compound according to any one of Embodiments 78 - 88, wherein the modified oligonucleotide comprises at least one sugar substitute.
[0250] Embodiment 90. The oligomeric compound according to Embodiment 89, wherein the sugar substitute is any one of morpholino, modified morpholino, PNA, THP and F-HNA.
[0251] Embodiment 91. An oligomeric compound as described in any one of embodiments 78-90, wherein the modified oligonucleotide is a gapmer.
[0252] Embodiment 92. An oligomeric compound as described in any one of embodiments 78-91, wherein the modified oligonucleotide has a sugar motif comprising:
[0253] A 5' region consisting of 1-6 linked 5' region nucleosides;
[0254] A central region consisting of 6-10 linked central region nucleosides; and
[0255] A 3' region consisting of 1-6 linked 3' region nucleosides; wherein
[0256] each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and at least 6 of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
[0257] Embodiment 93. An oligomeric compound as described in any one of embodiments 78-91, wherein the modified oligonucleotide has a sugar motif comprising:
[0258] A 5' region consisting of 1-6 linked 5' region nucleosides;
[0259] A central region consisting of 6-10 linked central region nucleosides; and
[0260] A 3' region consisting of 1-6 linked 3' region nucleosides; wherein
[0261] each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety.
[0262] Embodiment 94. An oligomeric compound as described in any one of embodiments 78-91, wherein the modified oligonucleotide has a sugar motif comprising:
[0263] A 5' region consisting of 3 linked 5' region nucleosides;
[0264] A central region consisting of 10 linked central region nucleosides; and
[0265] A 3' region consisting of 3 linked 3' region nucleosides; wherein
[0266] Each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a 2'-MOE sugar moiety or a cEt sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.
[0267] Embodiment 95. An oligomeric compound as described in any one of Embodiments 78-91, wherein the modified oligonucleotide has a glycosyl motif comprising:
[0268] A 5'-region, which consists of 3 linked 5'-region nucleosides;
[0269] A central region, which consists of 10 linked central region nucleosides; and
[0270] A 3'-region, which consists of 43 linked 3'-region nucleosides; wherein
[0271] Each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a 2'-MOE-modified sugar moiety or a cEt sugar moiety, and at least 6 of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
[0272] Embodiment 96. An oligomeric compound as described in any one of Embodiments 78-95, wherein the modified oligonucleotide has a glycosyl motif (5' to 3') selected from: eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddyddddddkkk, kkkddddddddddkkk or eeeeeddddddddddeeeee; where 'e' represents a 2'-MOE sugar moiety, 'k' represents a cEt sugar moiety, 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'y' represents a 2'-OMe sugar moiety.
[0273] Embodiment 97. An oligomeric compound as described in any one of Embodiments 78-96, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
[0274] Embodiment 98. An oligomeric compound as described in Embodiment 97, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
[0275] Embodiment 99. An oligomeric compound as described in Embodiment 97 or Embodiment 98, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
[0276] Embodiment 100. An oligomeric compound as described in any one of Embodiment 97 and Embodiment 99, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
[0277] Embodiment 101. An oligomeric compound as described in any one of Embodiment 97, 99 and 100, wherein each internucleoside linkage is a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
[0278] Embodiment 102. An oligomeric compound as described in Embodiment 98, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
[0279] Embodiment 103. An oligomeric compound as described in any one of Embodiments 78-97 or 99-101, wherein the modified oligonucleotide has an internucleoside linkage motif of soossssssssssos; wherein,
[0280] s = phosphorothioate internucleoside linkage, and
[0281] o = phosphodiester internucleoside linkage.
[0282] Embodiment 104. An oligomeric compound as described in any one of Embodiments 78-103, wherein the modified oligonucleotide comprises at least one modified nucleobase.
[0283] Embodiment 105. An oligomeric compound as described in Embodiment 104, wherein the modified nucleobase is 5-methylcytosine.
[0284] Embodiment 106. An oligomeric compound as described in any one of Embodiments 78-105, wherein the modified oligonucleotide is composed of 14-30, 14-22, 14-20, 14-18, 14-20, 15-17, 15-25 or 16-20 linked nucleosides.
[0285] Embodiment 107. An oligomeric compound as described in any one of Embodiments 78-106, wherein the modified oligonucleotide is composed of 16 linked nucleosides.
[0286] Embodiment 108. An oligomeric compound as described in any one of Embodiments 78-107, the oligomeric compound comprises a conjugating group.
[0287] Embodiment 109. An oligomeric compound as described in Embodiment 108, wherein the conjugating group comprises a GalNAc cluster containing 1-3 GalNAc ligands.
[0288] Embodiment 110. An oligomeric compound as described in any one of Embodiments 108 and 109, wherein the linking group comprises a linking linker consisting of a single bond.
[0289] Embodiment 111. An oligomeric compound as described in any one of Embodiments 108 - 110, wherein the linking group comprises a cleavable linker.
[0290] Embodiment 112. An oligomeric compound as described in any one of Embodiments 108 - 111, wherein the linking group comprises a linking linker containing 1 - 3 linker nucleosides.
[0291] Embodiment 113. An oligomeric compound as described in any one of Embodiments 108 - 112, wherein the linking group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.
[0292] Embodiment 114. An oligomeric compound as described in any one of Embodiments 108 - 113, wherein the linking group is attached to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.
[0293] Embodiment 115. An oligomeric compound as described in any one of Embodiments 78 - 114, wherein the oligomeric compound is a single-stranded oligomeric compound.
[0294] Embodiment 116. An oligomeric compound as described in any one of Embodiments 78 - 107 or 115, the oligomeric compound consisting of the modified oligonucleotide.
[0295] Embodiment 117. An oligomeric compound according to the following chemical structure:
[0296]
[0297] (SEQ ID NO:12), or a salt thereof.
[0298] Embodiment 118. An oligomeric compound according to the following chemical structure:
[0299]
[0300] (SEQ ID NO:12).
[0301] Embodiment 119. An oligomeric compound according to the following chemical structure:
[0302]
[0303] (SEQ ID NO:13), or a salt thereof.
[0304] Embodiment 120. An oligomeric compound having the following chemical structure:
[0305]
[0306] (SEQ ID NO:13).
[0307] Embodiment 121. An oligomeric compound having the following chemical structure:
[0308]
[0309] (SEQ ID NO:14), or a salt thereof.
[0310] Embodiment 122. An oligomeric compound having the following chemical structure:
[0311]
[0312] (SEQ ID NO:14).
[0313] Embodiment 123. An oligomeric compound having the following chemical structure:
[0314]
[0315] (SEQ ID NO:15), or a salt thereof.
[0316] Embodiment 124. An oligomeric compound having the following chemical structure:
[0317]
[0318] (SEQ ID NO:15).
[0319] Embodiment 125. The oligomeric compound according to any one of Embodiments 117, 119, 121 or 123, wherein the oligomeric compound is a sodium salt or a potassium salt.
[0320] Embodiment 126. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m Cds m C ds G ko G ks G e (SEQ ID NO:12), wherein:
[0321] A = adenine nucleobase,
[0322] m C = 5-methylcytosine nucleobase,
[0323] G = guanine nucleobase,
[0324] T = thymine nucleobase,
[0325] e = 2'-β-D-MOE sugar moiety,
[0326] k = cEt sugar moiety,
[0327] d = 2'-β-D-deoxyribosyl sugar moiety,
[0328] s = phosphorothioate internucleoside linkage, and
[0329] o = phosphodiester internucleoside linkage.
[0330] Embodiment 127. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T e (SEQ ID NO:13), wherein:
[0331] A = adenine nucleobase,
[0332] m C = 5-methylcytosine nucleobase,
[0333] G = guanine nucleobase,
[0334] T = thymine nucleobase,
[0335] e = 2'-β-D-MOE sugar moiety,
[0336] k = cEt sugar moiety,
[0337] d = 2'-β-D-deoxyribosyl sugar moiety,
[0338] s = phosphorothioate internucleoside linkage, and
[0339] o = phosphodiester internucleoside linkage.
[0340] Embodiment 128. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G ks T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k (SEQ ID NO:15), wherein:
[0341] A = adenine nucleobase,
[0342] m C = 5-methylcytosine nucleobase,
[0343] G = guanine nucleobase,
[0344] T = thymine nucleobase,
[0345] k = cEt sugar moiety,
[0346] d = 2'-β-D-deoxyribosyl sugar moiety,
[0347] y = 2'-OMe ribose moiety, and
[0348] s = phosphorothioate internucleoside linkage.
[0349] Embodiment 129. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T ks m C ko G ko G ds U ys T ds G ds Gds A ds A ds T ds T ds m C ds T ko T ks T k (SEQ ID NO:14), wherein:
[0350] A = adenine nucleobase,
[0351] m C = 5-methylcytosine nucleobase,
[0352] G = guanine nucleobase,
[0353] T = thymine nucleobase,
[0354] U = uracil nucleobase,
[0355] k = cEt sugar moiety,
[0356] d = 2'-β-D-deoxyribosyl sugar moiety,
[0357] y = 2'-OMe ribose moiety,
[0358] s = phosphorothioate internucleoside linkage, and
[0359] o = phosphodiester internucleoside linkage.
[0360] Embodiment 130. An oligomeric compound as described in any one of Embodiments 126-129, said oligomeric compound comprising said modified oligonucleotide covalently linked to a conjugating group.
[0361] Embodiment 131. An oligomeric duplex comprising an oligomeric compound as described in any one of Embodiments 78-130.
[0362] Embodiment 132. An antisense compound comprising, consisting of, or consisting essentially of an oligomeric compound as described in any one of Embodiments 78-130 or an oligomeric duplex as described in Embodiment 131.
[0363] Embodiment 133. A chirally enriched population of an oligomeric compound as described in any one of Embodiments 117-130, wherein said population is enriched in compounds comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.
[0364] Embodiment 134. The chiral-enriched population as described in Embodiment 133, wherein the population is enriched in a compound comprising at least one specific phosphorothioate internucleoside linkage having the (Sp) configuration.
[0365] Embodiment 135. The chiral-enriched population as described in Embodiment 133, wherein the population is enriched in a compound comprising at least one specific phosphorothioate internucleoside linkage having the (Rp) configuration.
[0366] Embodiment 136. The chiral-enriched population as described in Embodiment 133, wherein the population is enriched in a compound having a specifically and independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
[0367] Embodiment 137. The chiral-enriched population as described in Embodiment 133, wherein the population is enriched in a compound having the (Sp) configuration at each phosphorothioate internucleoside linkage or a modified oligonucleotide having the (Rp) configuration at each phosphorothioate internucleoside linkage.
[0368] Embodiment 138. The chiral-enriched population as described in Embodiment 133, wherein the population is enriched in a compound having the (Rp) configuration at one specific phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
[0369] Embodiment 139. The chiral-enriched population as described in Embodiment 133, wherein the population is enriched in a compound having at least 3 adjacent phosphorothioate internucleoside linkages in the 5' to 3' direction having the Sp, Sp, and Rp configurations.
[0370] Embodiment 140. A population of oligomeric compounds as described in any one of Embodiments 117 - 130, wherein all phosphorothioate internucleoside linkages of the oligomeric compounds are atactic.
[0371] Embodiment 141. A pharmaceutical composition comprising an oligomeric compound as described in any one of Embodiments 78 - 130, an oligomeric duplex as described in Embodiment 131, an antisense compound as described in Embodiment 132, or a population as described in any one of Embodiments 133 - 140, and a pharmaceutically acceptable carrier or diluent.
[0372] Embodiment 142. A method comprising administering the pharmaceutical composition as described in Embodiment 141 to an individual.
[0373] Embodiment 143. A method for treating a disease associated with the RAAS pathway, the method comprising administering to an individual having a disease associated with the RAAS pathway or at risk of having the disease a therapeutically effective amount of the pharmaceutical composition according to Embodiment 142, thereby treating the disease associated with the RAAS pathway.
[0374] Embodiment 144. The method according to Embodiment 143, wherein the disease is a cardiovascular disease.
[0375] Embodiment 145. The method according to any one of Embodiments 143 and 144, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.
[0376] Embodiment 146. The method according to any one of Embodiments 143 - 145, wherein at least one symptom or sign of the disease is improved.
[0377] Embodiment 147. The method according to Embodiment 146, wherein the symptom or sign is any one of the following: hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, preeclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, or pulmonary hypertension.
[0378] Embodiment 148. The method according to any one of Embodiments 142 - 147, wherein the pharmaceutical composition is administered systemically.
[0379] Embodiment 149. The method according to any one of Embodiments 142 - 148, wherein the pharmaceutical composition is administered subcutaneously or intramuscularly.
[0380] Embodiment 150. Use of an oligomeric compound according to any one of Embodiments 78 - 130, an oligomeric duplex according to Embodiment 131, an antisense compound according to Embodiment 132, or a population according to any one of Embodiments 133 - 140 for reducing AGT expression in cells.
[0381] Embodiment 151. The use according to Embodiment 150, wherein the level of AGT RNA is reduced.
[0382] Embodiment 152. The use according to Embodiment 150, wherein the level of AGT protein is reduced.
[0383] I. Certain oligonucleotides
[0384] In certain embodiments, provided herein are oligomeric compounds that include oligonucleotides composed of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or can be modified oligonucleotides. Relative to unmodified RNA or DNA, the modified oligonucleotides include at least one modification. That is, the modified oligonucleotides include at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.
[0385] A. Certain modified nucleosides
[0386] Modified nucleosides include a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.
[0387] 1. Certain sugar moieties
[0388] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can include one or more substitutions corresponding to those of other types of modified sugar moieties.
[0389] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring having one or more substituents, none of which bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be located at any position of the furanosyl, including (but not limited to) substituents at the 2'-position, 4'-position, and / or 5'-position. In certain embodiments, one or more non-bridging substituents of the non-bicyclic modified sugar moiety have a branched chain. Examples of 2'-substituents suitable for the non-bicyclic modified sugar moiety include (but are not limited to): 2'-F, 2'-OCH 3 ("OMe" or "O-methyl") and 2'-O(CH 2 ) 2 OCH 3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is selected from: halogen, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-C 1 -C 10 alkoxy, substituted O-C 1 -C 10 alkoxy, O-C 1 -C 10 alkyl, substituted O-C 1 -C10 alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylene-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 、O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(=O)-N(R m )(R n ), where each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10 alkyl, and the 2'-substituents described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 4'-substituents suitable for non-bicyclic modified sugar moieties include (but are not limited to) alkoxy (e.g., methoxy), alkyl, and those groups described in Manoharan et al., WO 2015 / 106128. Examples of 5'-substituents suitable for non-bicyclic modified sugar moieties include (but are not limited to): 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety contains more than one non-bridging sugar substituent, such as the 2'-F-5'-methyl sugar moiety and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0390] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside contains a sugar moiety that contains a non-bridging 2'-substituent selected from: F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 )3 NH 2 , CH 2 CH=CH 2 、OCH 2 CH=CH 2 、OCH 2 CH 2 OCH 3 、O(CH 2 ) 2 SCH 3 、O(CH 2 ) 2 ON(R m )(R n )、O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 and N-substituted acetamides (OCH 2 C(=O)-N(R m )(R n )), where each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C 1 -C 10 alkyl.
[0391] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from the group consisting of: F, OCF 3 、OCH 3 、OCH 2 CH 2 OCH 3 、O(CH 2 ) 2 SCH 3 、O(CH 2 ) 2 ON(CH 3 ) 2 、O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 and OCH 2 C(=O)-N(H)CH 3 (“NMA”).
[0392] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from: F, OCH 3 and OCH 2 CH 2 OCH 3 。
[0393] In certain embodiments, the modified furanosyl sugar moiety and the nucleoside having such a modified furanosyl sugar moiety are further defined by the isomeric configuration. For example, the 2'-deoxyfuranosyl sugar moiety can assume seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranosyl sugar moiety; thus, such sugar moieties have a total of sixteen possible isomeric configurations. Unless otherwise specified, the 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration.
[0394] Certain modified sugar moieties contain substituents that bridge two atoms of the furanosyl ring to form a second ring, thereby producing a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety contains a bridge between the 4' and 2' furanosyl ring atoms. Examples of such 4'-to-2'-bridging sugar substituents include (but are not limited to): 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2' (“LNA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -O-2' (“ENA”), 4'-CH(CH 3 )-O-2' (referred to as “constrained ethyl” or “cEt”), 4'-CH 2 -O-CH 2 -2', 4'-CH 2 -N(R)-2', 4'-CH(CH 2 OCH 3 )-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, for example, Seth et al., U.S. 7,399,845; Bhat et al., U.S. 7,569,686; Swayze et al., U.S. 7,741,457; and Swayze et al., U.S. 8,022,193), 4'-C(CH3 )(CH 3 )-O-2' and its analogs (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH 2 -N(OCH 3 )-2' and its analogs (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH 2 -O-N(CH 3 )-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'-CH 2 -C(H)(CH 3 )-2' (see, e.g., Zhou et al., J. Org. Chem., 2009, 74, 118 - 134), 4'-CH 2 -C(=CH 2 )-2' and its analogs (see, e.g., Seth et al., U.S. 8,278,426), 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-O-N(R)-2', 4'-CH 2 -O-N(R)-2' and 4'-CH 2 -N(R)-O-2', wherein each R, R a and R b is independently H, a protecting group or C 1 -C 12 alkyl (see, e.g., Imanishi et al., U.S. 7,427,672).
[0395] In certain embodiments, such 4' to 2' bridges independently comprise 1 to 4 linking groups independently selected from: -[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a ) 2 -, -S(=O) x - and -N(R a )-;
[0396] Wherein:
[0397] x is 0, 1 or 2;
[0398] n is 1, 2, 3 or 4;
[0399] Each R a and R b independently is H, a protecting group, a hydroxyl group, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, a heterocyclic group, a substituted heterocyclic group, a heteroaryl, a substituted heteroaryl, C 5 -C 7 an alicyclic group, substituted C 5 -C 7 alicyclic group, a halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , an acyl group (C(=O)-H), a substituted acyl group, CN, a sulfonyl group (S(=O) 2 -J 1 ) or a sulfoxyl group (S(=O)-J 1 ); and
[0400] each J 1 and J 2 independently is H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12Alkynyl, C 5 -C 20 Aryl, substituted C 5 -C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic group, substituted heterocyclic group, C 1 -C 12 Aminoalkyl, substituted C 1 -C 12 Aminoalkyl or protecting group.
[0401] Other bicyclic sugar moieties are known in the art, see for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Wengel et al., U.S. 7,053,207; Imanishi et al., U.S. 6,268,490; Imanishi et al., U.S. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499; Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133; Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; Ramasamy et al., U.S. 6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; and Allerson et al., U.S. Patent Publication No. US2008 / 0039618 and Migawa et al., U.S. Patent Publication No. US2015 / 0191727.
[0402] In certain embodiments, the bicyclic sugar moiety and the nucleoside incorporating such a bicyclic sugar moiety are further defined by the isomeric configuration. For example, LNA nucleosides (as described herein) can be in the α-L configuration or in the β-D configuration.
[0403]
[0404] α-L-methyleneoxy (4'-CH 2 -O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this text, the general description of bicyclic nucleosides includes two isomeric configurations. Unless otherwise specified, when the position of a particular bicyclic nucleoside (such as LNA or cEt) is identified in the embodiments exemplified herein, it is in the β-D configuration.
[0405] In certain embodiments, the modified sugar moiety contains one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted sugar and 4'-2' bridged sugar).
[0406] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also contain bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates contain a 4'-sulfur atom and substitutions at the 2'-position (see, for example, Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and / or the 5'-position.
[0407] In certain embodiments, the sugar surrogate contains a ring that is not 5 atoms. For example, in certain embodiments, the sugar surrogate contains a 6-membered tetrahydropyran ("THP"). Such tetrahydropyrans can be further modified or substituted. Nucleosides incorporating such modified tetrahydropyrans include (but are not limited to) hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, for example, Leumann, C.J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro-HNA:
[0408]
[0409] ("F-HNA", see, for example, Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran) and a nucleoside comprising other modified THP compounds having the following formula:
[0410]
[0411] wherein, independently, for each modified THP nucleoside:
[0412] Bx is a nucleobase moiety;
[0413] T 3 and T 4 are each independently a internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T 3 and T 4 is a internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linking moiety, or a 5' or 3' terminal group;
[0414] q 1 、q 2 、q 3 、q 4 、q 5 、q 6 and q 7 are each independently H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and
[0415] R 1 and R 2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 、SJ 1 、N 3 、OC(=X)J 1, OC(=X)NJ 1 J 2 , NJ 3 , C(=X)NJ 1 J 2 and CN, where X is O, S or NJ 1 , and each J 1 , J 2 and J 3 is independently H or C 1 -C 6 alkyl.
[0416] In certain embodiments, modified THP nucleosides are provided, wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is not H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy and R 2 is H.
[0417] In certain embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than one heteroatom. For example, nucleosides containing a morpholino sugar moiety and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506).
[0418] As used herein, the term "morpholino" refers to a sugar substitute having the following structure:
[0419]
[0420] In certain embodiments, the morpholino can be modified, for example, by adding or changing various substituents compared to the above morpholino structure. Such sugar substitutes are referred to herein as "modified morpholinos".
[0421] In certain embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include (but are not limited to): peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865) and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.
[0422] Many other bicyclic and tricyclic sugar and sugar substitute ring systems are known in the art and can be used in modified nucleosides.
[0423] 2. Certain modified nucleobases
[0424] In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing an unmodified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain a nucleobase, referred to as abasic nucleosides.
[0425] In certain embodiments, the modified nucleobases are selected from: 5-substituted pyrimidines, 6-aza pyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobases are selected from: 2-aminopropyl adenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-amino adenine, 6-N-methyl guanine, 6-N-methyl adenine, 2-propyl adenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl (-C≡C-CH 3)Uracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azathymine, 5-ribosyluracil (pseudouracil), 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza and other 8-substituted purines; 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine; 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoyl cytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoyl cytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced by other heterocycles such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Other nucleobases include those disclosed in Merigan et al., U.S. 3,687,808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I. ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, Int. Ed., 1991, 30, 613; Sanghvi, Y.S., Antisense Research and Applications, Crooke, S.T. and Lebleu, B. eds., CRC Press, Chapter 15, 1993, 273-288; and Antisense Drug Technology, Crooke S.T. ed., CRC Press, Chapters 6 and 15, 2008, 163-166 and 442-443.
[0426] Disclosures teaching the preparation of certain of the above - modified nucleobases and other modified nucleobases include, but are not limited to, Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. 6,005,096.
[0427] 3. Certain internucleoside linkages
[0428] In certain embodiments, any internucleoside linkage can be used to link the nucleosides of the modified oligonucleotides together. Two main classes of internucleoside linking groups are defined based on the presence or absence of a phosphorus atom. Representative phosphorus - containing internucleoside linkages include, but are not limited to, phosphodiesters, which contain a phosphodiester bond (“P(O 2)=O") (also referred to as unmodified linkages or naturally occurring linkages); phosphotriesters; methylphosphonates; phosphoramidates; thiophosphates ("P(O 2 )=S") and dithiophosphates ("HS-P=S"). Representative non-phosphorus nucleoside internucleoside linkers include (but are not limited to) methylene methylimino (-CH 2 -N(CH 3 )-O-CH 2 -), thiodiesters, thiocarbamates (-O-C(=O)(NH)-S-); siloxanes (-O-SiH 2 -O-); and N,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 ). Modified internucleoside linkages can be used to alter, and typically increase, the nuclease resistance of oligonucleotides as compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or separated enantiomers. Methods for preparing phosphorus-containing and non-phosphorus internucleoside linkages are well known to those of skill in the art.
[0429] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising an internucleoside linkage having a chiral center can be prepared as a population of modified oligonucleotides comprising a racemic internucleoside linkage, or as a population of modified oligonucleotides comprising phosphorothioate internucleoside linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides comprises phosphorothioate internucleoside linkages, wherein all of the phosphorothioate internucleoside linkages are racemic. Such modified oligonucleotides can be generated using synthetic methods that randomly select the stereochemical configuration of each phosphorothioate internucleoside linkage. Nevertheless, as is well understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides comprising one or more specific phosphorothioate internucleoside linkages in a specifically selected stereochemical configuration. In certain embodiments, a specific phosphorothioate internucleoside linkage in a specific configuration is present in at least 65% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage in a specific configuration is present in at least 70% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage in a specific configuration is present in at least 80% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage in a specific configuration is present in at least 90% of the molecules in the population. In certain embodiments, a specific phosphorothioate internucleoside linkage in a specific configuration is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, such as those described in: Oka et al., JACS 125, 8307 (2003); Wan et al., Nuc. Acid. Res. 42, 13456 (2014); and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, where "B" indicates a nucleobase:
[0430]
[0431] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides set forth herein can be racemic or in a specific stereochemical configuration.
[0432] Neutral internucleoside linkages include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH 2 -N(CH 3 )-O-5'), amide-3 (3'-CH 2 -C(=O)-N(H)-5'), amide-4 (3'-CH 2 -N(H)-C(=O)-5'), formaldehyde acetal (3'-O-CH 2 -O-5'), methoxypropyl (MOP), and thiomethylene acetal (3'-S-CH 2 -O-5'). Other neutral internucleoside linkages include nonionic linkages that include siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; edited by Y.S. Sanghvi and P.D. Cook, ACS Symposium Series 580; Chapters 3 and 4, 40-65). Other neutral internucleoside linkages include nonionic linkages that include a mixture of N, O, S, and CH 2 constituents.
[0433] B. Certain motifs
[0434] In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides that comprise a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides that comprise a modified nucleobase. In certain embodiments, a modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of the sugar moiety, nucleobase, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide can be described by its glycosyl motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, a nucleobase motif describes a modification to a nucleobase and is independent of the sequence of the nucleobases).
[0435] 1. Certain sugar motifs
[0436] In certain embodiments, an oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged in a defined pattern or glycosyl motif along the oligonucleotide or a portion thereof. In certain instances, such glycosyl motifs include, but are not limited to, any of the sugar modifications discussed herein.
[0437] In certain embodiments, the modified oligonucleotide has a gapmer motif defined by two outer regions or "wings" and a central or inner region or "gap". The three regions of the gapmer motif (5' wing, gap, and 3' wing) form an adjacent sequence of nucleosides, wherein at least some of the sugar moieties of the nucleosides of each wing are different from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleoside closest to the gap in each wing (the most 3' terminal nucleoside of the 5' wing and the most 5' terminal nucleoside of the 3' wing) is different from the sugar moiety of the adjacent gap nucleoside, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having sugar moieties different from those of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5' wing is different from the sugar motif of the 3' wing (asymmetric gapmer).
[0438] In certain embodiments, the wings of the gapmer contain 1 - 6 nucleosides. In certain embodiments, each nucleoside of each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of the gapmer contain a modified sugar moiety.
[0439] In certain embodiments, the gap of the gapmer contains 7 - 12 nucleosides. In certain embodiments, at least six nucleosides of the gap of the gapmer contain 2'-β-D-deoxyribosyl sugar moieties. In certain embodiments, each nucleoside of the gap of the gapmer contains a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of the gapmer contains a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of the gapmer contains a 2'-OMe sugar moiety.
[0440] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction contain 2'-deoxyribosyl sugar moieties, and the nucleosides on the wing side of each wing / gap junction contain modified sugar moieties. In certain embodiments, at least six nucleosides of the gap of the gapmer contain 2'-β-D-deoxyribosyl sugar moieties. In certain embodiments, each nucleoside of the gap contains a 2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer contains a modified sugar moiety. In certain embodiments, one nucleoside of the gap contains a modified sugar moiety and each remaining nucleoside of the gap contains a 2'-deoxyribosyl sugar moiety.
[0441] In certain embodiments, the modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide contains a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion contains the same modified sugar moiety, herein referred to as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified oligonucleotide contains the same 2'-modification.
[0442] In this text, the lengths (number of nucleotides) of the three regions of a gapmer can be provided using the notation [number of nucleotides in the 5' wing]-[number of nucleotides in the gap]-[number of nucleotides in the 3' wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleotides in each wing and 10 linked nucleotides in the gap. If this nomenclature is followed by a specific modification, the modification is in each sugar moiety of each wing and the gap nucleotides contain 2'-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleotides in the 5' wing, 10 linked 2'-β-D-deoxynucleotides in the gap, and 5 linked 2'-MOE nucleotides in the 3' wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleotides in the 5' wing, 10 linked 2'-β-D-deoxynucleotides in the gap, and 3 linked cEt nucleotides in the 3' wing. A 5-8-5 gapmer consists of 5 linked nucleotides with modified sugar moieties in the 5' wing, 8 linked 2'-deoxynucleotides in the gap, and 5 linked nucleotides with modified sugar moieties in the 3' wing. A mixed-wing gapmer has at least two different modified sugars in the 5' wing and / or the 3' wing. A 5-8-5 or 5-8-4 mixed-wing gapmer has at least two different modified sugar moieties in the 5' wing and / or the 3' wing.
[0443] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an X-Y-Z MOE gapmer, wherein X and Z are independently selected from 1, 2, 3, 4, 5, or 6 linked 2'-MOE nucleotides, and Y is 7, 8, 9, 10, or 11 linked deoxynucleotides.
[0444] In certain embodiments, the modified oligonucleotide has a sugar motif (5' to 3') selected from: meeemddddddddddmmmmm, where 'd' represents a 2'-deoxyribosyl sugar moiety, 'e' represents a 2'-MOE sugar moiety, and'm' represents a 2'-OMe sugar moiety.
[0445] 2. Certain nucleobase motifs
[0446] In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases of a modified oligonucleotide are 5-methylcytosine and all other nucleobases are unmodified nucleobases.
[0447] In certain embodiments, a modified oligonucleotide comprises a segment of modified nucleobases. In certain such embodiments, the segment is located at the 3'-end of the oligonucleotide. In certain embodiments, the segment is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the segment is located at the 5'-end of the oligonucleotide. In certain embodiments, the segment is within 3 nucleosides of the 5'-end of the oligonucleotide.
[0448] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleobase. In certain such embodiments, a nucleoside containing a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: 2-thiopyrimidine and 5-propynylpyrimidine.
[0449] 3. Certain internucleoside linkage motifs
[0450] In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P(O 2 )=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O 2) = S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar moiety of the modified oligonucleotide is a gapmer and all internucleoside linkages within the gap are modified. In some such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar moiety of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif contains at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In some such embodiments, all phosphorothioate internucleoside linkages are random. In certain embodiments, all phosphorothioate internucleoside linkages in the wings are (Sp) phosphorothioate and the gap contains at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing such internucleoside linkage motifs.
[0451] In certain embodiments, all internucleoside linkages are phosphodiester internucleoside linkages or phosphorothioate internucleoside linkages, and the chirality motif is (5' to 3'): Sp - o - o - o - Sp - Sp - Sp - Rp - Sp - Sp - Rp - Sp - Sp - Sp - Sp - Sp - Sp - Sp or Sp - o - o - o - Sp - Sp - Sp - Rp - Sp - Sp - Sp - Sp - Sp - Sp - Sp - Sp - Sp, where each 'Sp' represents an (Sp) phosphorothioate internucleoside linkage, each 'Rp' is an Rp internucleoside linkage, and each 'o' represents a phosphodiester internucleoside linkage. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing such internucleoside linkage motifs.
[0452] In certain embodiments, the modified oligonucleotide has a internucleoside linkage motif of sooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has the following internucleoside linkage motif (5' to 3'): sooooossssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has the following internucleoside linkage motif (5' to 3'): soooossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has the following internucleoside linkage motif (5' to 3'): sooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has the following internucleoside linkage motif (5' to 3'): sooossssssssssoooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has the following internucleoside linkage motif (5' to 3'): sooosssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0453] C. Certain lengths
[0454] The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al., Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992, a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of target nucleic acids in an oocyte injection model. Oligonucleotides 25 nucleobases in length and having 8 or 11 mismatched bases near the oligonucleotide termini were able to direct specific cleavage of the target nucleic acid, but to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13-nucleobase oligonucleotides, including those having 1 or 3 mismatches.
[0455] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, an oligonucleotide consists of from X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ≤ Y. For example, in certain embodiments, an oligonucleotide consists of from 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25,Composed of 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30 or 29 to 30 linked nucleosides.,
[0456] D. Certain modified oligonucleotides
[0457] In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modification motif and total length. In certain embodiments, such parameters are independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of the sugar modification. For example, the internucleoside linkages within the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, which is independent of the sugar modification gapmer pattern. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.,
[0458] E. Certain populations of modified oligonucleotides
[0459] A population of modified oligonucleotides in which all modified oligonucleotides in the population have the same molecular formula may be a racemic population or a chirally enriched population. In a racemic population, all chiral centers of all modified oligonucleotides are racemic. In a chirally enriched population, at least one specific chiral center is not racemic in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in the β-D-ribosyl sugar moiety and all phosphorothioate internucleoside linkages are racemic. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in both the β-D-ribosyl sugar moiety and at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.,
[0460] F.Nucleobase sequence
[0461] In certain embodiments, an oligonucleotide (modified or unmodified) is further described by its nucleobase sequence. In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain embodiments, the nucleobase sequence of a portion or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to a second oligonucleotide or nucleic acid (e.g., a target nucleic acid).
[0462] II. Certain oligomeric compounds
[0463] In certain embodiments, provided herein are oligomeric compounds that consist of an oligonucleotide (modified or unmodified) and optionally one or more linking groups and / or terminal groups. A linking group consists of one or more linking moieties and a linking linker that connects the linking moiety to the oligonucleotide. The linking group can be attached to either or both ends of the oligonucleotide and / or attached at any internal position. In certain embodiments, the linking group is attached to the 2'-position of the nucleoside of a modified oligonucleotide. In certain embodiments, a linking group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the linking group or terminal group is attached at the 3'-end and / or 5'-end of the oligonucleotide. In certain such embodiments, the linking group (or terminal group) is attached at the 3'-end of the oligonucleotide. In certain embodiments, the linking group is attached near the 3'-end of the oligonucleotide. In certain embodiments, the linking group (or terminal group) is attached at the 5'-end of the oligonucleotide. In certain embodiments, the linking group is attached near the 5'-end of the oligonucleotide.
[0464] Examples of terminal groups include (but are not limited to) linking groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.
[0465] A. Certain conjugating groups
[0466] In certain embodiments, the oligonucleotide is covalently linked to one or more conjugating groups. In certain embodiments, the conjugating group modifies one or more properties of the linked oligonucleotide, including (but not limited to) pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugating group imparts new properties to the linked oligonucleotide, such as a fluorophore or reporter group that enables detection of the oligonucleotide.Certain conjugating groups and moieties have been previously described, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids such as di-hexadecyl-rac-glycerol or 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonate triethylammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973); or adamantane acetic acid, palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexylamino-carbonyl-hydroxy cholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or GalNAc clusters (e.g., WO2014 / 179620).
[0467] 1. Conjugating moiety
[0468] The conjugating moiety includes, but is not limited to, an insert, a reporter molecule, a polyamine, a polyamide, a peptide, a carbohydrate, a vitamin moiety, polyethylene glycol, a thioether, a polyether, cholesterol, cholesteryl thioether, a bile acid moiety, a folate, a lipid, a lipophilic group, a phospholipid, biotin, a phenazine, a phenanthridine, an anthraquinone, an adamantane, an acridine, a fluorescein, a rhodamine, a coumarin, a fluorophore, and a dye.
[0469] In certain embodiments, the conjugating moiety comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfonamide, an antidiabetic agent, an antibacterial agent, or an antibiotic.
[0470] 2. Conjugating linker
[0471] The conjugating moiety is linked to the oligonucleotide via a conjugation linker. In certain oligomeric compounds, the conjugation linker is a single chemical bond (i.e., the conjugating moiety is directly linked to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugating moiety is linked to the oligonucleotide via a more complex conjugation linker that comprises one or more conjugation linker moieties, which are subunits that make up the conjugation linker. In certain embodiments, the conjugation linker comprises a chain structure such as a hydrocarbon chain or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.
[0472] In certain embodiments, the conjugation linker comprises one or more groups selected from the group consisting of an alkyl group, an amino group, an oxo group, an amide, a disulfide, polyethylene glycol, an ether, a thioether, and a hydroxyamino group. In certain such embodiments, the conjugation linker comprises a group selected from the group consisting of an alkyl group, an amino group, an oxo group, an amide, and an ether group. In certain embodiments, the conjugation linker comprises a group selected from an alkyl group and an amide group. In certain embodiments, the conjugation linker comprises a group selected from an alkyl group and an ether group. In certain embodiments, the conjugation linker comprises at least one phosphorus moiety. In certain embodiments, the conjugation linker comprises at least one phosphate group. In certain embodiments, the conjugation linker includes at least one neutral linking group.
[0473] In certain embodiments, the conjugation joint, including the conjugation joints described above, is a bifunctional linking moiety, such as those bifunctional linking moieties known in the art that can be used to link a conjugating group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linking moiety comprises at least two functional groups. One functional group is selected to bind to a specific site on the parent compound, and another functional group is selected to bind to the conjugating group. Examples of functional groups used in the bifunctional linking moiety include (but are not limited to) electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from the following: amino, hydroxy, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0474] Examples of conjugation joints include (but are not limited to) pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), N-succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation joints include (but are not limited to) substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl, or substituted or unsubstituted C 2 -C 10 alkynyl, where a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0475] In certain embodiments, the conjugate joint comprises 1 - 10 linker nucleosides. In certain embodiments, the conjugate joint comprises 2 - 5 linker nucleosides. In certain embodiments, the conjugate joint comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate joint comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoyl cytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyl adenine, guanine, and 2-N-isobutyryl guanine. It is generally desired that the linker nucleosides cleave from the oligomeric compound after the oligomeric compound reaches the target tissue. Thus, the linker nucleosides are generally linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is a phosphodiester bond.
[0476] As used herein, the linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where the oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or having a specified percentage of complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group containing a conjugate joint (comprising linker nucleosides), those linker nucleosides are not counted towards the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, the oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 - 30 nucleosides and (2) a conjugate group comprising 1 - 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. In such an oligomeric compound, the total number of adjacent linked nucleosides is greater than 30. Alternatively, the oligomeric compound may comprise a modified oligonucleotide consisting of 8 - 30 nucleosides and no conjugate group. In such an oligomeric compound, the total number of adjacent linked nucleosides does not exceed 30. Unless otherwise indicated, the conjugate joint comprises no more than 10 linker nucleosides. In certain embodiments, the conjugate joint comprises no more than 5 linker nucleosides. In certain embodiments, the conjugate joint comprises no more than 3 linker nucleosides. In certain embodiments, the conjugate joint comprises no more than 2 linker nucleosides. In certain embodiments, the conjugate joint comprises no more than 1 linker nucleoside.
[0477] In certain embodiments, it is desirable for the linking group to be cleaved from the oligonucleotide. For example, in certain cases, an oligomeric compound comprising a particular linking moiety is preferably taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable to cleave the linking group to release the unlinked oligonucleotide or the parent oligonucleotide. Accordingly, certain linking linkers can comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group having one, two, three, four or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or subcellular compartment (e.g., a lysosome). In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (e.g., a nuclease).
[0478] In certain embodiments, the cleavable bond is selected from: an amide, an ester, an ether, one or two esters of a phosphodiester, a phosphate ester, a carbamate or a disulfide. In certain embodiments, the cleavable bond is one or two esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate ester or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphoester or phosphodiester linkage between the oligonucleotide and the linking moiety or linking group.
[0479] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to the 3' or 5' terminal nucleoside of the oligonucleotide via a phosphodiester internucleoside linkage and is covalently linked to the remainder of the linking linker or linking moiety via a phosphoester or phosphorothioate internucleoside linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0480] 3. Cell targeting moiety
[0481] In certain embodiments, the linking group comprises a cell targeting moiety. In certain embodiments, the linking group has the following general formula:
[0482]
[0483] wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater than 2, j is 1 or 0, and k is 1 or 0.
[0484] In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
[0485] In certain embodiments, the conjugating group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently linked to a branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently linked to a branching group.
[0486] B. Certain terminal groups
[0487] In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include (but are not limited to) 5'-phosphonates, including (but not limited to) 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleoside is an abasic nucleoside.
[0488] III. Oligomeric duplex
[0489] In certain embodiments, the oligomeric compounds described herein comprise oligonucleotides having nucleobase sequences complementary to the nucleobase sequences of target nucleic acids. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of: (1) a modified or unmodified oligonucleotide and optionally a conjugating group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugating group. Either or both of the oligomeric compounds of the oligomeric duplex may comprise a conjugating group. The oligonucleotides of each oligomeric compound of the oligomeric duplex may include non-complementary overhanging nucleosides.
[0490] IV. Antisense activity
[0491] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, thereby producing at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity when it reduces the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids, thereby producing one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids or hybridize to one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.
[0492] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is an intracellular nuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity are described herein. In certain embodiments, one or more non-DNA-like nucleosides are present in the gap of a gapmer.
[0493] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds cause cleavage of the target nucleic acid by Argonaute. An antisense compound loaded into RISC is an RNAi compound. The RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).
[0494] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not recruit a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an alteration in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an alteration in the translation of the target nucleic acid.
[0495] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by the target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or subject.
[0496] V. Certain target nucleic acids
[0497] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide having a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target nucleic acid is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.
[0498] A. Complementarity / mismatch to target nucleic acid
[0499] Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) showed that an oligonucleotide having 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was able to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Additionally, this oligonucleotide demonstrated potent in vivo anti-tumor activity. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides and 28- and 42-nucleotide oligonucleotides containing sequences of two or three tandem oligonucleotides to block the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides alone was able to inhibit translation, but at a more modest level compared to the 28- or 42-nucleotide oligonucleotides.
[0500] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid along the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along the entire length of the oligonucleotide and contains a portion that is 100% or perfectly complementary to the target nucleic acid. In certain embodiments, the length of the perfectly complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0501] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by the mismatch, but the activity against non-targets is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5'-end of the gap region. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, or 6 from the 5'-end of the 5'-wing region or the 3'-wing region.
[0502] B. AGT
[0503] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide complementary to a target nucleic acid, wherein the target nucleic acid is an AGT nucleic acid. In certain embodiments, the AGT nucleic acid has the sequence shown in SEQ ID NO:1 (GENBANK accession number NM_000029.3) or SEQ ID NO:2 (complementary sequence of GENBANK accession number NC_000001.11 truncated from nucleotide 230700001 to 230718000).
[0504] In certain embodiments, contacting a cell with an oligomeric compound complementary to either SEQ ID NO:1 or 2 reduces the amount of AGT RNA, and in certain embodiments reduces the amount of AGT protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell with an oligomeric compound complementary to either SEQ ID NO:1 or 2 reduces the amount of AGT RNA in the cell, and in certain embodiments reduces the amount of AGT protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting the cells in a subject with an oligomeric compound complementary to either SEQ ID NO:1 or 2 ameliorates one or more symptoms or markers of cardiovascular disease. In certain embodiments, the disease is hypertension. In certain embodiments, the disease is resistant hypertension. In certain embodiments, the disease is Marfan syndrome. In certain embodiments, the disease is heart failure. In certain embodiments, the symptoms or markers are selected from hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, heart valve disease, vascular aneurysm, peripheral artery disease, and organ damage.
[0505] In certain embodiments, when administered according to standard cell assays, an oligomeric compound complementary to either of SEQ ID NO:1 and 2 is capable of reducing the detectable amount of AGT RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, when administered according to standard in vitro assays, an oligomeric compound complementary to SEQ ID NO:1 or 2 is capable of reducing the amount of AGT in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 is capable of reducing the detectable amount of AGT RNA in a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
[0506] VI. Certain conjugating compounds
[0507] In certain embodiments, the oligomeric compounds described herein comprise, or consist of, an oligonucleotide (modified or unmodified) and optionally one or more conjugating groups and / or terminal groups. A conjugating group consists of one or more conjugate moieties and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. The conjugating group can be attached to either or both ends of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugating group is attached to the 2'-position of the nucleoside of a modified oligonucleotide. In certain embodiments, a conjugating group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugating group or terminal group is attached at the 3'-end and / or 5'-end of the oligonucleotide. In certain such embodiments, the conjugating group (or terminal group) is attached at the 3'-end of the oligonucleotide. In certain embodiments, the conjugating group is attached near the 3'-end of the oligonucleotide. In certain embodiments, the conjugating group (or terminal group) is attached at the 5'-end of the oligonucleotide. In certain embodiments, the conjugating group is attached near the 5'-end of the oligonucleotide.
[0508] In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of the compound has a nucleobase sequence complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In certain embodiments, the oligonucleotide is complementary to pre-mRNA. In certain embodiments, the oligonucleotide is complementary to a sense transcript.
[0509] Examples of end groups include, but are not limited to, conjugation groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.
[0510] In certain embodiments, the oligonucleotide is covalently linked to one or more conjugating groups. In certain embodiments, the conjugating group modifies one or more properties of the linked oligonucleotide, including (but not limited to) pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugating group confers new properties on the linked oligonucleotide, such as a fluorophore or reporter group that enables detection of the oligonucleotide.Certain conjugating groups and conjugating moieties have been described previously, e.g., cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); cholesteryl thioether (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains, e.g., dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, e.g., di-hexadecyl-rac-glycerol or 1,2-di-O-hexadecyl-rac-glycerol-3-H-phosphonate triethylammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973); or adamantane acetic acid, palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexylamino-carbonyl-hydroxy cholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or GalNAc clusters (e.g., WO2014 / 179620).
[0511] 1. Conjugating moiety
[0512] The conjugating moiety includes, but is not limited to, an insert, a reporter molecule, a polyamine, a polyamide, a peptide, a carbohydrate (e.g., GalNAc), a vitamin moiety, a polyethylene glycol, a thioether, a polyether, cholesterol, cholesteryl sulfate, a bile acid moiety, a folate, a lipid, a phospholipid, biotin, a phenazine, a phenanthridine, an anthraquinone, an adamantane, an acridine, a fluorescein, a rhodamine, a coumarin, a fluorophore, and a dye.
[0513] In certain embodiments, the conjugating moiety comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepam, indomethacin, a barbiturate, a cephalosporin, a sulfonamide, an antidiabetic agent, an antibacterial agent, or an antibiotic.
[0514] 2. Conjugating linker
[0515] The conjugating moiety is connected to the oligonucleotide via a conjugating linker. In certain compounds, the conjugating linker is a single chemical bond (i.e., the conjugating moiety is directly connected to the oligonucleotide via a single bond). In certain compounds, the conjugating moiety is connected to the oligonucleotide via a more complex conjugating linker that comprises one or more conjugating linker moieties, which are subunits that make up the conjugating linker. In certain embodiments, the conjugating linker comprises a chain structure such as a hydrocarbon chain or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.
[0516] In certain embodiments, the conjugating linker comprises one or more groups selected from the following: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In certain such embodiments, the conjugating linker comprises a group selected from the following: alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugating linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugating linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugating linker comprises at least one phosphorus moiety. In certain embodiments, the conjugating linker comprises at least one phosphate group. In certain embodiments, the conjugating linker includes at least one neutral linking group.
[0517] In certain embodiments, the conjugation joint, including the conjugation joints described above, is a bifunctional linking moiety, such as those bifunctional linking moieties known in the art to be useful for linking a conjugating group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linking moiety comprises at least two functional groups. One functional group is selected to bind to a specific site on the parent compound, and another functional group is selected to bind to the conjugating group. Examples of functional groups used in the bifunctional linking moiety include (but are not limited to) electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from: amino, hydroxy, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0518] Examples of conjugation joints include (but are not limited to) pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), N-succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation joints include (but are not limited to) substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl, or substituted or unsubstituted C 2 -C 10 alkynyl, where a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0519] In certain embodiments, the conjugation joint comprises 1 - 10 linker nucleosides. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from: purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from: uracil, thymine, cytosine, 4-N-benzoyl cytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyl adenine, guanine, and 2-N-isobutyryl guanine. It is generally desirable for the linker nucleosides to cleave from the compound after the compound reaches the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0520] In this text, a linker nucleoside is not considered part of an oligonucleotide. Thus, in embodiments where a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or having a specified percentage of complementarity to a reference nucleic acid and the compound further comprises a conjugating group containing a conjugation linker (comprising linker nucleosides), those linker nucleosides are not counted towards the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, a compound can comprise (1) a modified oligonucleotide consisting of 8 - 30 nucleosides and (2) a conjugating group comprising 1 - 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. In such a compound, the total number of adjacent linked nucleosides is greater than 30. Alternatively, a compound can comprise a modified oligonucleotide consisting of 8 - 30 nucleosides and no conjugating group. In such a compound, the total number of adjacent linked nucleosides does not exceed 30. Unless otherwise indicated, a conjugation linker comprises no more than 10 linker nucleosides. In certain embodiments, the conjugation linker comprises no more than 5 linker nucleosides. In certain embodiments, the conjugation linker comprises no more than 3 linker nucleosides. In certain embodiments, the conjugation linker comprises no more than 2 linker nucleosides. In certain embodiments, the conjugation linker comprises no more than 1 linker nucleoside.
[0521] In certain embodiments, it is desirable for the conjugating group to cleave from the oligonucleotide. For example, in certain cases, a compound comprising a particular conjugating moiety is preferably taken up by a particular cell type, but once the compound has been taken up, it is desirable to cleave the conjugating group to release the un-conjugated oligonucleotide or the parent oligonucleotide. Thus, certain conjugation linkers can comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety selectively cleaves inside a cell or subcellular compartment (such as a lysosome). In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (such as a nuclease).
[0522] In certain embodiments, the cleavable bond is selected from: an amide, an ester, an ether, one or two esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or two esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate ester or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate ester linkage between the oligonucleotide and the conjugating moiety or the conjugating group.
[0523] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, the one or more linker nucleosides are connected to each other and / or to the remainder of the compound via a cleavable bond. In certain embodiments, such a cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to the 3' or 5'-terminal nucleoside of the oligonucleotide via a phosphoronucleoside internucleoside linkage and is covalently linked to the remainder of the conjugating linker or conjugating moiety via a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0524] 3. Certain cell-targeting conjugating moieties
[0525] In certain embodiments, the conjugating group comprises a cell-targeting conjugating moiety. In certain embodiments, the conjugating group has the following general formula:
[0526]
[0527] where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater than 2, j is 1 or 0, and k is 1 or 0.
[0528] In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.
[0529] In certain embodiments, the conjugating group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently linked to a branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently linked to a branching group.
[0530] In certain embodiments, the cell targeting moiety comprises a branched group, the branched group comprising one or more groups selected from: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In certain embodiments, the branched group comprises a branched aliphatic group, the branched aliphatic group comprising a group selected from: alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In certain such embodiments, the branched aliphatic group comprises a group selected from: alkyl, amino, oxo, amide, and ether group. In certain such embodiments, the branched aliphatic group comprises a group selected from alkyl, amino, and ether group. In certain such embodiments, the branched aliphatic group comprises a group selected from alkyl and ether group. In certain embodiments, the branched group comprises a monocyclic or polycyclic system.
[0531] In certain embodiments, each tether of the cell targeting moiety comprises one or more groups in any combination selected from: alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups in any combination selected from: alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups in any combination selected from: alkyl, phosphodiester, ether, amino, oxo, and amide. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups in any combination selected from: alkyl, ether, amino, oxo, and amide. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups in any combination selected from: alkyl, amino, and oxo. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups in any combination selected from: alkyl and oxo. In certain embodiments, each tether is a straight-chain aliphatic group comprising one or more groups in any combination selected from: alkyl and phosphodiester. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain having a length of from about 6 to about 20 atoms. In certain embodiments, each tether comprises a chain having a length of from about 10 to about 18 atoms. In certain embodiments, each tether comprises a chain having a length of about 10 atoms.
[0532] In certain embodiments, each ligand of the cell targeting moiety has an affinity for at least one type of receptor on the target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of mammalian liver cells. In certain embodiments, each ligand has an affinity for the asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine (GalNAc), mannose, glucose, glucosamine, and fucose. In certain embodiments, each ligand is N-acetylgalactosamine (GalNAc). In certain embodiments, the cell targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell targeting moiety comprises 1 GalNAc ligand.
[0533] In certain embodiments, each ligand of the cell targeting moiety is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In certain such embodiments, the conjugating group comprises a carbohydrate cluster (see, for example, Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting”, Bioconjugate Chemistry, 2003, 14, 18 - 29 or Rensen et al., “Design and Synthesis of Novel N - Acetylgalactosamine - Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor”, J. Med. Chem. 2004, 47, 5798 - 5808). In certain such embodiments, each ligand is an amino sugar or a thioglycoside. For example, amino sugars can be selected from a number of compounds known in the art, such as sialic acid, α - D - galactosamine, β - muramic acid, 2 - deoxy - 2 - methylamino - L - glucopyranose, 4,6 - dideoxy - 4 - formamido - 2,3 - di - O - methyl - D - mannosepyranose, 2 - deoxy - 2 - sulfoamino - D - glucopyranose, and N - sulfo - D - glucosamine and N - glycolyl - α - neuraminic acid. For example, thioglycosides can be selected from 5 - thio - β - D - glucopyranose, methyl 2,3,4 - tri - O - acetyl - 1 - thio - 6 - O - triphenylmethyl - α - D - glucopyranoside, 4 - thio - β - D - galactopyranose, and ethyl 3,4,6,7 - tetra - O - acetyl - 2 - deoxy - 1,5 - dithio - α - D - gluco - heptopyranoside.
[0534] In certain embodiments, the conjugating group comprises a cell targeting moiety having the following formula:
[0535]
[0536] In certain embodiments, the conjugating group comprises a cell targeting moiety having the following formula:
[0537]
[0538] In certain embodiments, the conjugating group comprises a cell targeting moiety having the following formula:
[0539]
[0540] In certain embodiments, the conjugating group comprises a cell targeting moiety having the formula:
[0541]
[0542] In certain embodiments, the conjugating group comprises a cell targeting moiety having the formula:
[0543]
[0544] In certain embodiments, the compound comprises a conjugating group described herein as “LICA-1”. LICA-1 has the formula:
[0545]
[0546] In certain embodiments, the compounds set forth herein that comprise LICA-1 and a cleavable moiety within the conjugation linker have the formula:
[0547]
[0548] wherein oligo is an oligonucleotide.
[0549] Representative U.S. patents, U.S. patent application publications, international patent application publications, and other publications teaching the preparation of certain of the above conjugating groups, compounds comprising conjugating groups, linkers, conjugation linkers, branching groups, ligands, cleavable moieties, and other modifications include (but are not limited to) US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US2006 / 0148740, US2011 / 0123520, WO 2013 / 033230, and WO 2012 / 037254; Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011, 19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; and Valentijn et al., Tetrahedron, 1997, 53, 759-770.
[0550] In certain embodiments, the modified oligonucleotide comprises a gapmer or a fully modified glycosyl motif and a conjugating group comprising at least one, two, or three GalNAc ligands. In certain embodiments, the compound comprises a conjugating group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., JMed Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618;Rensen et al., J Med Chem, 2004, 47, 5798 - 5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169 - 175; van Rossenberg et al., Gene Ther, 2004, 11, 457 - 464; Sato et al., J Am Chem Soc, 2004, 126, 14013 - 14022; Lee et al., J Org Chem, 2012, 77, 7564 - 7571; Biessen et al., FASEB J, 2000, 14, 1784 - 1792; Rajur et al., Bioconjug Chem, 1997, 8, 935 - 940; Duff et al., Methods Enzymol, 2000, 313, 297 - 321; Maier et al., Bioconjug Chem, 2003, 14, 18 - 29; Jayaprakash et al., Org Lett, 2010, 12, 5410 - 5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103 - 128; Merwin et al., Bioconjug Chem, 1994, 5, 612 - 620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275 - 5281; International Applications WO1998 / 013381; WO2011 / 038356; WO1997 / 046098; WO 2008 / 098788; WO2004 / 101619; WO2012 / 037254; WO2011 / 120053; WO2011 / 100131; WO2011 / 163121; WO2012 / 177947; WO2013 / 033230; WO2013 / 075035; WO2012 / 083185; WO2012 / 083046; WO2009 / 082607; WO2009 / 134487; WO2010 / 144740; WO2010 / 148013; WO1997 / 020563; WO2010 / 088537; WO2002 / 043771; WO2010 / 129709; WO2012 / 068187; WO2009 / 126933; WO2004 / 024757; WO2010 / 054406; WO2012 / 089352; WO2012 / 089602; WO2013 / 166121; WO2013 / 165816; U.S. Patents 4,751,219; 8,552,163; 6,908,903;7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Applications US2011 / 0097264; US2011 / 0097265; US2013 / 0004427; US2005 / 0164235; US2006 / 0148740; US2008 / 0281044; US2010 / 0240730; US2003 / 0119724; US2006 / 0183886; US2008 / 0206869; US2011 / 0269814; US2009 / 0286973; US2011 / 0207799; US2012 / 0136042; US2012 / 0165393; US2008 / 0281041; US2009 / 0203135; US2012 / 0035115; US2012 / 0095075; US2012 / 0101148; US2012 / 0128760; US2012 / 0157509; US2012 / 0230938; US2013 / 0109817; US2013 / 0121954; US2013 / 0178512; US2013 / 0236968; US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; and US2009 / 0203132.;
[0551] VII. Certain pharmaceutical compositions
[0552] In certain embodiments, pharmaceutical compositions are described herein that comprise one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds is composed of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises, or consists of, a saline solution and one or more oligomeric compounds. In certain embodiments, the pharmaceutical composition comprises, or consists of, a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises, or consists of, one or more oligomeric compounds and water. In certain embodiments, the pharmaceutical composition comprises, or consists of, one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises, or consists of, one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS.
[0553] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylases, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxypropylmethyl cellulose, and polyvinylpyrrolidone.
[0554] In certain embodiments, the oligomeric compounds can be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating the pharmaceutical compositions depend on a variety of criteria, including (but not limited to) the route of administration, the degree of the disease, or the dose to be administered.
[0555] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more oligonucleotides are capable of providing (directly or indirectly) bioactive metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalent forms. Suitable pharmaceutically acceptable salts include (but are not limited to) sodium salts and potassium salts. In certain embodiments, the prodrug comprises one or more linking groups attached to the oligonucleotide, wherein the linking group is cleaved by endogenous nucleases in the body.
[0556] Lipid moieties have been used in nucleic acid therapies in a variety of ways. In some such methods, a nucleic acid (e.g., an oligomeric compound) is introduced into a preformed liposome or lipoplex made from a mixture of a cationic lipid and a neutral lipid. In some methods, DNA complexes are formed with a single cationic lipid or polycationic lipid in the absence of a neutral lipid. In some embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to a particular cell or tissue. In some embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to adipose tissue. In some embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent to muscle tissue.
[0557] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising a hydrophobic compound. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0558] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents comprising the oligomeric compounds provided herein to a particular tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with a tissue-specific antibody.
[0559] In some embodiments, the pharmaceutical composition comprises a co-solvent system. Some such co-solvent systems comprise, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is an anhydrous ethanol solution comprising 3% w / v benzyl alcohol, 8% w / v non-polar surfactant polysorbate 80 TM and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems can be varied quite substantially without significantly altering their solubility and toxicity characteristics. In addition, the identity of the co-solvent components can be altered: for example, other surfactants can be used instead of polysorbate 80 TM ; the fraction size of the polyethylene glycol can be altered; other biocompatible polymers can be used instead of polyethylene glycol, such as polyvinylpyrrolidone; and dextran can be replaced with other sugars or polysaccharides.
[0560] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, which is, for example, water or a physiologically compatible buffer, such as Hanks's solution, Ringer's solution, or a saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in dissolution or act as preservatives). In certain embodiments, injectable suspensions are prepared using a suitable liquid carrier, suspending agent, etc. Certain injectable pharmaceutical compositions are presented in unit dosage forms (e.g., in ampoules or in multi-dose containers). Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may contain formulating agents such as suspending agents, stabilizers, and / or dispersing agents. Some solvents suitable for injectable pharmaceutical compositions include (but are not limited to) lipophilic solvents and fatty oils (e.g., sesame oil), synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.
[0561] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be depicted or described in their protonated (free acid) form, or in their ionized and associated with a cation (salt) form, the aqueous solutions of such compounds exist in equilibrium in such forms. For example, the phosphodiester linkages of oligonucleotides in aqueous solution exist in equilibrium in free acid, anion, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. In addition, certain oligonucleotides have several such linkages, each in equilibrium. Thus, an oligonucleotide in solution exists in a series of forms at multiple sites, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The structures depicted necessarily depict a single form. However, unless otherwise indicated, such drawings are also intended to include the corresponding forms. In this document, the structure of the free acid of a compound followed by the term "or a salt thereof" explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.
[0562] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted using NaOH and / or HCl to achieve the desired pH.
[0563] In this text, certain specific doses are set forth. The doses can be in the form of dose units. For clarity, the dose (or dose unit) of the modified oligonucleotide or oligomeric compound (in milligrams) indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As set forth above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dose, it is assumed that the modified oligonucleotide or oligomeric compound exists in a solvent-free, sodium acetate-free, anhydrous free acid form. For example, if the modified oligonucleotide or oligomeric compound is in a solution containing sodium (such as brine), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with Na+ ions. However, the mass of the protons is still included in the weight of the dose, while the mass of the Na+ ions is not included in the weight of the dose. When the oligomeric compound contains a conjugating group, the mass of the conjugating group is included in the calculation of the dose of this oligomeric compound. If the conjugating group also has an acid, for the purpose of calculating the dose, it is also assumed that the conjugating group is fully protonated.
[0564] VIII. Certain compositions
[0565] Compound No. 1.1205407
[0566] In certain embodiments, Compound 1205407 is characterized as a 3-10-3 MOE / cEt mixed wing gap oligomer that is conjugated at the 5'-end to a conjugation group. Compound 1205407 has the sequence CGCTGATTTGTCCGGG (SEQ ID NO:12) (from 5' to 3'), where nucleotides 1 to 3 have sugar modifications of e-e-k (from 5' to 3'), where nucleotides 14 to 16 have sugar modifications of k-k-e, where each 'e' represents a 2'-MOE sugar moiety, and each 'k' refers to a cEt sugar moiety; and each of nucleotides 4 to 13 is a 2'-β-D-deoxynucleotide; where the internucleoside linkages between nucleotides 2 to 3, 3 to 4, and 14 to 15 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleotides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, and 15 to 16 are phosphorothioate internucleoside linkages, and where each cytosine is 5-methylcytosine. Compound 1205407 has a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capping, which is represented by the following structure, where the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleotide:
[0567]
[0568] In certain embodiments, Compound 1205407 is represented by the following chemical notation: THA-C6-GalNAc 3 - m C e s G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e (SEQ ID NO:12), where:
[0569] A = adenine nucleobase,
[0570] m C = 5-methylcytosine nucleobase,
[0571] G = guanine nucleobase,
[0572] T = thymine nucleobase,
[0573] e = 2'-β-D-MOE sugar moiety,
[0574] k = cEt sugar moiety,
[0575] d = 2'-β-D-deoxyribosyl sugar moiety,
[0576] s = phosphorothioate internucleoside linkage, and
[0577] o = phosphodiester internucleoside linkage.
[0578] In certain embodiments, the compound of No. 1205407 is represented by the following chemical structure:
[0579]
[0580] (SEQ ID NO:12), or a salt thereof.
[0581] In certain embodiments, the sodium salt of the compound of No. 1205407 is represented by the following chemical structure:
[0582]
[0583] (SEQ ID NO:12).
[0584] In certain embodiments, the compound of No. 1205407 is in an anionic form.
[0585] Compound No. 2.1205408
[0586] In certain embodiments, the compound of 1205408 is characterized as a 3-10-3 MOE / cEt mixed wing gap oligomer that is conjugated at the 5'-end to a conjugation group. Compound 1205408 has the sequence TCGGTTGGAATTCTTT (SEQ ID NO:13) (from 5' to 3'), where nucleosides 1 to 3 have sugar modifications of e-k-k (from 5' to 3') and where nucleosides 14 to 16 have sugar modifications of k-k-e; where each 'e' represents a 2'-MOE sugar moiety and each 'k' refers to a cEt sugar moiety; and each of nucleosides 4 to 13 is a 2'-β-D-deoxynucleoside; where the internucleoside linkages between nucleosides 2 to 3, 3 to 4, and 14 to 15 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, and 15 to 16 are phosphorothioate internucleoside linkages, and where each cytosine is 5-methylcytosine. The compound of 1205408 has a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capping, which is represented by the following structure, where the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside:
[0587]
[0588] In certain embodiments, the compound of 1205408 is represented by the following chemical notation: THA-C6-GalNAc 3 -T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T e (SEQ ID NO:13), where:
[0589] A = adenine nucleobase,
[0590] m C = 5-methylcytosine nucleobase,
[0591] G = guanine nucleobase,
[0592] T = thymine nucleobase,
[0593] e = 2'-β-D-MOE sugar moiety,
[0594] k = cEt sugar moiety,
[0595] d = 2'-β-D-deoxyribosyl sugar moiety,
[0596] s = phosphorothioate internucleoside linkage, and
[0597] o = phosphodiester internucleoside linkage.
[0598] In certain embodiments, the compound of No. 1205408 is represented by the following chemical structure:
[0599]
[0600] (SEQ ID NO:13), or a salt thereof.
[0601] In certain embodiments, the sodium salt of the compound of No. 1205408 is represented by the following chemical structure:
[0602]
[0603] (SEQ ID NO:13).
[0604] In certain embodiments, the compound of No. 1205408 is in an anionic form.
[0605] Compound No. 3.1250837
[0606] In certain embodiments, the compound of No. 1250837 is characterized as a 3-10-3 gapmer that is conjugated to a conjugating group at the 5'-end. Compound 1250837 has the sequence GTCGGTTGGAATTCTT (SEQ ID NO:15) (from 5' to 3'), wherein nucleosides 1 to 3 and 14 to 16 have cEt sugar modifications, wherein nucleoside 5 has 2'-OMe ribose, and wherein each of nucleosides 4 and 6 to 13 is a 2'-β-D-deoxynucleoside; wherein each internucleoside linkage between nucleosides is a phosphorothioate internucleoside linkage, and wherein each cytosine is 5-methylcytosine. The compound of No. 1250837 has a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capping, which is represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside:
[0607]
[0608] In certain embodiments, the compound of No. 1250837 is represented by the following chemical notation: THA-C6-GalNAc 3 -G k s T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k (SEQ ID NO:15), wherein:
[0609] A = adenine nucleobase,
[0610] m C = 5-methylcytosine nucleobase,
[0611] G = guanine nucleobase,
[0612] T = thymine nucleobase,
[0613] k = cEt sugar moiety,
[0614] d = 2'-β-D-deoxyribosyl sugar moiety,
[0615] y = 2'-OMe ribose moiety, and
[0616] s = phosphorothioate internucleoside linkage.
[0617] In certain embodiments, the compound of No. 1250837 is represented by the following chemical structure:
[0618]
[0619] (SEQ ID NO:15), or a salt thereof.
[0620] In certain embodiments, the sodium salt of the compound of No. 1250837 is represented by the following chemical structure:
[0621]
[0622] (SEQ ID NO:15).
[0623] In certain embodiments, the compound of No. 1250837 is in an anionic form.
[0624] Compound No. 4.1250851
[0625] In certain embodiments, the compound of No. 1250851 is characterized as a 3-10-3 gapmer that is conjugated at the 5'-end with a conjugation group. The compound 1250851 has the sequence TCGGUTGGAATTCTTT (SEQ ID NO:14) (from 5' to 3'), wherein nucleosides 1 to 3 and 14 to 16 have cEt sugar modifications, wherein nucleoside 5 has a 2'-OMe ribose, and wherein each of nucleosides 4 and 6 to 13 is a 2'-β-D-deoxynucleoside; wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, and 14 to 15 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, and 15 to 16 are phosphorothioate internucleoside linkages, and wherein each cytosine is 5-methylcytosine. The compound of No. 1250851 has a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capping, which is represented by the following structure, wherein the phosphate group is linked to the 5'-oxygen atom of the 5'-nucleoside:
[0626]
[0627] In certain embodiments, the compound of No. 1250851 is represented by the following chemical notation: THA-C6-GalNAc 3 -T ks m C ko G ko G ds U ys T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T k (SEQ ID NO:14), wherein:
[0628] A = adenine nucleobase,
[0629] m C = 5-methylcytosine nucleobase,
[0630] G = guanine nucleobase,
[0631] T = thymine nucleobase,
[0632] U = uracil nucleobase,
[0633] k = cEt sugar moiety,
[0634] d = 2'-β-D-deoxyribosyl sugar moiety,
[0635] y = 2'-OMe ribose moiety,
[0636] s = phosphorothioate internucleoside linkage, and
[0637] o = phosphodiester internucleoside linkage.
[0638] In certain embodiments, the compound of No. 1250851 is represented by the following chemical structure:
[0639]
[0640] (SEQ ID NO:14), or a salt thereof.
[0641] In certain embodiments, the sodium salt of the compound of No. 1250851 is represented by the following chemical structure:
[0642]
[0643] (SEQ ID NO:14).
[0644] In certain embodiments, the compound of No. 1250851 is in an anionic form.
[0645] VI. Certain comparative compositions
[0646] In certain embodiments, the compound of No. 757456 is a comparative compound. The compound of No. 757456 was previously described in WO2017062816, which is incorporated herein by reference, and has the sequence CACAAACAAGCTGGTCGGTT (SEQ ID NO:28) (from 5' to 3'), wherein the compound comprises a conjugation group and a modified oligonucleotide; wherein the modified oligonucleotide is a 5-10-5 MOE gapmer, wherein the central gap segment consists of ten 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consist of five 2'-MOE-modified nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine. The compound of No. 757456 has a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capping, which is represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside:
[0647]
[0648] In certain embodiments, the compound of No. 568637 is a comparative compound. The compound of No. 568637 was previously described in WO2017062816 which is incorporated herein by reference, and has the sequence CGCTGATTTGTCCGGG (SEQ ID NO:12) (from 5' to 3'), wherein the compound consists of a modified oligonucleotide; wherein the modified oligonucleotide has a length of 16 nucleosides and has a mixed sugar moiety as described by the sugar motif eekddddddddddkke; wherein each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.
[0649] In certain embodiments, the compound of No. 1176644 is a comparative compound. The compound of No. 1176644 is a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capped compound of No. 568637. Similar to the compound of No. 568637, the compound of No. 1176644 has the sequence CGCTGATTTGTCCGGG (SEQ ID NO:12) (from 5' to 3'), wherein the compound comprises a modified oligonucleotide; wherein the modified oligonucleotide has a length of 16 nucleosides and has a mixed sugar moiety as described by the sugar motif eekddddddddddkke; wherein each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.
[0650] In certain embodiments, the compounds described herein are superior to the compounds described in WO2017062816 because they exhibit one or more improved properties, such as potency.
[0651] For example, compared with Compound No. 757456, Compound No. 1205407 exhibits improved in vivo potency. As shown in Example 5, at a dose of 2.7 mg / kg, Compound No. 1205407 achieved 93% and 90% inhibition of AGT RNA and protein, respectively. In contrast, at a dose of 3.3 mg / kg, Compound No. 757456 achieved 65% and 60% inhibition of AGT RNA and protein, respectively. Therefore, in this assay, Compound No. 1205407 is more potent than Compound No. 757456. For example, as shown in Study 1 of Example 6, the ED 50 in the liver and plasma for Compound No. 1205407 is 0.1. In contrast, the ED 50 in the liver and plasma for Compound No. 757456 is 1.3. Therefore, in this assay, Compound No. 1205407 is more potent than Compound No. 757456.
[0652] For example, compared with Compound No. 757456, Compound No. 1205407 exhibits improved ex vivo potency. As shown in Example 8, using the Hepatopac system, the ex vivo IC 50 of Compound No. 1205407 is 0.04 nM. In contrast, the ex vivo IC 50 of Compound No. 757456 > 20 μM. Therefore, in this assay, Compound No. 1205407 is more potent than Compound No. 757456.
[0653] For example, compared with Compound No. 757456 or Compound No. 1176644, Compound No. 1205407 exhibits improved in vitro potency. As shown in Example 7, when tested in vitro using two different primer-probe sets, the IC 50 of Compound No. 1205407 is 8 nM and 12 nM. In contrast, under the same in vitro culture conditions, the IC 50 of Compound No. 757456 is 868 nM and 709 nM. In contrast, under the same in vitro culture conditions, the IC 50 of Compound No. 1176644 is 35 nM and 43 nM. Therefore, in this assay, Compound No. 1205407 is more potent than Compound No. 757456 or Compound No. 1176644.
[0654] For example, compared with Compound No. 757456 or Compound No. 1176644, Compound No. 1205407 exhibits improved in vivo potency. As shown in Study 2 of Example 6, the ED 50 in the transgenic mouse study for Compound No. 1205407 is 0.11 and the ED 75 is 0.38. In contrast, the ED of Compound No. 75745650 is 2.1 and ED 75 is 2.68. In contrast, the ED of compound No. 1176644 50 is 0.38 and ED 75 is 0.61. Therefore, in this assay, compound No. 1205407 is more potent than compound No. 757456 or compound No. 1176644.
[0655] Non-limiting disclosure and incorporation by reference
[0656] Each document and patent disclosure listed herein is incorporated by reference in its entirety.
[0657] Although certain compounds, compositions, and methods described herein have been specifically set forth in accordance with certain embodiments, the following examples are for illustrative purposes only of the compounds described herein and are not intended to limit such compounds. Each reference, GenBank accession number, etc. listed in this application is incorporated by reference in its entirety herein.
[0658] Although the sequence listing accompanying this application identifies each sequence as "RNA" or "DNA" as required, in reality, those sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily understand that in some cases, for example, the designation of a modified oligonucleotide as "RNA" or "DNA" is arbitrary. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA with a modified sugar moiety (2'-OH instead of a 2'-H of DNA) or as RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein (including, but not limited to, those in the sequence listing) are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleobases. As another non-limiting example, an oligomeric compound having a nucleobase sequence of "ATCGATCG" encompasses any oligomeric compound having this nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds containing RNA bases, such as those having the sequence "AUCGAUCG"; and those having some DNA bases and some RNA bases, such as "AUCGATCG"; and oligomeric compounds having other modified nucleobases, such as "AT m CGAUCG", where m C indicates a cytosine base containing a methyl group at the 5-position.
[0659] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and, as a result, give rise to enantiomers, diastereomers, and other stereoisomeric forms, which can be defined in terms of absolute stereochemistry as (R) or (S), α or β (e.g., for sugar anomers) or (D) or (L) (e.g., for amino acids, etc.). Compounds depicted or described herein as having certain stereoisomeric forms include only the indicated compounds. Unless otherwise specified, compounds depicted or described herein in undefined stereochemistry include all such possible isomers, including their atactic and optically pure forms. Similarly, unless otherwise indicated, all cis and trans isomers and tautomeric forms of the compounds herein are also included. The oligomeric compounds described herein include enantiopure or enriched mixtures as well as racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate internucleoside linkages include such compounds with chiral-controlled or random phosphorothioate internucleoside linkages. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.
[0660] Compounds described herein include variants in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated element. For example, compounds herein containing a hydrogen atom encompass all possible deuterium substitutions for each 1 H hydrogen atom. Isotope substitutions encompassed by the compounds herein include (but are not limited to): 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O and 33 S, 34 S, 35 S or 36 S in place of 32 S. In certain embodiments, non-radioactive isotope substitutions can impart new properties to the oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions can render the compounds suitable for research or diagnostic purposes, such as imaging.
[0661] Examples
[0662] The following examples illustrate certain embodiments of the disclosure and are not limiting. Additionally, in the context of providing specific embodiments, the inventors contemplate the general application of those specific embodiments.
[0663] Example 1: Design of Modified Oligonucleotides Complementary to Human AGT Nucleic Acid
[0664] As set forth in the following tables, modified oligonucleotides complementary to human AGT nucleic acid were designed. The "starting site" in all of the following tables indicates the most 5'-terminal nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The "terminating site" indicates the most 3'-terminal nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. Each modified oligonucleotide listed in the following tables is 100% complementary to SEQ ID NO:1 (GENBANK accession number NM_000029.3) or to SEQ ID NO:2 (complementary sequence of GENBANK accession number NC_000001.11 truncated from nucleotide 230700001 to 230718000) or to both of them.
[0665] The modified oligonucleotides in Table 1 are 16 nucleosides in length and have a mixed sugar moiety as indicated in the table below, where each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' represents a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine. 568637 is a comparative compound previously described in WO 2017 / 062816.
[0666] Table 1
[0667] 3-10-3 MOE / cEt Hybrid Wing Gapmer with Uniform PS Internucleoside Linkages Complementary to Human AGT RNA
[0668]
[0669] The modified oligonucleotides in Tables 2 to 6 all have a 5'-trihexylammonium-(THA)-C 6 GalNAc 3 capping, which is represented by the following structure, where the phosphate group is linked to the 5'-oxygen atom of the 5'-nucleoside:
[0670]
[0671] The modified oligonucleotides in Table 2 are 16 nucleosides in length and have a mixed sugar moiety as indicated, where each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' refers to a cEt sugar moiety. The internucleoside motif of the gapmer is (from 5' to 3'): soossssssssssos; where each 'o' represents a phosphodiester internucleoside linkage and each's' represents a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.
[0672] Table 2
[0673] GalNAc-conjugated 3-10-3 MOE / cEt hybrid wing gapmer with mixed PO / PS internucleoside linkages complementary to human AGT RNA
[0674]
[0675] The modified oligonucleotides in Table 3 are 16 nucleosides in length and have the indicated mixed sugar moieties, where each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, each 'k' refers to a cEt sugar moiety, and each 'y' refers to a 2'-OMe ribose. The internucleoside motif of the gapmer is (5' to 3'): soossssssssssos; where each 'o' represents a phosphodiester internucleoside linkage and each's' represents a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine, unless indicated by bold and underlined ' C ', in which case the cytosine is not methylated.
[0676] Table 3
[0677] GalNAc-conjugated 3-10-3 cEt gapmer with 2'-OMe in the gap and having mixed PO / PS internucleoside linkages complementary to human AGT RNA
[0678]
[0679] The modified oligonucleotides in Table 4 are 16 nucleosides in length and have the indicated mixed sugar motif, where 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, 'e' represents a 2'-MOE sugar moiety, and 'k' refers to a cEt sugar moiety. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine.
[0680] Table 4
[0681] GalNAc-conjugated 3-10-3 MOE / cEt hybrid wing gapmer with uniform PS internucleoside linkages complementary to human AGT RNA
[0682]
[0683] The modified oligonucleotides in Table 5 are 16 nucleotides in length and have the indicated mixed sugar motifs, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'e' represents the 2'-MOE sugar moiety, 'k' refers to the cEt sugar moiety, and 'y' refers to 2'-OMe ribose. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine, unless indicated by bold and underlined ' C ’, in which case the cytosine is not methylated.
[0684] Table 5
[0685] GalNAc-conjugated 3-10-3 cEt gapmer with 2'-OMe in the gap, complementary to human AGT RNA and having uniform PS internucleoside linkages
[0686]
[0687] The modified oligonucleotides in Table 6 are 5-10-5 MOE gapmers with uniform phosphorothioate internucleoside linkages. The compounds are 20 nucleotides in length, where the central gap segment consists of ten 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consist of five 2'-MOE-modified nucleosides. Each internucleoside linkage is a phosphorothioate internucleoside linkage. All cytosine residues are 5-methylcytosine. 757456 is a comparative compound previously described in WO 2017 / 062816.
[0688] Table 6
[0689] GalNAc-conjugated 5-10-5 MOE gapmer with uniform PS internucleoside linkages, complementary to human AGT RNA
[0690]
[0691]
[0692] Example 2: Dose-dependent in vitro inhibition of human AGT in HepG2 cells
[0693] Cultured HepG2 cells at a density of 10,000 cells per well were treated with modified oligonucleotides diluted to different concentrations as specified in the following tables by electroporation. After a treatment period of approximately 24 hours, AGT RNA levels were measured using the human AGT primer-probe set RTS3721 (described above). The AGT RNA levels were normalized relative to human GAPDH expression levels using the primer-probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO:9; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO:10; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO:11). The results are presented in the following tables as the percentage of AGT inhibition relative to untreated control cells. As used herein, the value '0' indicates that treatment with the modified oligonucleotide does not inhibit AGT mRNA levels.
[0694] Table 7
[0695] Multi-dose determination of modified oligonucleotides in HepG2 cells
[0696]
[0697]
[0698] Example 3: Tolerance of modified oligonucleotides targeting human AGT in CD-1 mice
[0699] CD1 mice are a versatile mouse model commonly used in safety and efficacy testing. Mice were treated with modified oligonucleotides selected from the above studies, and changes in the levels of various plasma chemical markers were evaluated.
[0700] Treatment
[0701] Groups of 6- to 8-week-old male CD-1 mice were injected subcutaneously with 15 mg / kg of the modified oligonucleotide once a week for six weeks (a total of 7 treatments). A group of male CD-1 mice was injected with saline. The mice were euthanized 72 hours after the last administration.
[0702] Plasma chemical markers
[0703] To evaluate the effect of the modified oligonucleotides on liver function, the plasma levels of blood urea nitrogen (BUN), albumin, alanine transaminase (ALT), aspartate transaminase (AST), creatinine (CREA), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below.
[0704] Table 8
[0705] Plasma chemical markers in male CD-1 mice
[0706]
[0707]
[0708] Blood samples obtained from the mouse groups at week 6 were sent to IDEXX BioResearch for blood cell count measurements. The counts taken included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), and platelets (PLT). The results are presented in the tables below.
[0709] Table 9
[0710] Blood cell counts in male CD-1 mice
[0711]
[0712] Mouse body weights were measured on day 1 and day 35, and the average body weight of each group is presented in the table below. Liver, spleen, and kidney weights were measured at the end of the study and are presented in the table below. Any modified oligonucleotides that caused organ weight changes outside the expected range of the modified oligonucleotides were excluded from further study.
[0713] Table 10
[0714] Body weight and organ weight (g)
[0715]
[0716] Example 4: Tolerance of Modified Oligonucleotides Targeting Human AGT in Sprague-Dawley Rats
[0717] Sprague-Dawley rats are a versatile model for safety and efficacy assessment. Rats were treated with Ionis-modified oligonucleotides from the studies described in the above examples, and changes in the levels of various plasma chemical markers were evaluated.
[0718] Study 1
[0719] Treatment
[0720] Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina regular rat chow ad libitum. Four Sprague-Dawley rats per group were each injected subcutaneously with 15 mg / kg of Ionis oligonucleotide weekly for 6 weeks (a total of 6 doses). Seventy-two hours after the last dose, the rats were euthanized; and organs, urine, and plasma were harvested for further analysis.
[0721] Plasma chemical markers
[0722] To evaluate the effect of Ionis oligonucleotide on liver function, the plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured, and the results are presented in the following table in IU / L. The plasma levels of total bilirubin (TBIL), creatinine, albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and the results are also presented in the following table.
[0723] Table 11
[0724] Plasma chemical markers in Sprague-Dawley rats
[0725]
[0726] Organ weights
[0727] Liver, heart, spleen, and kidney weights were measured at the end of the study and are presented in the following table.
[0728] Table 12
[0729] Organ weights (g)
[0730]
[0731] Renal function
[0732] To evaluate the effect of Ionis-modified oligonucleotides on kidney function, urinary total protein and creatinine levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The ratio of total protein to creatinine (P / C ratio) is presented in the table below.
[0733] Table 13
[0734] Ratio of Total Protein to Creatinine in Sprague-Dawley Rats
[0735]
[0736] Study 2
[0737] Treatment
[0738] Male Sprague-Dawley rats were maintained on a 12-hour light / dark cycle and fed Purina regular rat chow ad libitum. Four Sprague-Dawley rats per group were each injected subcutaneously with 15 mg / kg of Ionis oligonucleotide once a week for 6 weeks (a total of 6 doses). Seventy-two hours after the last dose, the rats were euthanized; and organs, urine, and plasma were harvested for further analysis.
[0739] Plasma Chemical Markers
[0740] To evaluate the effect of Ionis oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured, and the results are presented in the table below in IU / L. Plasma levels of total bilirubin (TBIL), creatinine, albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and the results are also presented in the table below.
[0741] Table 14
[0742] Plasma Chemical Markers in Sprague-Dawley Rats
[0743]
[0744] Organ Weights
[0745] Liver, heart, spleen, and kidney weights were measured at the end of the study and are presented in the table below.
[0746] Table 15
[0747] Organ Weights (g)
[0748]
[0749] Renal function
[0750] To evaluate the effect of Ionis - modified oligonucleotides on renal function, urinary total protein and creatinine levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The ratio of total protein to creatinine (P / C ratio) is presented in the table below.
[0751] Table 16
[0752] Ratio of total protein to creatinine in Sprague - Dawley rats
[0753]
[0754] Example 5: Activity of a Modified Oligonucleotide Complementary to Human AGT in Transgenic Mice
[0755] Dr. Curt Sigmund's laboratory developed a transgenic AGT mouse model by inserting a 14 - kb transgenic construct containing the entire human angiotensinogen gene (approximately 11.5 kb) along with 5' (1.2 kb) and 3' (1.4 kb) flanking sequences (Yang G et al., 1994. J Biol Chem 269(51):32497 - 502), and used this model to further test the modified oligonucleotides described above.
[0756] Treatment
[0757] AGT transgenic mice were grouped with 2 mice per group. Each mouse was injected subcutaneously with 2.7 mg / kg of the modified oligonucleotide (on day 0 and day 7, a total of 2 doses). A group of 2 mice received saline as a negative control. Additionally, a group of 2 mice received 3.3 mg / kg of the comparative modified oligonucleotide 757456 (on day 0 and day 7, a total of 2 doses). Three days after the last dose (day 10), the mice were sacrificed. Liver and plasma were collected for analysis.
[0758] RNA and Protein Analysis
[0759] RNA was extracted from liver tissue for real - time PCR analysis to measure the amount of AGT RNA using the human primer - probe set RTS3721 (described above). The results are presented as the percentage of AGT RNA inhibition relative to the saline control, which is relative to as measured by RIBOGRE The measured total RNA content was normalized. Additionally, plasma was extracted to measure the human AGT protein level in plasma using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). The results are presented as the percentage of AGT protein inhibition relative to the saline control.
[0760] Table 17
[0761] Reduction of human AGT RNA and protein in transgenic mice
[0762]
[0763] Example 6: Efficacy of modified oligonucleotides complementary to human AGT RNA in transgenic mice, multiple doses
[0764] In the transgenic mouse model described above, the modified oligonucleotides were further tested in a dose-dependent manner.
[0765] Treatment
[0766] AGT transgenic mice were grouped with 2 mice per group. Each mouse was subcutaneously injected with two doses (on day 0 and day 7) of the modified oligonucleotide at the concentrations indicated in the table below. A group of 4 mice received PBS as a negative control. At 72 hours (day 10) after the last dose, the mice were euthanized. Liver and plasma were collected for analysis. Compound No. 757456 was added as a comparative compound in some studies.
[0767] Study 1
[0768] RNA and protein analysis
[0769] RNA was extracted from liver tissue for real-time PCR analysis to measure the amount of AGT RNA using the human primer-probe set RTS3721 (described above). The results are presented as the percentage of AGT RNA inhibition relative to the saline control, which was normalized relative to the total RNA content measured as The measured total RNA content was normalized. Additionally, plasma was extracted to measure the human AGT protein level in plasma using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). The results are presented as the percentage of AGT protein inhibition relative to the saline control.
[0770] Table 18
[0771] Reduction of human AGT RNA and protein in transgenic mice (%)
[0772]
[0773]
[0774]
[0775] Study 2
[0776] RNA and Protein Analysis
[0777] RNA was extracted from liver tissues for real-time PCR analysis to measure the amount of AGT RNA using the human primer-probe set RTS3721 (described above). The results are presented as the percentage of AGT RNA inhibition relative to the saline control, which is normalized relative to the total RNA content as measured by . Additionally, plasma was extracted to measure the human AGT protein level in plasma using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). The results are presented as the percentage of AGT protein inhibition relative to the saline control.
[0778] Table 19
[0779] Reduction of Human AGT RNA and Protein in Transgenic Mice
[0780]
[0781]
[0782] Study 3
[0783] RNA and Protein Analysis
[0784] RNA was extracted from liver tissues for real-time PCR analysis to measure the amount of AGT RNA using the human primer-probe set RTS3721 (described above). The results are presented as the percentage of AGT RNA inhibition relative to the saline control, which is normalized relative to the total RNA content as measured by . Additionally, plasma was extracted to measure the human AGT protein level in plasma using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). The results are presented as the percentage of AGT protein inhibition relative to the saline control. As used herein, the value '0' indicates that treatment with the modified oligonucleotide does not inhibit AGT levels.
[0785] Table 20
[0786] Reduction of Human AGT RNA and Protein in Transgenic Mice
[0787]
[0788]
[0789] Example 7: In Vitro Dose-Dependent Inhibition of Human AGT in Transgenic Mouse Hepatocytes
[0790] The transgenic AGT mouse model described above was used in this study. In primary mouse hepatocytes isolated from these transgenic mice, the modified oligonucleotides described in the above studies were tested for their inhibition of AGT RNA at various doses.
[0791] Primary mouse transgenic hepatocytes were plated at a density of 20,000 cells / well and treated by free uptake with diluted modified oligonucleotides at different concentrations as specified in the following tables. After overnight incubation, the AGT RNA levels were measured using the human AGT primer-probe set RTS3721 (forward sequence CCCTGATGGGAGCCAGTGT, designated herein as SEQ ID NO:3; reverse sequence AGCAGGGAGAAGCCCTTCA, designated herein as SEQ ID NO:4; probe sequence CCCTGGCTTTCAACACCTACGTCCACT, designated herein as SEQ ID NO:5). Additionally, the human AGT RNA levels were measured using a second human AGT primer-probe set RTS4039 (forward sequence GGACAAGGTGGAGGGTCTCA, designated herein as SEQID NO:6; reverse sequence AGATCCTTGCAGCACCAGTTG, designated herein as SEQ ID NO:7; probe sequence ATGAAGAAACTATCTCCCCGGACCATCCA, designated herein as SEQ ID NO:8) to confirm the data. The AGT RNA levels were normalized relative to the total RNA content as measured by R The AGT RNA levels were normalized relative to the total RNA content as measured by R. The results are presented in the following tables as the percentage of AGT inhibition relative to untreated control cells. As used herein, the value '0' indicates that treatment with the modified oligonucleotide does not inhibit the AGT mRNA level. The half-maximal inhibitory concentration (IC 50 ) of each modified oligonucleotide is also presented. Using nonlinear regression, the 4-parameter variable slope method of log(inhibitor) vs. response was used, with the bottom and top values fixed at 0 and 100, respectively, to calculate the IC 50 (Prism).
[0792] Table 21
[0793] Multi-Dose Assay of Modified Oligonucleotides in Primary Mouse Hepatocytes
[0794]
[0795] Table 22
[0796] Multi-dose determination of modified oligonucleotides in primary mouse hepatocytes
[0797]
[0798] Example 8: Dose-dependent ex vivo inhibition of human AGT
[0799] The kit is a commercially available liver model system obtainable from BIOIVT and consists of micro-patterned hepatocyte "islands" co-cultured with supportive stromal cells. Prior to treatment, the 96-well HepatoPac plates were equilibrated in fresh maintenance medium at 37 °C and 10% CO 2 for 48 hours. The modified oligonucleotides were diluted to the concentrations described in the following table in the maintenance medium for 48 hours. After 48 hours, the medium was replaced with fresh maintenance medium without additional oligonucleotides. Cell lysates were collected 96 hours after oligonucleotide addition and analyzed by RT-PCR using the primer-probe set RTS3721 (described above). The results are presented in the following tables as the percentage of AGT inhibition relative to untreated control cells. As used herein, the value '0' indicates that treatment with the modified oligonucleotide does not inhibit AGT mRNA levels. The IC 50 was calculated using a variable slope 4-parameter logistic regression in Prism, with the bottom and top values of the curve set to 5 and 100, respectively.
[0800] Table 23
[0801] Multi-dose determination of modified oligonucleotides in cells
[0802]
[0803] Example 9: Effects of modified oligonucleotides targeting human AGT in cynomolgus monkeys
[0804] Cynomolgus monkeys were treated with modified oligonucleotides selected from the studies described in the above examples.
[0805] Treatment
[0806] Prior to the study, the monkeys were kept in isolation, followed by an adaptation period during which the general health of the animals was observed daily. The monkeys were 2 - 4 years old and weighed 2 - 4 kg. Nine groups of 4 randomly assigned male cynomolgus monkeys were each subcutaneously injected with Ionis oligonucleotide or saline in a clockwise rotation between four different sites on the back. After the loading doses on Day 1, Day 4, and Day 8, 20 mg / kg of Ionis oligonucleotide was administered to the monkeys once a week (on Day 15, Day 22, Day 29, Day 36, Day 43, Day 50, Day 57, Day 64, Day 71, Day 78, and Day 85). A control group of 4 cynomolgus monkeys was injected with 0.9% saline in a similar manner and used as a control group.
[0807] During the study, the monkeys were observed at least once daily for signs of illness or distress. Any animal showing signs of severe debilitation or toxicity, especially if it appeared near death, was humanely euthanized as soon as possible after consulting the attending veterinarian. On Day 87, approximately 48 hours after the last dose, the animals were euthanized by exsanguination under deep anesthesia. The protocol described in the examples was approved by the Institutional Animal Care and Use Committee (IACUC).
[0808] Body weight and organ weight measurements
[0809] To evaluate the effect of Ionis oligonucleotide on the overall health of the animals, body weight and organ weight were measured. Terminal body weight was measured prior to necropsy. Organ weights were also measured, and all weight measurements are presented in the table below.
[0810] Table 24
[0811] Body weight and organ weight (g)
[0812]
[0813]
[0814] Kidney and liver function
[0815] To evaluate the effects of Ionis oligonucleotides on liver and kidney function, blood samples were collected from all study groups on Day 87. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulants for serum separation. The tubes were kept at room temperature for at least 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. The levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Corporation, Japan). Plasma levels of blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), albumin (ALB), globulin (GLO), albumin / globulin (A / G) ratio, alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin (TBIL) were measured, and the results are presented in the table below.
[0816] Table 25
[0817] Liver function markers in cynomolgus monkey plasma
[0818]
[0819]
[0820] Pro-inflammatory protein analysis
[0821] To evaluate any inflammatory effects of Ionis-modified oligonucleotides in cynomolgus monkeys, blood samples were collected for analysis. The monkeys were fasted overnight prior to blood collection. On Day 85 (before dosing and 24 hours after dosing), approximately 0.8 mL of blood was collected from each animal and placed in tubes without anticoagulants for serum separation. The tubes were kept at room temperature for at least 90 min and then centrifuged at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 was measured using a Toshiba 120FR NEO chemistry analyzer (Toshiba Corporation, Japan). Another inflammatory marker, C-reactive protein (CRP), was tested along with the clinical chemistry parameters tested above for liver function.
[0822] Table 26
[0823] Pro-inflammatory protein analysis in cynomolgus monkeys
[0824]
[0825] Hematology
[0826] To evaluate any effects of Ionis-modified oligonucleotides on cynomolgus monkey hematology parameters, blood samples of approximately 0.5 mL of blood were collected from each available study animal on Day 87. The samples were collected in tubes containing K 2Into the tube with -EDTA. Use the ADVIA 2120i hematology analyzer (Siemens, USA) to analyze the red blood cell (RBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelet count (PLT), white blood cell (WBC) count, and individual white blood cell counts (such as the counts of monocytes (MON), neutrophils (NEU), and lymphocytes (LYM)) of the samples.
[0827] Table 27
[0828] Hematological counts of cynomolgus monkeys
[0829]
[0830] Urinalysis
[0831] One day before collecting fresh urine, remove the food overnight but supply water. On day 87, collect fresh urine samples (first morning urine) from all animals using clean cage trays on wet ice for urinalysis and urine chemistry. Urinalysis / urine chemistry parameters include urine creatinine (UCRE), protein / creatinine (P / C) ratio, urinary total protein (UTP), and urinary microalbumin (UALB), and these parameters are measured using a Toshiba 120FR automated chemistry analyzer (Toshiba Corporation, Japan).
[0832] Table 28
[0833] Urinalysis and urine chemistry markers of cynomolgus monkeys
[0834]
Claims
1. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence of at least 14, at least 15 or at least 16 contiguous nucleobases comprising any one of the nucleobase sequences of SEQ ID NO: 12-15, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
2. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence of at least 14, at least 15 or at least 16 contiguous nucleobases complementary to: An equally long portion of nucleobases 2046-2061 of SEQ ID NO: 1; An equally long portion of nucleobases 2271-2286 of SEQ ID NO: 1; An equally long portion of nucleobases 2272-2287 of SEQ ID NO: 1; wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
3. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 12, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
4. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 13, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
5. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 14, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
6. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide, the modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified internucleoside linkages.
7. The oligomeric compound according to any one of claims 1-6, wherein when measured over the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequence of either SEQ ID NO: 1 or SEQ ID NO:
2.
8. The oligomeric compound according to any one of claims 1-7, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.
9. The oligomeric compound according to claim 8, wherein the bicyclic sugar moiety has a 4'-2' bridge, and the 4'-2' bridge is selected from -CH 2 -O- and -CH(CH 3 )-O-.
10. The oligomeric compound according to any one of claims 1-9, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.
11. The oligomeric compound according to claim 10, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
12. The oligomeric compound according to any one of claims 1-11, wherein the modified oligonucleotide comprises at least one sugar surrogate.
13. The oligomeric compound according to claim 12, wherein the sugar surrogate is any one of morpholino, modified morpholino, PNA, THP, and F-HNA.
14. The oligomeric compound according to any one of claims 1-13, wherein the modified oligonucleotide is a gapmer.
15. The oligomeric compound according to claim 14, wherein the modified oligonucleotide has a sugar motif comprising: a 5' region consisting of 1-6 linked 5' region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3' region consisting of 1-6 linked 3' region nucleosides; wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and at least 6 of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
16. The oligomeric compound according to claim 14, wherein the modified oligonucleotide has a sugar motif comprising: a 5' region consisting of 1-6 linked 5' region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3' region consisting of 1-6 linked 3' region nucleosides; wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety.
17. The oligomeric compound according to claim 14, wherein the modified oligonucleotide has a sugar motif comprising: a 5' region consisting of 3 linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3' region consisting of 3 linked 3' region nucleosides; wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a sugar moiety modified with 2'-MOE or cEt, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.
18. The oligomeric compound according to claim 14, wherein the modified oligonucleotide has a sugar motif comprising: a 5' region consisting of 3 linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3' region consisting of 43 linked 3' region nucleosides; wherein Each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a sugar moiety modified with 2'-MOE or a sugar moiety modified with cEt, and at least 6 of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
19. The oligomeric compound according to any one of claims 1-18, wherein the modified oligonucleotide has a glycosyl motif (5' to 3') selected from: eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddydddddddkkk, kkkddddddddddkkk or eeeeeddddddddddeeeee; wherein 'e' represents a 2'-MOE sugar moiety, 'k' represents a cEt sugar moiety, 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'y' represents a 2'-OMe sugar moiety.
20. The oligomeric compound according to any one of claims 1-19, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
21. The oligomeric compound according to claim 20, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
22. The oligomeric compound according to claim 20 or claim 21, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
23. The oligomeric compound according to any one of claims 20 and 22, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
24. The oligomeric compound according to any one of claims 20, 22 and 23, wherein each internucleoside linkage is a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
25. The oligomeric compound according to claim 21, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
26. The oligomeric compound according to any one of claims 1-20 or 22-24, wherein the modified oligonucleotide has an internucleoside linkage motif of soossssssssssos; wherein, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
27. The oligomeric compound according to any one of claims 1-26, wherein the modified oligonucleotide comprises at least one modified nucleobase.
28. The oligomeric compound according to claim 27, wherein the modified nucleobase is 5-methylcytosine.
29. The oligomeric compound according to any one of claims 1-28, wherein the modified oligonucleotide is composed of 14-30, 14-22, 14-20, 14-18, 14-20, 15-17, 15-25 or 16-20 linked nucleosides.
30. The oligomeric compound according to any one of claims 1-28, wherein the modified oligonucleotide is composed of 16 linked nucleosides.
31. The oligomeric compound according to any one of claims 1-30, wherein the oligomeric compound comprises a conjugating group.
32. The oligomeric compound according to claim 31, wherein the conjugating group comprises a GalNAc cluster containing 1-3 GalNAc ligands.
33. The oligomeric compound according to any one of claims 31 and 32, wherein the conjugating group comprises a conjugation linker consisting of single bonds.
34. The oligomeric compound according to any one of claims 31-33, wherein the conjugating group comprises a cleavable linker.
35. The oligomeric compound according to any one of claims 31-34, wherein the conjugating group comprises a conjugation linker containing 1-3 linker nucleosides.
36. The oligomeric compound according to any one of claims 31-35, wherein the conjugating group is linked to the modified oligonucleotide at the 5'-nucleoside of the modified oligonucleotide.
37. The oligomeric compound according to any one of claims 31-35, wherein the conjugating group is linked to the modified oligonucleotide at the 3'-nucleoside of the modified oligonucleotide.
38. The oligomeric compound according to any one of claims 1-37, wherein the oligomeric compound is a single-stranded oligomeric compound.
39. The oligomeric compound according to any one of claims 1-30, wherein the oligomeric compound consists of the modified oligonucleotide.
40. An oligomeric compound according to the following chemical structure: (SEQ ID NO:12), or a salt thereof.
41. An oligomeric compound according to the following chemical structure: (SEQ ID NO:12).
42. An oligomeric compound according to the following chemical structure: (SEQ ID NO:13), or a salt thereof.
43. An oligomeric compound according to the following chemical structure: (SEQ ID NO:13).
44. An oligomeric compound according to the following chemical structure: (SEQ ID NO:14), or a salt thereof.
45. An oligomeric compound according to the following chemical structure: (SEQ ID NO:14).
46. An oligomeric compound according to the following chemical structure: (SEQ ID NO:15), or a salt thereof.
47. An oligomeric compound according to the following chemical structure: (SEQ ID NO:15).
48. The oligomeric compound according to any one of claims 40, 42, 44 and 47, wherein the oligomeric compound is a sodium salt or a potassium salt.
49. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e (SEQ ID NO:12) Wherein: A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
50. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T es m C ko G ko G ds T ds T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T e (SEQ ID NO:13) Wherein: A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
51. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G k s T ks m C ks G ds G ys T ds T ds G ds G ds A ds A ds T ds T ds m C ks T ks T k (SEQ ID NO:15) Wherein: A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, k = cEt sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, y = 2'-OMe ribose moiety, and s = phosphorothioate internucleoside linkage.
52. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: T ks m C ko G ko G ds U ys T ds G ds G ds A ds A ds T ds T ds m C ds T ko T ks T k (SEQ ID NO:14) Wherein: A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, U = uracil nucleobase, k = cEt sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, y = 2'-OMe ribose moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
53. The oligomeric compound according to any one of claims 49 - 52, said oligomeric compound comprising the modified oligonucleotide covalently linked to a conjugating group.
54. An oligomeric duplex comprising the oligomeric compound according to any one of claims 1 - 53.
55. An antisense compound comprising, consisting of, or consisting essentially of the oligomeric compound according to any one of claims 1 - 53 or the oligomeric duplex according to claim 54.
56. A chirally enriched population of the oligomeric compound according to any one of claims 40 - 53, wherein the population is enriched in compounds comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.
57. The chirally enriched population according to claim 56, wherein the population is enriched in compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.
58. The chirally enriched population according to claim 56, wherein the population is enriched in compounds comprising at least one specific phosphorothioate internucleoside linkage having an (Rp) configuration.
59. The chirally enriched population according to claim 56, wherein the population is enriched in compounds having a specifically and independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.
60. The chirally enriched population according to claim 56, wherein the population is enriched in compounds having an (Sp) configuration at each phosphorothioate internucleoside linkage or modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.
61. The chirally enriched population according to claim 56, wherein the population is enriched in compounds having an (Rp) configuration at one specific phosphorothioate internucleoside linkage and an (Sp) configuration at each remaining phosphorothioate internucleoside linkage.
62. The chirally enriched population according to claim 56, wherein the population is enriched in compounds having at least 3 adjacent phosphorothioate internucleoside linkages in the 5' to 3' direction having Sp, Sp, and Rp configurations.
63. A population of the oligomeric compound according to any one of claims 40 - 53, wherein all phosphorothioate internucleoside linkages of the oligomeric compound are atactic.
64. A pharmaceutical composition, the pharmaceutical composition comprising an oligomeric compound as described in any one of claims 1 - 53, an oligomeric duplex as described in claim 54, an antisense compound as described in claim 55, or a population as described in any one of claims 56 - 63, and a pharmaceutically acceptable carrier or diluent.
65. A method, the method comprising administering to an individual the pharmaceutical composition as described in claim 64.
66. A method for treating a disease associated with the RAAS pathway, the method comprising administering to an individual suffering from a disease associated with the RAAS pathway or at risk of suffering from said disease a therapeutically effective amount of the pharmaceutical composition according to claim 64, thereby treating the disease associated with the RAAS pathway.
67. The method according to claim 66, wherein the disease is a cardiovascular disease.
68. The method according to any one of claims 66 and 67, wherein the disease is selected from hypertension, resistant hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.
69. The method according to any one of claims 66 - 68, wherein at least one symptom or sign of the disease is improved.
70. The method according to claim 69, wherein the symptom or sign is any one of the following: hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, preeclampsia, vascular aneurysm, abdominal aneurysm, peripheral arterial disease, organ damage, or pulmonary arterial hypertension.
71. The method according to any one of claims 65 to 70, wherein the pharmaceutical composition is administered systemically.
72. The method according to any one of claims 65 to 71, wherein the pharmaceutical composition is administered subcutaneously or intramuscularly.
73. Use of an oligomeric compound as described in any one of claims 1 - 53, an oligomeric duplex as described in claim 54, an antisense compound as described in claim 55, or a population as described in any one of claims 56 - 63, for reducing AGT expression in cells.
74. The use according to claim 73, wherein the level of AGT RNA is reduced.
75. The use according to claim 73, wherein the level of AGT protein is reduced.
76. An oligomeric compound according to the following chemical structure: (SEQ ID NO:12), or a salt thereof.
77. The oligomeric compound according to claim 76, wherein the oligomeric compound is a sodium salt or a potassium salt.
78. An oligomeric compound according to the following chemical structure: (SEQ ID NO:12).
79. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es G eo m C ko T ds G ds A ds T ds T ds T ds G ds T ds m C ds m C ds G ko G ks G e (SEQ ID NO:12) Wherein: A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.
80. The oligomeric compound according to claim 79, wherein the oligomeric compound comprises the modified oligonucleotide covalently linked to a conjugating group.
81. A population of oligomeric compounds as claimed in claim 76, wherein all phosphorothioate internucleoside linkages of the oligomeric compounds are atactic.
82. A pharmaceutical composition comprising the oligomeric compound as claimed in claim 76 and a pharmaceutically acceptable carrier or diluent.
83. The pharmaceutical composition as claimed in claim 82, wherein the pharmaceutically acceptable diluent is water or PBS.
84. A pharmaceutical composition comprising the population as claimed in claim 81 and a pharmaceutically acceptable carrier or diluent.
85. A population of oligomeric compounds as claimed in claim 77, wherein all phosphorothioate internucleoside linkages of the oligomeric compounds are atactic.
86. A pharmaceutical composition comprising the oligomeric compound as claimed in claim 77 and a pharmaceutically acceptable carrier or diluent.
87. The pharmaceutical composition as claimed in claim 86, wherein the pharmaceutically acceptable diluent is water or PBS.
88. A pharmaceutical composition comprising the population as claimed in claim 85 and a pharmaceutically acceptable carrier or diluent.
89. A population of oligomeric compounds as claimed in claim 78, wherein all phosphorothioate internucleoside linkages of the oligomeric compounds are atactic.
90. A pharmaceutical composition comprising the oligomeric compound as claimed in claim 78 and a pharmaceutically acceptable carrier or diluent.
91. The pharmaceutical composition as claimed in claim 90, wherein the pharmaceutically acceptable diluent is water or PBS.
92. A pharmaceutical composition comprising the population as claimed in claim 89 and a pharmaceutically acceptable carrier or diluent.
93. A population of oligomeric compounds as claimed in claim 79, wherein all phosphorothioate internucleoside linkages of the oligomeric compounds are atactic.
94. A pharmaceutical composition comprising the oligomeric compound as claimed in claim 79 and a pharmaceutically acceptable carrier or diluent.
95. The pharmaceutical composition as claimed in claim 94, wherein the pharmaceutically acceptable diluent is water or PBS.
96. A pharmaceutical composition comprising the population as claimed in claim 93 and a pharmaceutically acceptable carrier or diluent.
97. A population of oligomeric compounds as claimed in claim 80, wherein all phosphorothioate internucleoside linkages of the oligomeric compounds are atactic.
98. A pharmaceutical composition comprising the oligomeric compound as claimed in claim 80 and a pharmaceutically acceptable carrier or diluent.
99. The pharmaceutical composition as claimed in claim 98, wherein the pharmaceutically acceptable diluent is water or PBS.
100. A pharmaceutical composition comprising the population as claimed in claim 97 and a pharmaceutically acceptable carrier or diluent.
Citation Information
Patent Citations
Lipid-based formulations
US20030077829A1
Ligands to enhance cellular uptake of biomolecules
US20030119724A1
Nuclease resistant chimeric oligonucleotides
US20030158403A1
Nuclease resistant chimeric oligonucleotides
US20030175906A1
Modified iRNA agents
US20050164235A1