Small heat shock protein RpHsp22.6 of the bee stink bug and its application
By targeting the RpHsp22.6 gene of the small heat shock protein of the dot beetle, dsRNA was designed and introduced into the body of the dot beetlele, the problems of low prevention and control efficiency and poor environmental protection were solved, and efficient prevention and control of the dot beetlelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelelele
Patent Information
- Application Number
- CN202510601765.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2045-05-12
AI Technical Summary
The prior art has problems of low efficiency and poor environmental protection when preventing and controlling pests of scalybeans, especially the prevention and control of soybean syndrome is difficult to effectively control.
Targeting the RpHsp22.6 gene of the small heat shock protein of the dot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot beetroot bee
It significantly reduces the survival rate and egg laying rate of the syringae bug, effectively reduces the symptoms of soybean syndrome, and provides a more effective and environmentally friendly prevention and treatment method.
Smart Images

Figure CN120118907B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of genetic engineering and agricultural biotechnology, and in particular to use of dsRNA that specifically inhibits RpHsp22.6 gene expression in preparing insecticides. Background Art
[0002] Soybeans have high nutritional value and are a high-quality source of plant protein. Rich in unsaturated fatty acids, vitamins, and dietary fiber, they are an important oilseed crop and source of plant protein. They are also a high-protein dual-purpose crop for food and feed, and a crucial industrial raw material. Soybean "greening syndrome" manifests itself in the late stages of plant growth, where leaves remain dark green, stems remain straight, and many branches may develop. Flowers are rare and the flowering period is longer than normal. Later in the growth cycle, soybeans produce fewer pods, wrinkled grains within pods, and shrunken pods, significantly reducing quality. Pods fail to inflate properly or not at all, resulting in empty pods. Symptoms include "infertile pods," "young pods," and "pods without fruit." Once "greening syndrome" occurs, it can lead to reduced or even complete soybean yields, dampening grower enthusiasm and severely hindering the revitalization of the soybean industry. Therefore, the prevention and treatment of soybean "greening syndrome" is urgent.
[0003] The spotted bee stink bug (Riptortus pedestris), belonging to the class Insecta, order Hemiptera, suborder Heteroptera, is widely distributed and a major agricultural pest of legumes. It is a polyphagous insect that obtains nutrients and water by inserting its piercing-sucking mouthparts directly into plant tissues, such as leaves, stems, flowers, pods, and seeds. This feeding can cause partial necrosis of plant tissues and infection with pathogens, leading to significant reductions in agricultural yield and quality. Multiple studies have shown that the spotted bee stink bug is one of the main causes of soybean greening syndrome (commonly known as "sick greening"). Currently, control of the spotted bee stink bug mainly involves agricultural and chemical control. Agricultural control has certain limitations and is subject to regional and seasonal variations, slow control effects, and inability to quickly control outbreaks of pests, diseases, and weeds. Chemical control is prone to pesticide damage, especially long-term application of the same pesticide, which can lead to pesticide resistance in pests and diseases, pollute the environment, and kill natural enemies. Furthermore, pesticide residues can compromise food security.
[0004] RNA interference (RNAi), a self-developed eukaryotic defense mechanism, plays a crucial role in plant growth and development, as well as host antiviral defense. It specifically degrades or inhibits target gene mRNA expression by exogenously introducing small double-stranded RNA molecules (approximately 20-25 nucleotides), thereby reducing or shutting down the expression of specific genes. RNAi offers advantages such as high specificity, ease of use, and high efficiency, promising broad applications. Subsequent experiments have shown that RNAi effects can also be induced in various insects through feeding, injection, or spraying of exogenously synthesized double-stranded RNA (dsRNA). Since then, RNAi technology has opened up new avenues for plant protection. In recent years, researchers have used RNA interference technology to conduct relevant functional studies using the bee-shaped stink bug as an experimental material. For example, Nan's team studied the interaction between chemosensory proteins (CSPs) between the bee-shaped stink bug and host plant volatiles (Gu N et al., 2024), and DesMarteaux's team studied the role of vesicular glutamate transporters in photoperiod regulation, which can promote ovarian development under RNAi interference (Lauren Des Marteaux et al., 2021). However, these studies are more mechanistic explorations of the mechanism of action and are not very applicable.
[0005] Therefore, there is an urgent need for more effective and environmentally friendly prevention and control of bee-margined stink bug pests in the soybean cultivation field. Summary of the Invention
[0006] The technical problem to be solved by the present invention is how to prevent and control the diseases and insect pests of bee-margin stink bugs more effectively and environmentally friendly.
[0007] Based on the above technical problems, the present invention establishes an RNA interference system for Riptortus pedestris and a RpHsp22.6 gene mutant by targeting the small heat shock protein 22.6 (RpHsp22.6) which is essential for the survival of Riptortus pedestris, providing a sequence and data basis for the prevention and control of Riptortus pedestris.
[0008] The present invention solves the technical problem by providing a small heat shock protein RpHsp22.6 from the schizont. The nucleotide sequence encoding the small heat shock protein RpHsp22.6 is shown in SEQ ID NO. 1 or comprises nucleotides having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO. 1. The nucleotide sequence shown in SEQ ID NO. 1 is as follows:
[0009] .
[0010] In another aspect, the present invention relates to a small heat shock protein RpHsp22.6 from a schizont, whose amino acid sequence consists of or is composed of the amino acids set forth in SEQ ID NO. 2, or amino acids having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acids set forth in SEQ ID NO. 2. The amino acid sequence set forth in SEQ ID NO. 2 is as follows:
[0011] MTRNSLIELCSAVVRNLGKQTRISSNYKEVTQKPTNSGFIFDPASSTALQSSGKVLQECGNLNARFDTPSLSSSSLAFLDRTRIGDILLKPLQVMDSTERTSSNFSVEYSDKGMVVEIEMKGYKEEDVSVRVDGPWLVIEGNMTTHVPDKEGGGLMIRNTVRRYEIPPNSDVANIKMKFKNERLTVTVPTLSPTVSIHFGICVT.
[0012] In another aspect, the present invention relates to a method for preparing the aforementioned secretory protein RpHsp22.6 of the bee-margin stink bug, comprising the following steps:
[0013] 1. Extraction of RNA from whole bee stink bugs;
[0014] 1) Take some adult or nymphs of the bee-edge bug and grind them thoroughly in 1 mL of Trizol reagent.
[0015] 2) Then add 400 μL of chloroform, mix vigorously, and let stand on ice for 8-10 minutes;
[0016] 3) Centrifuge at 12,000 rpm at 4°C for 20 min. Carefully transfer the upper aqueous phase to a new 1.5 mL RNase-free centrifuge tube.
[0017] 4) Add an equal volume of isopropanol, mix thoroughly by inversion, and incubate at -20°C for 2 h to precipitate RNA.
[0018] 5) After removal, centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to the precipitate, and centrifuge at 12,000 rpm at 4°C for 5 min. Discard the supernatant. Repeat the above washing steps twice.
[0019] 6) Place on ice for 5 minutes to evaporate the ethanol;
[0020] 7) Add 30 μL of RNase-free water and incubate at 4°C for 2 h to dissolve the sample. Measure the RNA concentration using a NanoDrop.
[0021] 2. Synthesis of cDNA and acquisition of gene fragments of the bee-margin stink bug;
[0022] 1) Reverse transcription of the total RNA obtained by the aforementioned whole-insect RNA extraction method to obtain cDNA of the beetle;
[0023] 2) Design the following primers based on the full-length RpHsp22.6 gene sequence (direction: 5'-3'):
[0024] RpHsp22.6-F: ATGACCAGAAACAGCCTTATAGAATTG (SEQ ID NO.4),
[0025] RpHsp22.6-R: TTAAGTAACACAAATGCCAAAATGTAT (SEQ ID NO.5);
[0026] 3) Using the obtained cDNA as a template, perform PCR amplification of the target gene using the aforementioned primers;
[0027] 4) Separate the PCR amplification products using 1% agarose gel electrophoresis and recover the target DNA using a DNA agarose gel recovery kit;
[0028] 5) The purified RpHsp22.6 gene DNA fragment was ligated to the blunt-end cloning vector pEASY ® -Blunt, transformed into Escherichia coli competent cells Trans1-T1, cultured on LB solid medium containing kanamycin, and obtained monoclonal colonies containing the gene fragment;
[0029] 6) A single clone was selected and expanded in LB liquid medium containing kanamycin, and the plasmid was extracted to obtain the nucleotide sequence of RpHsp22.6 of the bee stink bug. The obtained sequence is shown in SEQ ID NO. 1.
[0030] In another aspect, the present invention relates to a method for synthesizing dsRNA of the RpHsp22.6 gene, the specific steps comprising:
[0031] 1) Synthesize dsRNA using the dsRpHsp22.6 gene fragment containing the T7 promoter as shown in SEQ ID NO. 3 as a template. The reaction system is as follows: 2 µL of 10× reaction buffer, 2 µL of ATP solution, 2 µL of UTP solution, 2 µL of CTP solution, 2 µL of GTP solution, 2 µL of T7 RNA polymerase, 1 µg of DNA template, and RNase-free water to 20 µL. Mix well and incubate at 37°C for 8 h.
[0032] 2) Add 1 µL of DNase to the reaction system to eliminate DNA in the system and react at 37°C for 15 min to obtain dsRNA;
[0033] 3) Denature a portion of the reacted sample at 65°C for 5 min;
[0034] 4) Determine dsRNA concentration using Nanodrop and confirm dsRNA quality by 1% agarose gel electrophoresis;
[0035] 5) Store the remaining dsRNA at -80°C until use.
[0036] In another aspect, the present invention relates to a method for controlling the bee stink bug, comprising feeding or injecting the bee stink bug with dsRNA that specifically inhibits the expression of the RpHsp22.6 gene, wherein the dsRNA is obtained through the above steps.
[0037] In another aspect, the present invention also relates to a method for alleviating soybean greening, comprising spraying exogenously synthesized dsRNA containing the nucleotide sequence shown in SEQ ID NO. 12 on the leaves of crops in the field.
[0038] Compared with the prior art, the present invention has the following beneficial effects: the dsRNA of the present invention can effectively reduce the survival rate of the bee stink bug and significantly reduce the egg-laying rate of the bee stink bug, providing an effective way to prevent and control the bee stink bug and can alleviate soybean green syndrome. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 : Comparison of the effects of dsRNA treatment on the survival rate of the spotted bee stink bug.
[0040] Figure 2 : Schematic diagram of the silencing efficiency of dsRNA on the RpHsp22.6 gene.
[0041] Figure 3 :Schematic diagram of the effect of dsRNA treatment on the egg-laying rate of the spotted bee-margin stink bug. DETAILED DESCRIPTION
[0042] Example 1: Cloning of the RpHsp22.6 gene of the schizontid
[0043] (1) RNA extraction from whole bee-margin stink bugs
[0044] 1) Take some adult or nymphs of the bee-edge bug and grind them thoroughly in 1 mL of Trizol (Acrobio, Cat. No. AG21101).
[0045] 2) Then add 400 μL of chloroform, mix vigorously, and let stand on ice for 8-10 min.
[0046] 3) Centrifuge at 12,000 rpm at 4°C for 20 min. Carefully transfer the upper aqueous phase to a new 1.5 mL RNase-free centrifuge tube.
[0047] 4) Add an equal volume of isopropanol, mix thoroughly by inversion, and incubate at -20°C for 2 h to precipitate the RNA.
[0048] 5) After removal, centrifuge at 12,000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to the precipitate, wash the precipitate, centrifuge at 12,000 rpm at 4°C for 5 min, discard the supernatant, and repeat the above washing steps twice.
[0049] 6) Place on ice for 5 min to evaporate the ethanol.
[0050] 7) Add 30 μL of RNase-free water and incubate at 4°C for 2 h to dissolve the sample. Measure the RNA concentration using a NanoDrop.
[0051] (2) Synthesis of cDNA of the bee-margin stink bug and acquisition of a single clone strain carrying the RpHsp22.6 gene
[0052] 1) The total RNA obtained by the above-mentioned whole insect RNA extraction method of the schizont was reverse transcribed to obtain the cDNA of the schizont.
[0053] 2) Primers were designed based on the full-length RpHsp22.6 gene sequence as follows (direction: 5'-3'). The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.:
[0054] RpHsp22.6-F: ATGACCAGAAACAGCCTTATAGAATTG (SEQ ID NO.4),
[0055] RpHsp22.6-R: TTAAGTAACACAAATGCCAAAATGTAT (SEQ ID NO. 5).
[0056] 3) Using the obtained cDNA as a template, perform PCR amplification of the target gene using the aforementioned primers. The PCR reaction system is as follows: 1 μL of C. punctata cDNA, 1.5 μL of upstream and downstream primers, 1 μL of Phanta® Max Super-Fidelity DNA Polymerase, 25 μL of 2× Phanta® Max Buffer, and 1 μL of dNTP Mix (10 mM each). Finally, add ddH2O to the final volume of the reaction system to 50 μL.
[0057] The PCR reaction program was as follows: 95°C for 3 min; 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 60 s; and 72°C for 10 min.
[0058] 4) The PCR amplification products were separated by 1% agarose gel electrophoresis, and the target DNA was recovered using a DNA agarose gel recovery kit (Shanghai Sangon Biotechnology, SK8131).
[0059] 5) The purified RpHsp22.6 gene DNA fragment was ligated to the blunt-end cloning vector pEASY ® -Blunt (TransGen), transformed into Escherichia coli competent cells Trans1-T1, cultured on LB solid medium containing kanamycin, and obtained monoclonal colonies containing the gene fragment.
[0060] 6) A single colony was selected and expanded in LB liquid medium containing kanamycin. The plasmid was extracted and named pEASY-RpHsp22.6. It was then sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing, resulting in a 615 bp sequence of RpHsp22.6 from the bee stink bug (Psoralea punctata). The resulting sequence is shown in SEQ ID NO. 1.
[0061] Example 2: Synthesis of dsRNA of the RpHsp22.6 gene of the schizontid
[0062] (1) T7 primer PCR amplification and purification
[0063] 1) Using the pEASY-RpHsp22.6 plasmid as a template, amplify the target gene using the following primers with a T7 promoter sequence (5'-3'). The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.
[0064] The amplification reaction system and procedure are the same as above.
[0065] dsRpHsp22.6-F: taatacgactcactatagggCCACTAACTCAGGATTCATCTTC (SEQ IDNO.6),
[0066] dsRpHsp22.6-R: taatacgactcactataggggGTGTAGGTACGGTTACTGTGAG (SEQ ID NO. 7).
[0067] 2) The amplified product was separated by agarose gel electrophoresis and recovered using a DNA agarose gel recovery kit, ultimately obtaining a large, single dsRpHsp22.6 gene fragment containing the T7 promoter. The resulting sequence is shown in SEQ ID NO. 3:
[0068] CCACTAACTCAGGATTCATCTTCGACCCAGCTTCAAGTACAGCTCTGCAAAGTAGTGGGAAGGTCTTGCAAGAATGTGGCAATCTAAATGCACGCTTCGATACTCCTTCTCTCCTCATCCAGCCTGGCTTTTCTCGACAGAACAAGGATTGGAGATATATTGCTAAAGCCGCTCCAAGTCATGGACTCGACTGAAAGGACATCTTCAAATTTCTCTGTGGAATACTCGGATAAA GGAATGGTTGTAGAAATAGAGATGAAAGGCTACAAGGAGGAAGATGTTAGCGTGAGAGTTGACGGCCCATGGCTGGTGATTGAAGGCAACATGACCACCCATGTTCCTGACAAGGAAGGAGGAGGGCTCATGATCCGCAATACCGTCAGGAGGTACGAAATACCGCCCAATTCGGATGTAGCCAACATCAAAATGAAGTTCAAGAACGAGCGACTCACAGTAACCGTACCTACAC.
[0069] (2) Synthesis and purification of dsRNA of the dsRpHsp22.6 gene
[0070] The dsRNA of the dsRpHsp22.6 gene was synthesized and purified using the T7 High Yield RNA Transcription Kit from Novagen Biotech Co., Ltd. The specific method is as follows:
[0071] 1) Synthesize dsRNA using the dsRpHsp22.6 gene fragment containing the T7 promoter obtained by PCR amplification as a template. The reaction system is as follows: 2 µL of 10× reaction buffer, 2 µL of ATP solution, 2 µL of UTP solution, 2 µL of CTP solution, 2 µL of GTP solution, 2 µL of T7 RNA polymerase, 1 µg of DNA template, and RNase-free water to 20 µL. Mix well and incubate at 37°C for 8 h.
[0072] 2) Add 1 µL of DNase to the reaction system to eliminate DNA in the system and react at 37°C for 15 min to obtain dsRNA.
[0073] 3) Denature a portion of the reacted sample at 65°C for 5 min.
[0074] 4) Determine the dsRNA concentration using Nanodrop and confirm the dsRNA quality by 1% agarose gel electrophoresis.
[0075] 5) Store the remaining dsRNA at -80°C until use.
[0076] The dsRNA sequence is shown in SEQ ID NO.12:
[0077] CCACUAACUCAGGAUUCAUCUUCGACCCAGCUUCAAGUACAGCUCUGCAAAGUAGUGGGAAGGUCUUGCAAGAAUGUGGCAAUCUAAAUGCACGCUUCGAUACUCCUUCUCUCCUCAUCCAGCCUGGCUUUUCUCGACAGAACAAGGAUUGGAGAUAUAUUGCUAAAGCCGCUCCAAGUCAUGGACUCGACUGAAAGGACAUCUUCAAAUUUCUCUGUGGAAUACUCGGAUAAA GGAAUGGUUGUAGAAAUAGAGAUGAAAGGCUACAAGGAGGAAGAUGUUAGCGUGAGAGUUGACGGCCCAUGGCUGGUGAUUGAAGGCAACAUGACCACCCAUGUUCCUGACAAGGAAGGAGGAGGGCUCAUGAUCCGCAAUACCGUCAGGAGGUACGAAAUACCGCCCAAUUCGGAUGUAGCCAACAUCAAAAUGAAGUUCAAGAACGAGCGACUCACAGUAACCGUACCUACAC.
[0078] Example 3: Effect of dsRNA of RpHsp22.6 gene introduced into bee stink bugs on insect survival rate
[0079] (1) Microinjection of dsRNA
[0080] 1) Prepare an injection solution using RNase-free water and dilute the dsRNA synthesized in Example 2 to a final concentration of 4000 ng / mL.
[0081] 2) Third-instar nymphs of the bee stink bug were selected and dsRNA was introduced into them using a microinjector under a stereomicroscope. The microinjector parameters were set as follows: injection pressure 1300 Pa, injection time 0.3 s, and compensation pressure 10 Pa.
[0082] 3) Using the same method, dsRNA of the jellyfish green fluorescent protein gene (GFP) was introduced into the body of the dotted bee stink bug as a negative control.
[0083] (2) Effect of injection of dsRpHsp22.6 gene dsRNA on the survival rate of the bee-margin stink bug
[0084] 1) dsRNA-transfected D. spp. were transplanted onto soybean plants. Ten D. spp. were placed per soybean plant, with three replicates. Mortality was recorded daily. D. spp. were maintained at a temperature of 26°C ± 0.5°C, a relative humidity of 50% ± 5%, and a photoperiod of 16 h:8 h (day:night).
[0085] 2) Experimental results are as follows Figure 1 As shown in the data, the survival rate of the bee-necked stink bug introduced with dsRpHsp22.6 gene dsRNA (dsRpHsp22.6) was significantly lower than that of the control (dsGFP), indicating that dsRpHsp22.6 gene dsRNA has potential application value in the control of bee-necked stink bug.
[0086] Example 4: Silencing efficiency of the RpHsp22.6 gene in the bee-margin stink bug after introduction of dsRpHsp22.6
[0087] The bee stink bugs were collected on the third day after the introduction of dsRpHsp22.6, and the expression level of the dsRpHsp22.6 gene was measured. The specific method is as follows:
[0088] 1) Grind the collected D. punctatus, extract total RNA using Trizol, and reverse transcribe to obtain D. punctatus cDNA.
[0089] 2) Using Primer Primer 3.0 online software, quantitative primers for the RpHsp22.6 gene of the bee-margin stink bug were designed. The sequences are shown below (5'-3'). The primers were synthesized by Hangzhou Youkang Biotechnology Co., Ltd.
[0090] qRpHsp22.6-F:ATGACCACCCATGTTCCTGA (SEQ ID NO.8),
[0091] qRpHsp22.6-R: TGTAGGTACGGTTACTGTGAG (SEQ ID NO.9),
[0092] qRpGAPDH-F: CTGTTGTAGACCTCACTGTT (SEQ ID NO. 10),
[0093] qRpGAPDH-R:ATATCCGCACTCATTGTCAT (SEQ ID NO. 11).
[0094] 3) Using the cDNA of R. punctata as a template, quantitative RT-PCR (qRT-PCR) was performed with the primers shown above to detect the expression level of the RpHsp22.6 gene. The GAPDH gene of R. punctata was used as an internal reference. The relative expression level of the RpHsp22.6 gene in R. punctata was calculated using the 2-ΔΔCt method to evaluate the silencing efficiency of the RpHsp22.6 gene. The Student's t-test was used to test the significance of the differences among different treatment groups.
[0095] The qRT-PCR reaction system was as follows: 10 μL: 1.5 μg cDNA, 0.3 μL each of 10 μmol / L upstream and downstream primers, 5 μL SYBR qPCR Master Mix, and ddH2O to 10 μL.
[0096] The qRT-PCR reaction program was as follows: 95°C for 3 min; 95°C for 15 s, 60°C for 15 s, and 72°C for 20 s, for 40 cycles.
[0097] The experimental results are as follows Figure 2 As shown in the figure, the expression level of the RpHsp22.6 gene in the bee-margin stink bug introduced with dsRpHsp22.6 was significantly lower than that in the control, indicating that the RpHsp22.6 gene dsRNA has a high silencing efficiency on the RpHsp22.6 gene in the bee-margin stink bug.
[0098] Example 5: Effect of dsRNA of RpHsp22.6 gene introduced into the bee stink bug on the insect's egg-laying rate
[0099] (1) Microinjection of dsRNA
[0100] 1) Prepare the injection solution using RNase-free water and dilute the synthesized dsRNA to a final concentration of 4000 ng / mL.
[0101] 2) Fifth-instar nymphs of the bee-shaped stink bug were selected and dsRNA was introduced into them using a microinjector under a stereomicroscope. The microinjector parameters were set as follows: injection pressure 1300 Pa, injection time 0.3 s, and compensation pressure 10 Pa.
[0102] 3) Using the same method, dsRNA of the jellyfish green fluorescent protein gene (GFP) was introduced into the body of the dotted bee stink bug as a negative control.
[0103] (2) Effect of injection of dsRpHsp22.6 gene dsRNA on the survival rate of the bee-margin stink bug
[0104] 1) Place dsRNA-transfected D. spp. in culture cups. Place a pair of newly emerged D. spp. adults in each cup. Repeat 20 times. Count the egg-laying rate after 15 days. Rearing conditions for D. spp. are: temperature 26°C ± 0.5°C, relative humidity 50% ± 5%, and a 16 h:8 h photoperiod (day:night).
[0105] The experimental results are as follows Figure 3 As shown in the results, the egg-laying rate of the bee-biting stink bug introduced with dsRpHsp22.6 gene dsRNA was significantly lower than that of the control (dsGFP), indicating that dsRpHsp22.6 gene dsRNA has potential application value in the control of bee-biting stink bug.
Claims
1. Use of a dsRNA that specifically inhibits the expression of the RpHsp22.6 gene in the preparation of an insecticide for the treatment of the bee stink bug, wherein the nucleotide sequence of the dsRNA is shown in SEQ ID NO.
12.
2. The use according to claim 1, characterized in that The preparation method of the dsRNA comprises the following steps: 1) Synthesizing dsRNA using the dsRpHsp22.6 gene fragment containing the T7 promoter as shown in SEQ ID NO. 3 as a template, mixing and then performing an amplification reaction; 2) Add DNase to eliminate DNA in the system; 3) Take part of the reaction sample for denaturation treatment; 4) Determine dsRNA concentration and determine dsRNA quality; 5) Storing the dsRNA for future use.
3. A method for alleviating soybean greening, comprising spraying exogenously synthesized dsRNA having a nucleotide sequence as shown in SEQ ID NO. 12 on soybean leaves.
Citation Information
Patent Citations
Emblycoris indica secretory protein RpSP4043 and application thereof in prevention and control of soybean'disease green '
CN115927357A
Non-ATP (adenosine triphosphate) enzyme regulation subunit RpRpn gene of 26S proteasome of Eriomycorus cerinus and application thereof
CN118240849A