MAF vaccine as well as preparation method and application thereof

By developing MAF nasal spray vaccine, using MAF protein and adenovirus vector technology, the problem of difficulty in providing effective local protection of IPF mucosa in the prior art was solved, effective treatment and prevention of f-ILD and IPF were achieved, and good safety and therapeutic efficacy were shown in animal experiments.

CN120131928APending Publication Date: 2025-06-13SICHUAN UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510325170.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

The prior art is difficult to provide effective local mucosal protection against idiopathic pulmonary fibrosis (IPF), and the adenovirus nasal spray vaccine has not yet entered the clinical research stage, mainly due to the complexity of antigen epitopes of fibrotic diseases and the unclear regulatory mechanism of the mucosal immune system.

Method used

A MAF nasal spray vaccine is developed, using MAF protein as a model antigen, constructing a MAF adenovirus vaccine based on adenovirus vector or encapsulating it into a peptide vaccine using TLR7 adjuvant, and activate the mucosal immune system through nasal drop immunity.

Benefits of technology

Effective treatment and prevention of fibrotic interstitial lung disease (f-ILD), especially IPF, was achieved, and the safety and therapeutic efficacy of the vaccine were verified through animal experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120131928A_ABST
    Figure CN120131928A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an MAF vaccine as well as a preparation method and application thereof. In order to develop a nasal spray type vaccine capable of effectively preventing and treating fibrotic interstitial lung diseases and avoiding risk increase caused by local inflammatory reaction, the invention adopts two modes of taking a synthesized MAF protein as a model antigen, encapsulating the MAF protein by using a TLR7 adjuvant to form a peptide fragment vaccine or constructing an MAF adenovirus vaccine based on an adenovirus vector. Two vaccines based on the MAF target spot are successfully constructed. Animal experiment results prove that the two vaccines based on the MAF target spot have treatment and prevention effects on bleomycin-induced mouse pulmonary fibrosis models during nasal dripping immunization, and also have good safety in vivo. A good candidate vaccine is provided for future fibrotic disease prevention and treatment vaccine transformation research and clinical experiment development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to a MAF vaccine, a preparation method thereof, and an application thereof. Background Art

[0002] Fibrotic interstitial lung disease (f-ILD) includes several different clinical entities, which have pathological features of lung injury, inflammation, and fibrosis. Among them, the most clinically studied ones include idiopathic pulmonary fibrosis (IPF) and interstitial lung disease associated with rheumatoid arthritis. Clinically, the prognosis of f-ILD is poor, and clinical data show that its 5-year survival rate is less than 50%. Part of the reason for such a low survival rate is the lack of effective targeted therapies. Although pirfenidone and nintedanib have been approved by the US Food and Drug Administration (FDA) for the treatment of IPF, these drugs can only slow down the progression of fibrosis, rather than effectively treat or even reverse fibrosis. Therefore, there is an urgent need to study a new generation of vaccines that can effectively treat f-ILD.

[0003] Previously, the applicant developed a peptide vaccine for the prevention and treatment of pulmonary fibrosis. As described in patent CN118955693A, it uses the traditional vaccine immunization method: intramuscular injection to induce a systemic immune response. Although this peptide vaccine can effectively treat and prevent pulmonary fibrosis diseases, this immunization method is difficult to provide effective mucosal local protection against IPF.

[0004] Adenovirus vectors have advantages such as a wide host range, a large capacity for carrying foreign genes, high infection efficiency, no integration with the host genome, and low genotoxicity. They can continuously and stably express the target antigen and activate innate immunity without the assistance of adjuvants, thereby simultaneously stimulating antigen-specific cellular and humoral immunity. Some studies have shown that after adenovirus vectors target lung fibroblasts, they can form a persistent protection in the lungs and delay or even reverse the fibrosis process.

[0005] However, currently, no adenovirus nasal spray vaccine targeting fibrosis-related antigens has entered the clinical research stage. This technical gap mainly stems from the complexity of fibrosis disease antigen epitopes and the unclear regulatory mechanism of the mucosal immune system on non-respiratory target organs. From the perspective of the mechanism of action, adenovirus nasal spray vaccines complete antigen uptake through M cells in nasal-associated lymphoid tissue (NALT), and then activate local CD8+ T cells and IgA-secreting B cells to form mucosal immune memory. This dual-channel immune activation characteristic gives it significant advantages in preventing pathogens transmitted through the mucosal route, but also increases the risk of local inflammatory reactions. Therefore, studying a nasal spray vaccine that can effectively treat and prevent f-ILD, especially IPF, and avoid the increased risk caused by local inflammatory reactions is of great significance for treating and even reversing fibrosis. Summary of the Invention

[0006] In order to develop a nasal spray vaccine that can effectively treat and prevent fibrotic interstitial lung disease (f-ILD), especially idiopathic pulmonary fibrosis (IPF), and avoid the increased risks caused by local inflammatory reactions, the present invention provides a MAF nasal spray vaccine, its preparation method and application.

[0007] To achieve the above application objectives, the technical solutions adopted in this application are as follows:

[0008] In a first aspect, the present invention provides a MAF vaccine, which is a MAF adenovirus vaccine constructed based on an adenovirus vector using the MAF protein as a model antigen and / or a peptide vaccine encapsulated with auxiliary components; the gene sequence of the model antigen contains the amino acid sequence shown in SEQ ID NO:1.

[0009] SEQ ID NO:1: ALISNSHQL.

[0010] Among them, the dosage form of the MAF vaccine is a nasal drops, injection, spray or inhalant. Preferably, the dosage form of the MAF vaccine is nasal drops.

[0011] The “and / or” in the above MAF vaccine refers to a single MAF adenovirus vaccine, a single MAF peptide vaccine, or a mixture of a MAF adenovirus vaccine and a MAF peptide vaccine.

[0012] Furthermore, the MAF adenovirus vaccine contains a recombinant MAF adenovirus vector, which contains a foreign gene encoding the MAF protein antigen, and the amino acid sequence of the MAF protein antigen is shown in SEQ ID NO:2, or has more than 80% homology with SEQ ID NO:2 and has the same or similar biological activity.

[0013] SEQ ID NO:2:

[0014] MASELAMSNSDLPTSPLAMEYVNDFDLMKFEVKKEPVETDRIISQCGRLIAGGSLSSTPMSTPCSSVPPSPSFSAPSPGSGSEQKAHLEDYYWMTGYPQQLNPEALGFSPEDAVEALISNSHQLQGGFDGYARGAQQLAAAAGAGAGASLGGSGEEMGPAAAVVSAVIAAAAAQSGAGPHYHHHHHHAAGHHHHPTAGAPGAAGSAAASAGGAGGAGGGGPASAGGGGGGGGGGGGGGAAGAGGALHPHHAAGGLHFDDRFSDEQLVTMSVRELNRQLRGVSKEEVIRLKQKRRTLKNRGYAQSCRFKRVQQRHVLESEKNQLLQQVDHLKQEISRLVRERDAYKEKYEKLVSSGFRENGSSSDNPSSPEFFM。

[0015] Furthermore, the nucleotide sequence corresponding to the MAF protein is shown as SEQ ID NO:3.

[0016] SEQ ID NO:3:

[0017] ATGGCATCAGAACTGGCAATGAGCAACTCCGACCTGCCCACCAGTCCCCTGGCCATGGAATATGTTAATGACTTCGATCTGATGAAGTTTGAAGTGAAAAAGGAACCGGTGGAGACCGACCGCATCATCAGCCAGTGCGGCCGTCTCATCGCCGGGGGCTCGCTGTCCTCCACCCCCATGAGCACGCCGTGCAGCTCGGTGCCCCCTTCCCCCAGCTTCTCGGCGCCCAGCCCGGGCTCGGGCAGCGAGCAGAAGGCGCACCTGGAAGACTACTACTGGATGACCGGCTACCCGCAGCAGCTGAACCCCGAGGCGCTGGGCTTCAGCCCCGAGGACGCGGTCGAGGCGCTCATCAGCAACAGCCACCAGCTCCAGGGCGGCTTCGATGGCTACGCGCGCGGGGCGCAGCAGCTGGCCGCGGCGGCCGGGGCCGGTGCCGGCGCCTCCTTGGGCGGCAGCGGCGAGGAGATGGGCCCCGCCGCCGCCGTGGTGTCCGCCGTGATCGCCGCGGCCGCCGCGCAGAGCGGCGCGGGCCCGCACTACCACCACCACCACCACCACGCCGCCGGCCACCACCACCACCCGACGGCCGGCGCGCCCGGCGCCGCGGGCAGCGCGGCCGCCTCGGCCGGTGGCGCTGGGGGCGCGGGCGGCGGTGGCCCGGCCAGCGCTGGGGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGGGGCGCGGCGGGGGCGGGGGGCGCCCTGCACCCGCACCACGCCGCCGGCGGCCTGCACTTCGACGACCGCTTCTCCGACGAGCAGCTGGTGACCATGTCTGTGCGCGAGCTGAACCGGCAGCTGCGCGGGGTCAGCAAGGAGGAGGTGATCCGGCTGAAGCAGAAGAGGCGGACCCTGAAAAACCGCGGCTATGCCCAGTCCTGCCGCTTCAAGAGGGTGCAGCAGAGACACGTCCTGGAGTCGGAGAAGAACCAGCTGCTGCAGCAAGTCGACCACCTCAAGCAGGAGATCTCCAGGCTGGTGCGCGAGAGGGACGCGTACAAGGAGAAATACGAGAAGTTGGTGAGCAGCGGCTTCCGAGAAAACGGCTCGAGCAGCGACAACCCGTCCTCTCCCGAGTTTTTCATGTGA。

[0018] Further, the adenovirus vector is selected from replication-defective adenoviruses of human type 5, type 35, type 26, and / or chimpanzee AdC68, AdC7.

[0019] Preferably, it is a replication-defective human type 5 adenovirus lacking E1 and / or E3.

[0020] Further, the recombinant adenovirus vector contains a CMV promoter for driving the expression of foreign genes.

[0021] Further, the nucleotide sequence of the CMV promoter is as shown in SEQ ID NO:4.

[0022] SEQ ID NO:4: Derived sequence of mCMV

[0023] GAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCAATTAAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAAGGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATATTGGCACGCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATAAGAGGCGCGACCAGCGTCGGTACCGTCGCAGTCTTCGGTCTGACCACCGTAGAACGCAGATC。

[0024] Furthermore, the active ingredient of the MAF adenovirus vaccine is MAF adenovirus, and the adenovirus is obtained by transfecting a recombinant MAF adenovirus vector into packaging cells to obtain a replication-defective recombinant adenovirus, and then amplifying and purifying it.

[0025] Furthermore, the shuttle plasmid used for the MAF adenovirus is selected from at least one of the plasmids of the pENTR-ATTL, pDC516, pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pShuttle, pShuttle-CMV, pCTAP-Shuttle series plasmids, pNTAP-Shuttle series plasmids, pAdTrack, pAdTrack-CMV, pacAd5 series plasmids, pHBAd series plasmids or pXC1 plasmid.

[0026] Furthermore, the backbone plasmid used for the MAF adenovirus is selected from at least one of AD5-ATTR, pBHGfrtdelE13FLP, pBHGloxdelE13cre, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10i.

[0027] Further, the packaging cells are selected from at least one of HEK293A, PER.C6, HeLa, A549 or HT 1080.

[0028] Further, the MAF peptide vaccine contains the MAF peptide, and the amino acid sequence of the peptide is shown in SEQ ID NO: 1.

[0029] Further, the adjuvant component in the peptide vaccine is the immune adjuvant 1V209-Cho-Lip liposome.

[0030] The 1V209-Cho-Lip liposome is a TLR7 liposome prepared from cholesterol-modified 1V209 molecule 1V209-Cho, lipid components and cholesterol, and the structural formula of 1V209-Cho is shown in Formula II;

[0031] Formula II:

[0032] Further, 1V209 is a synthetic small molecule TLR7 agonist, and its structural formula is shown in Formula I,

[0033] Formula I:

[0034] Further, the lipid component is at least one of lecithin, hydrogenated lecithin or synthetic phospholipid.

[0035] Preferably, the lipid component is soy lecithin or hydrogenated soy lecithin.

[0036] Most preferably, the lipid component is hydrogenated soy lecithin (HSPC).

[0037] In a second aspect, the present invention provides the application of the above MAF vaccine in the prevention and / or treatment of fibrotic interstitial lung disease (f-ILD).

[0038] Further, the f-ILD includes at least one of idiopathic pulmonary fibrosis (IPF) or interstitial lung disease associated with rheumatoid arthritis.

[0039] In a third aspect, the present invention provides a method for preparing the MAF adenovirus in the above MAF vaccine, comprising the following steps:

[0040] Insert the foreign gene encoding the MAF protein antigen into the adenovirus shuttle plasmid, then co-transfect the shuttle plasmid and the backbone plasmid of the adenovirus system into the host cell for packaging of the recombinant adenovirus, obtain the replication-defective recombinant adenovirus, and then expand the culture and purify it.

[0041] Furthermore, the nucleotide sequence of the exogenous gene encoding the MAF protein antigen is as shown in SEQ ID NO:3.

[0042] Furthermore, the 5' end of the exogenous gene contains a CMV promoter for initiating the transcription of the exogenous gene.

[0043] In the fourth aspect, the present invention provides a method for preparing the MAF peptide vaccine in the above MAF vaccine, which includes the following steps: uniformly encapsulating the peptide in a lipid delivery carrier.

[0044] Beneficial effects: The present invention uses the synthetic MAF protein as a model antigen, and constructs two MAF adenovirus vaccines based on the adenovirus vector or encapsulates it with a TLR7 adjuvant to form a liposomal peptide vaccine in two ways, successfully constructing two vaccines based on the MAF target, and verifying the therapeutic and preventive effects of the two vaccines on f-ILD, especially IPF, through animal experiments. The experimental results prove that the two vaccines based on the MAF target have therapeutic and preventive effects on the bleomycin-induced mouse pulmonary fibrosis model during intranasal immunization, and also have good safety in vivo. It provides good candidate vaccines for the translational research and clinical trials of preventive and therapeutic vaccines for future fibrotic diseases. Description of the Drawings

[0045] Figure 1 It is a result diagram of the MAF antigen as a potential target for the pulmonary fibrosis vaccine in Example 1: A) Immunohistochemical diagrams of MAF in normal human lungs, IPF human lungs, normal mouse lungs, and fibrotic mouse lungs; B) Immunofluorescence diagrams of the MAF protein expression levels in normal and fibrotic mouse lung tissues; C) Single-cell transcriptome data analysis diagram of the MAF expression in different cells.

[0046] Figure 2 It is a result diagram of the MAF peptide vaccine treating mouse pulmonary fibrosis by intranasal injection in Example 3: Among them, first is the flow chart of the MAF peptide vaccine intranasal immunotherapy for treating mouse pulmonary fibrosis; A) Mouse body weight changes; B) Mouse lung coefficient; C) Ashcroft score and Szapiel score; D) H&E staining diagram of mouse lung tissue; E) Masson staining diagram of mouse lung tissue; F) Immunohistochemical diagrams of α-SMA and Colla1 in mouse lung tissue; G) Relative expression levels of Acta2, Col1α1, and Fn1 genes in mouse lung tissue detected by real-time fluorescence quantitative PCR (qRT-PCR).

[0047] Figure 3Results graph of the prevention of pulmonary fibrosis in mice by intranasal immunization with the MAF peptide vaccine in Example 4; among them, first is the flow chart of the prevention of pulmonary fibrosis in mice by intranasal immunization with the MAF peptide vaccine; A) Changes in mouse body weight; B) Mouse survival curve; C) Mouse lung coefficient; D) H&E staining map of mouse lung tissue; E) Masson staining map of mouse lung tissue; F) Immunohistochemical map of α-SMA and Colla1 in mouse lung tissue; G) Relative expression levels of Col1α1 and Fn1 genes in mouse lung tissue detected by qRT-PCR; H) Protein expression levels of Collagen1, α-SMA, and Fibronectin in mouse lung tissue detected by Western-blot, with VINCULIN as an internal reference.

[0048] Figure 4 Results graph of the treatment of pulmonary fibrosis in mice by intranasal immunization with the MAF adenovirus vaccine in Example 5: Among them, A) Changes in mouse body weight; B) Mouse survival curve; C) Mouse lung weight; D) H&E staining map of mouse lung tissue; E) Masson staining map of mouse lung tissue; F) Relative expression levels of Col1α1 and Fn1 genes in mouse lung tissue detected by qRT-PCR; G) Protein expression levels of Collagen1 and Fibronectin in mouse lung tissue detected by Western-blot, with VINCULIN as an internal reference.

[0049] Figure 5 Results graph of the in vivo safety evaluation of the MAF peptide vaccine in Example 6: Among them, A) Complete blood cell count of mice, including neutrophils, monocytes, eosinophils, basophils, red blood cells (RBC), hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin content (MCH), mean corpuscular hemoglobin concentration (MCHC), B) Detection of serum biochemical indicators of mice, including albumin (ALB2), alkaline phosphatase (ALP2L), alanine aminotransferase (ALTL), amylase (AMY-P), cholesterol (CHO2L), creatine kinase isoenzyme MB (CKMB), blood glucose (GLUC), high-density lipoprotein cholesterol (HDLC), lactate dehydrogenase (LDH2), low-density lipoprotein cholesterol (LDLC3).

[0050] Figure 6 Results graph of the in vivo safety evaluation of the MAF peptide vaccine in Example 6 after H&E staining of mouse organs: heart, liver, spleen, lung, kidney, small intestine, skin, and bone muscle. Detailed implementation methods

[0051] To make the technical problems to be solved, technical solutions and beneficial effects of this application more clear and understandable, the following further details this application in combination with embodiments. Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those of ordinary skill in the art.

[0052] Traditional vaccine immunization is intramuscular injection to induce systemic immune responses, but it is difficult to provide effective mucosal local protection against IPF. Mucosal immunity can make up for this shortcoming. Nasal spray vaccine is an immunotherapeutic means of delivering antigens through the nasal mucosa. It shows potential in infectious diseases, tumor treatment and infectious diseases by activating mucosa-associated lymphoid tissue (MALT) and systemic immune responses. Based on this, in one embodiment of the present invention, an immune peptide library was established using lung tissues from clinical IPF patients and healthy subjects, and the MAF protein highly expressed in fibrotic lung tissues was screened out. By encapsulating it with TLR7 adjuvant to form a peptide liposome vaccine and using intranasal immunization, its therapeutic and preventive effects on a bleomycin-induced mouse model of pulmonary fibrosis were studied.

[0053] Adenoviral vectors have advantages such as a wide host range, a large capacity for carrying foreign genes, high infection efficiency, no integration with the host genome, and low genotoxicity. They continuously and stably express the target antigen and activate innate immunity without the assistance of adjuvants; different from the mechanism of dendritic cell (DC) vaccines that rely on antigen-presenting cells to activate T cells, adenoviral vectors directly infect host cells and highly express the target antigen, thereby activating both humoral and cellular immune responses simultaneously. At the same time, previous clinical trials have also confirmed the good safety of adenovirus vaccines. Adenoviral vectors can also activate mucosal-associated invariant T cells (MAIT) in a T cell receptor (TCR)-independent manner, promote their proliferation and secretion of various cytokines and cytotoxic molecules, and cascade enhance the antigen-specific T cell immune response induced by the vaccine. Therefore, in one embodiment of the present invention, an adenoviral vector is selected as the suitable delivery vector for the pulmonary fibrosis vaccine.

[0054] Although adenoviral vectors show potential in presenting tumor neoantigens, no adenovirus nasal spray vaccine targeting fibrosis-related antigens has entered the clinical research stage. This technical gap mainly stems from the complexity of fibrosis disease antigen epitopes and the unclear regulatory mechanism of the mucosal immune system on non-respiratory target organs. From the perspective of the mechanism of action, adenovirus nasal spray vaccine completes antigen uptake through M cells in nasal-associated lymphoid tissue (NALT), and then activates local CD8+ T cells and IgA-secreting B cells to form mucosal immune memory. This dual-channel immune activation characteristic gives it significant advantages in preventing pathogens transmitted through the mucosal route, but also increases the risk of local inflammatory reactions.

[0055] Based on this, in an embodiment of the present invention, a replication-defective adenovirus vector modified by genetic engineering is adopted, and the immunogenicity of the vector protein is reduced by codon optimization. Specifically: taking MAF as a model antigen, a MAF adenovirus vaccine is constructed through a replication-defective adenovirus vector, and the nasal spray immunization method is used to evaluate its therapeutic and preventive efficacy against pulmonary fibrosis disease.

[0056] SEQ ID NO:5: Full-length sequence of MAF (Gene ID: 17132, Uniprot ID: P54843, NCBI reference sequence: NP_001020748.2)

[0057]

[0058] GCTCACCTTTGAACCGGGCCATCAATTGCCTGTATATATATTTTTTCTTCTTCTTCTTCAGC

[0059] TCATGAGCTGGTGTTCATTCTGTGTGTGTGTGTTTGTGTGTTTTATTTTGTTTGGATTTTCT

[0060] TTTTTCTTCTTCTTCTTCTTTGTTTTTGTTTATTATTACTATTACTAATTTTTTGGAGCTTGC

[0061] TGTGTTTCCCAGCCTCTGCCACCCCCCACCCCCACCCCTGCACCATGTTCTTGAGATAAA

[0062] AGGAAAAAAAAAAAAAGCAGGGTTTTTTTTTCCCCTCCTTCTGAGTTCTTCTGATTGAG

[0063] CTTGCAAAGGAAAAAAAAATGTGAAATGCTATAGACCTTGCAGCGAGCTGAGTTCCAC

[0064] GGGGGTTTTATCTTAGCATTGTTATGCTAAAACAGAATGAACTAAAGCCACTCCTGAACC

[0065] TGCCACAATCAAGCCTACATCAACCTTCTGGGTGTGACTTGTGAGTTTTGGCCTTATGAT

[0066] GCCAAATCTGAAAGTTTAGTCTGCCATTAAACAACAAACAAACAAAAACACAAAAACA

[0067] AACTTACTCTCATCTCATGCATTACGATGCTTGCTACTTTGTCTTAGCAACAATGAACTAT

[0068] AACAGTTTCAAAGACATTATGGAAAAGAGACATTATATTAATAAAAGAAGCCTGCATGCT

[0069] GGACATGTATGGTATAATTATTTTTTTCCTTTTTTTTCCCCCCAATTTGGCTTGGAAATGGA

[0070] CTTTTGAAGACTTAGCGCATGACATCCATACTTTTGATTTACAGCCTCATGACTTTTTTGA

[0071] GTTCCAAACAACAACAGAAAAAGTACAACCCCAGAGCCTTCTTCCCTTGACAGTTTGCT

[0072] TCTACTCCTGACTGCTTTGAGTTACAATGAACTTCAGCCTCCCGTTGTACATGCACTGAA

[0073] GGCGTTCCTTGTCAAAGATAGCAGAATGGGCTACAAATTTATATGGCAAATATTATAGAA

[0074] CGTAAATTAAATGTTTTCTTTTTAGAAACAATGATGCCTGCTTTGGGGCACTTTAAATTGT

[0075] GCTATTGCCAAAAGCAGTCTAAATTTTCTTTGAAAAGAAAGAAAAAAAAAATCTGCCCC

[0076] AATTATTTTTTGGTTGGTTTTATTTTTTTTTATTTTATTTTTTCTATTTTTTTTTTAATTTTTTT

[0077] GGTTTTTGGTCATTGTCAAATGTGGAATGCTATGGGTTTCTAGTATATAATTTAATTCTAGA

[0078] TTTTATAATCTGTTAGCCCAGTTAAAATGTATGCTACAGATAAAGGAATGTTATAGATACAT

[0079] TTGAAAGAGTTAGGTCTGTGTAGCTGTAGATTTTTTTAAAGACCGATGCACTAAATTGTT

[0080] TACTGTTGTGATGTTAAGGGGGGTAGAGTTTGCAAGGGGACTGTTTAAAAAGTAGCTTT

[0081] CTGAAGCATGTGCTTGCAACTTAAATATAAGTTGGGTATGTGTAGTTCTTGCTATACCATG

[0082] GACTGTATTGAAAACCAAAGTATTAAAAGGGGAAATGCCCCTGTTTATATCTGTAGGGGT

[0083] ATTTTACATTCAAAATGTATGTTTTTTTCCAAAATTAAAGTATTTGGGACTGAATTGCACT

[0084] AAGATATAACCTGCAAGCATATAATACAAAAAAAAATCGCAAAAACTGTTTAGAACGCT

[0085] AATAAAATTTATGCAGTTATAAAATGGCATTACTGCACAGTTTTAAAGTGATGCAGATTTT

[0086] TTACAGTTATGTTGTGGTGCAGAACTGGATTTTCTGTAACTTAAAAAAATCCACAGTTTT

[0087] AAAGGCAATAACCAGTAAATGTTATTTTCAGGGACTGACATCCTGTCTTAGAAAGAAAG

[0088] AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAGGA

[0089] AAGGAAATCTTACCACAATAAATATAAGAAATCTTGTCAGTTACTTTTCTTTTACATATTT

[0090] TGCTGTGCAAAATTGTTTTATAACTTGAGTTACTAACTAACCACGCGTGACGTTCTACAT

[0091] GCTTCTCTTTCATTTTCAATTCTGGTTATATCAAGAGAAAGAATAATCTACAATAATAAAC

[0092] TGCATTTTTTTTGATTC。

[0093] Specific embodiments will be listed below to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. For those not specified in the embodiments regarding specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0094] The main materials used in the following embodiments are as follows:

[0095] Bleomycin (HY-108345) was purchased from MedChemExpress. Antibody Rabbit Anti-c-Maf Polyclonal Antibody (#bs-5977R) was purchased from Beijing Protein Innovation Co., Ltd. Antibody HRP-conjugated anti-rabbit IgG (7074) was purchased from Cell Signaling Technology. Antibody rabbit polyclonal anti-α-smooth muscle actin (α-SMA) (14395-1-A) was purchased from Wuhan Sanying Biotechnology Co., Ltd. Antibody rabbit polyclonal anti-Collagen I alpha1 (501352) was purchased from Chengdu Zhengneng Biotechnology Co., Ltd. Fluorescent secondary antibody goat anti-rabbit AF488, goat anti-rabbit AF647 (A27040) was purchased from Invitrogen.

[0096] Male C57BL / 6 mice (weighing 26-28 g) were purchased from Vital River Laboratories (Beijing, China). The experiments were carried out after the mice were adaptively fed for one week. The mice were housed in the SPF-class animal house of the State Key Laboratory of Biotherapy, Sichuan University. All experimental protocols were reviewed and approved by the Laboratory Animal Management Committee of Sichuan University (Chengdu, Sichuan).

[0097] The main detection methods used in the following embodiments are as follows:

[0098] 1. Immunohistochemical staining

[0099] Immunohistochemical staining was performed according to the instructions of the Histonstain-SP kit (ZSGB-BIO, SPN-9002) with minor adjustments. The specific steps were as follows: After dewaxing and rehydrating the paraffin sections, antigen retrieval was carried out. Subsequently, the sections were permeabilized with 0.2% Triton X-100 (Sigma Aldrich, 9036-19-5) and non-specific binding sites were blocked with 10% goat serum (Solarbio, SL038). 100 μL of the primary antibody was added and incubated at 37 °C for 1 hour. After incubation, the sections were washed three times with PBS for 5 minutes each time. Then, 100 μL of biotinylated goat anti-rabbit IgG was added and incubated at room temperature for 10 - 15 minutes. After washing three times with PBS again, 100 μL of the working solution of streptavidin labeled with horseradish peroxidase (HRP) was added and incubated at room temperature for 10 - 15 minutes. The color reaction was carried out using freshly prepared diaminobenzidine (DAB) (5 - 8 minutes at room temperature), followed by counterstaining the cell nuclei with hematoxylin for 30 seconds and rinsing with tap water for 5 minutes. After the sections were dried, they were mounted with neutral balsam (Solarbio, G8590). The primary antibodies used in this experiment included: α-SMA (Abcam, ab7817, 1:1000) and Col1α1 (Abcam, ab270993, 1:1000). All images were acquired using a PANNORAMIC digital slide scanner (3DHISTECH, PANNORAMIC MIDI II).

[0100] 2. Immunofluorescence

[0101] The expression of MAF in sections of normal and fibrotic lung tissues of humans and mice was detected by immunofluorescence experiments. First, the lung tissue sections were dewaxed and baked in an oven at 65 °C for 2 hours; immersed in xylene for 10 minutes and repeated 3 times; immersed in gradient ethanol. The sections were boiled in a microwave oven at high power for 3 minutes and maintained at low power for 15 minutes, then taken out and cooled naturally to room temperature. The residual washing solution on the slides was removed, and the sample areas on the slides were outlined with a histochemical pen. The blocking solution was added and incubated with shaking at room temperature for 10 minutes. The blocking on the slides was removed, and the MAF antibody (Bioss, bs-5977r, diluted 1:500) was added to ensure complete immersion of the sample areas, and incubated with shaking at room temperature for 1 hour. The slides were immersed in PBST for 3 minutes and repeated once. Then, the mounting medium containing DAPI was added, and a coverslip was covered to seal the slides, avoiding air bubbles. The slides were sealed with an anti-fluorescence quencher, and finally the expression of MAF was observed under a Zeiss 880 confocal microscope.

[0102] 3. Histopathology, Hematoxylin & Eosin (H&E) staining and Masson staining

[0103] (1) Specimen collection, dehydration, embedding, sectioning

[0104] After the fresh tissue sampling is completed, each tissue and organ is immersed in 4% paraformaldehyde for at least 2 days. The tissue is taken out of the fixative and trimmed flat at the target site with a scalpel in a fume hood. The trimmed tissue and the corresponding label are placed in a dehydration cassette. After the tissue is washed with water, gradient dehydration can be carried out in the order of 70%, 80%, 90%, 95% and 100% alcohol (absolute ethanol), and the dehydration time for each stage is 30 minutes. The tissue impregnated with wax is embedded in a paraffin embedding machine (Leica) and cooled on the cold stage of the automatic tissue embedding machine (Leica). After the wax solidifies, the wax block is taken out of the embedding frame and trimmed. The trimmed wax block is placed on a paraffin slicer and sliced at a thickness of 3 μm. The slices are floated on the warm water at 40 °C of a spreading machine to flatten the tissue, picked up with a glass slide, and put into an oven at 60 °C for baking. After the water is baked dry and the wax is melted, it is taken out and stored for standby at room temperature or 4 °C.

[0105] (2) Deparaffinization and hydration

[0106] First, place the slices on the copper slice rack in an orderly manner and bake the slices at 65 - 70 °C in a spreading machine for 30 minutes to dissolve the wax layer. Then deparaffinize with xylene 3 times, 10 minutes each time. Subsequently, perform gradient hydration in alcohol in the order of absolute ethanol, 95%, 85% and 75%, and the hydration time for each stage is 5 minutes. After hydration is completed, transfer the slices to a histochemistry box and wash twice with ddH 2 O for 5 minutes each time. Immerse the slices in a histochemistry box containing 200 mL of 1× antigen retrieval solution, transfer it to a pressure cooker, and after the pressure cooker boils and steams for 10 - 12 minutes, take out the histochemistry box and let it cool naturally at room temperature. Wash twice with 1× PBS on a shaker for 5 minutes each time.

[0107] (3) H&E staining

[0108] After the paraffin sections are processed according to the above steps, use an H&E staining kit (Beyotime, C0105S) to stain the tissue. Generally, hematoxylin staining is carried out for 5 - 10 minutes, then immersed in tap water and rinsed to remove the excess dye, and washed once with ddH 2 O. Eosin staining is carried out for 3 - 30 s. The above steps can be adjusted according to the staining results and requirements. After drying at room temperature, seal the slices with neutral resin and scan and analyze them on a pathological slide scanner.

[0109] (4) Masson staining

[0110] After the paraffin sections were processed according to the conventional method, Masson trichrome staining reagent (Beyotime, C0189M) was used for tissue staining. First, stain with Weigert iron hematoxylin staining solution for 5 - 10 minutes. After staining, rinse the sections with tap water to remove the excess stain, and wash once with distilled water. Then, stain with acid fuchsin staining solution for 1 - 3 minutes and wash again with water. Subsequently, perform phosphotungstic acid - brilliant blue staining, and the staining time is generally 5 - 10 minutes, which can be appropriately adjusted according to the tissue type and staining effect. After staining, dehydrate the sections until clean and transparent, and finally mount the sections with neutral resin and perform scanning analysis on a pathological slide scanner.

[0111] 4. Western blot

[0112] Western blot analysis was performed according to the established experimental protocol. For tissue samples, 50 mg of lung tissue was homogenized in 1 mL of RIPA buffer containing 10 μL of phosphatase inhibitor and 10 μL of protease inhibitor, and further ground using a high - speed tissue homogenizer (Servicebio, KZ - II). The homogenized tissue lysate was centrifuged at 13,000 rpm for 10 minutes, and the supernatant was collected. Subsequently, the tissue lysate was mixed with SDS - PAGE sample loading buffer (Beyotime, P0015L), boiled for 10 minutes, and stored at - 80 °C.

[0113] Protein electrophoresis and membrane transfer were performed according to the standard protocol. Protein electrophoresis was carried out using 7.5% SDS-PAGE, and membrane transfer was performed at 370 mA for 2 hours. The PVDF membrane was collected. The PVDF membrane was blocked with 5% skim milk at room temperature for 1 hour. After blocking, the PVDF membrane was incubated with the primary antibody successively, washed with 1×TBST, and incubated with the secondary antibody. The primary antibodies used included: mouse monoclonal anti-Vinculin (Sigma-Aldrich, V9264, 1:1000), rabbit polyclonal anti-α-smooth muscle actin (α-SMA) (Proteintech, 14395-1-AP, 1:2000), rabbit polyclonal anti-Fibronectin (Proteintech, 15613-1-AP, 1:2000), rabbit polyclonal anti-Collagen I alpha 1 (Zenbio, 501352, 1:1000). Vinculin was used as the internal reference protein. The secondary antibodies were HRP-labeled anti-rabbit IgG (Cell Signaling Technology, 7074, 1:5000) and HRP-labeled anti-mouse IgG (Cell Signaling Technology, 7076, 1:5000). Chemiluminescence was performed using Clarity Western ECL Substrate (Bio-Rad, 1705061). Image data were collected by a Western Blot imaging system (e-BLOT).

[0114] 5. Real-time fluorescence quantitative PCR (qRT-PCR) detection

[0115] Total RNA of tissues and cells was extracted using a total cell RNA isolation kit (FOREGENE, RE-03113), and cDNA synthesis was carried out using the RT Easy TM II reverse transcription kit (FOREGENE, RT-01031 / 01032). qRT-PCR detection was performed using a real-time fluorescence quantitative PCR instrument (Bio-Rad, CFX96 Touch TM ). The PCR reaction system included forward primer, reverse primer, Green Supermix (Bio-Rad, iTaq Universal SYBR Green), cDNA, ddH 2 O. The 18sRNA present in all eukaryotic cells was selected as the internal reference gene. The primer sequences for qRT-PCR are shown in Table 1:

[0116] Table 1. Primer Sequences

[0117]

[0118]

[0119] Example 1. MAF Antigen Is a Potential Target for Pulmonary Fibrosis Vaccine

[0120] To evaluate the potential of MAF antigen as a target for pulmonary fibrosis vaccine, we performed immunohistochemical staining on tissue sections of normal human lungs, IPF human lungs, normal mouse lungs, and bleomycin-induced pulmonary fibrosis mouse lungs, and found that MAF antigen was not expressed or limitedly expressed in normal human and mouse lungs ( Figure 1 A), but highly expressed in IPF human lungs and fibrotic mouse lung tissues ( Figure 1 A). Further, we verified by immunofluorescence staining of tissue sections of fibrotic and normal mouse lungs, and the results showed that MAF expression was significantly increased in fibrotic tissues ( Figure 1 B). Analysis of mouse single-cell transcriptome sequencing results showed that the MAF gene was mainly enriched in myeloid cells and fibroblasts in the lungs of bleomycin-induced pulmonary fibrosis mice ( Figure 1 C). Based on the above results, we found that MAF antigen was significantly highly expressed in fibrotic lungs of humans and mice, suggesting that MAF antigen could be used as a target for developing pulmonary fibrosis vaccine.

[0121] Example 2. Preparation of MAF Peptide Vaccine and MAF Adenovirus Vaccine

[0122] To analyze the potential of MAF as a target for fibrosis treatment, we prepared two vaccines based on the MAF target, namely MAF peptide vaccine and MAF adenovirus vaccine, and their preparation processes are described below respectively.

[0123] (I) Preparation of MAF Peptide Vaccine:

[0124] The dry powder of MAF peptide (SEQ ID NO: 1: ALISNSHQL) was purchased from GL Biochem (Shanghai) Ltd., 10 mg / tube;

[0125] TLR7 liposomes include lipid components hydrogenated soy phosphatidylcholine (HSPC), cholesterol, and 1V209-Cho dissolved in absolute ethanol and dimethyl sulfoxide in a molar ratio of 65:32:3 and used as the organic phase (the volume ratio of absolute ethanol and dimethyl sulfoxide is 10:1). Among them, the preparation of 1V209-Cho refers to Patent CN118955693A.

[0126] Dissolve the dry peptide powder completely into a clear and transparent liquid with 1 mL of pure water. Encapulate the aqueous phase containing the MAF peptide and the organic phase containing the TLR7 liposome through a microfluidic instrument at a volume ratio of 3:1. The mass ratio of the peptide to the TLR7 liposome is 5:2. After encapsulation, use an ultrafiltration tube to ultrafilter it in an ultracentrifuge to remove water, organic solvents, and unencapsulated peptides. After completion, adjust the volume to the target volume to complete the preparation of the MAF peptide vaccine.

[0127] (II) Preparation of the MAF adenovirus vaccine:

[0128] 1. The human MAF gene sequence (SEQ ID NO: 3) and the promoter sequence of the MAF gene, which is a derivative sequence of the mCMV sequence (SEQ ID NO: 4), were synthesized by GenScript Biotech Corporation.

[0129] 2. Construct the shuttle plasmid pENTR-ATTL-mCMV-MAF: Obtain the target gene fragment using the PCR method. The primers used for PCR are as follows:

[0130] Forward primer: SEQ ID NO: 12

[0131] ACTATAACGGTCCTAAGGTAGCGAAGATCTGAGTCATTAGGGACTTTCCAATG

[0132] Reverse primer: SEQ ID NO: 13

[0133] CTTTGTACAAGAAAGCTGGGTCTAGACTATCACATGAAAAACTCGGGAGA

[0134] The PCR amplification conditions are as follows:

[0135] 200 ng (1 μl) of the mCMV-MAF template plasmid, 2 μl of the forward primer, 2 μl of the reverse primer, 25 μl of 2*PrimeSTAR mix (Takara, REF, R045A), and 20 μl of ddH 2 O.

[0136] The reaction program is: 98°C for 2 min, <98°C for 20 s, 60°C for 20 s, 72°C for 20 s> for a total of 30 cycles, and 72°C for 5 min.

[0137] The PCR products were verified by DNA agarose gel electrophoresis, and the products obtained by PCR were purified using an agarose gel purification kit (OMEGA, REF, D2500-02); The pENTR-ATTL shuttle plasmid was digested with BglII / XbaI restriction enzymes (NEB, REF, R0144S; NEB, REF, R0145S), verified by DNA agarose gel electrophoresis, and the digested plasmid was purified using an agarose gel purification kit (OMEGA, REF, D2500-02). The target gene was ligated to the pENTR-ATTL shuttle plasmid using homologous recombinase (Vazyme, REF, C112-02), transformed into T1 competent cells, spread on kanamycin LB plates, single colonies were picked for colony PCR identification, and the PCR products were subjected to DNA agarose gel electrophoresis. The positively identified single colonies were verified by sequencing.

[0138] 3. The backbone plasmid (AD5-ATTR) of AD5-mCMV-MAF was selected as adenovirus type 5 and synthesized by GenoWay Biotech Co., Ltd. (Guangzhou). This plasmid lacks the E1 and E3 regions of adenovirus.

[0139] 4. Construct the AD5-mCMV-MAF plasmid. Use the Gateway LR reaction system (Thermo Fisher Scientific, REF, 11791020). The reaction system is as follows:

[0140] AD5-ATTR (300 ng), pENTR-ATTL-mCMV-MAF (150 ng), supplemented with TE buffer to 8 μl, and 2 μl of LR Clonase II.

[0141] Incubate at 25 °C for 1 hour, add 1 μl of proteinase K solution to each sample to terminate the reaction. After brief vortexing, incubate at 37 °C for 10 minutes. Transform into T1 competent cells, spread on ampicillin LB plates, pick single colonies for colony PCR identification, and perform DNA agarose gel electrophoresis on the PCR products. The positively identified single colonies were verified by sequencing.

[0142] 5. Linearize the AD5-mCMV-MAF plasmid. Use the PacI (NEB, REF, R0547L) restriction enzyme to digest and linearize the AD5-mCMV-MAF plasmid. After the digestion reaction, the digested plasmid was purified by the traditional method (phenol, chloroform, isopropanol).

[0143] 6. Obtain AD5-mCMV-MAF adenovirus stock solution. Prepared 293A cells were used as cells. PEI transfection reagent was used for transfection, and the mass ratio of plasmid to PEI was 1:4, where the plasmid was the linearized AD5-mCMV-MAF plasmid. After transfecting cells for about 7 days, the formation of virus plaques can be seen (the cells become round, swollen and translucent, and look like grape clusters). Collect the cell supernatant, and obtain the AD5-mCMV-MAF adenovirus stock solution after repeated freezing and thawing.

[0144] 7. Identification of recombinant adenovirus

[0145] Take 500 μl of viral supernatant and use a DNA extraction kit (QIAGEN, REF, 51104) to extract viral DNA for PCR identification and sequencing verification. The primers used are as follows:

[0146] TEST-F: SEQ ID NO: 14

[0147] ttttggattgaagccaatatgataatgaggg

[0148] TEST-R:SEQ ID NO:15

[0149] cagacacggtctcgtaggtcaaggtagtagag

[0150] PCR amplification conditions were: 2 μl of viral genome, 2 μl of TEST-F, 2 μl of TEST-R, 25 μl of 2*PrimeSTAR mix (Takara, REF, R045A), ddH 2 O 19μl.

[0151] The reaction program was: 98°C for 5 min, <98°C for 20 s, 60°C for 20 s, 72°C for 30 s>, 72°C for 5 min.

[0152] The results of DNA agarose gel electrophoresis showed that the virus strain could be amplified to a single target band with the correct fragment size. The target band was sequenced on the gel block, and the comparison results indicated that the sequencing sequence was completely correct.

[0153] 8. Amplification of AD5-mCMV-MAF adenovirus. HEK293H cells were cultured at 37°C and 5% CO 2 The cells were cultured in suspension on a cell shaker at 1×10 6 The culture was carried out at a density of 6 × 10 6 When the cells reach 6×10 6Inoculate the virus seed at [X] per milliliter. The inoculation ratio is 2% - 4% of the culture volume. About 72 hours after inoculating the virus seed, detect the viability of the cells. When the viability is 60% - 70%, the virus can be harvested. Discard the supernatant, and resuspend the finally harvested cell residue with 50 mL of fresh medium. After repeated freezing and thawing 3 times in an -80°C refrigerator and a 37°C water bath, centrifuge at 3000 rpm for 30 minutes, take the supernatant, and store it at 4°C in the refrigerator for purification.

[0154] 9. Purification of AD5-mCMV-MAF Adenovirus

[0155] Purify the recombinant adenovirus by cesium chloride gradient centrifugation. Prepare cesium chloride solutions with different densities: Solution A at 1.4 g / mL and Solution B at 1.2 g / mL. Lay the solutions with different densities in the ultracentrifuge tube in the order of Solution A, Solution B, and the recombinant adenovirus. Use a Beckmen ultracentrifuge and a SW32 Ti horizontal rotor to centrifuge at 100,000 g for 2 hours, then aspirate the lower virus band. Re-ultracentrifuge the aspirated recombinant adenovirus in the order of Solution A, Solution B, and the recombinant adenovirus again, centrifuge at 100,000 g for 18 hours, aspirate the virus band, and perform dialysis. The dialysis solution is 2 mM magnesium chloride + 10 mM Tris-base + 5% sucrose solution. Use a dialysis bag with a molecular weight cut-off of 14 kDa and a magnetic stirrer rotating at 600 RPM for dialysis. Change the dialysis solution every 6 hours, and perform dialysis 3 times in total. Dialyze the storage medium of the recombinant adenovirus from cesium chloride into the dialysis solution. After dialysis, aliquot the recombinant adenovirus and store it in an -80°C refrigerator for later use.

[0156] 10. Identification of Purified AD5-mCMV-MAF Adenovirus

[0157] PCR amplify the full sequence of the target protein gene and perform sequencing identification. The experimental methods and procedures are the same as in 8. The results of agarose gel electrophoresis show that a single target band can be amplified from all virus seeds, and the fragment size is correct. Recover the target band from the gel and sequence it. The comparison results show that the sequenced sequence is completely correct.

[0158] 11. Determination of Infection Titer

[0159] (1) Use the Takara Adeno-X TM Rapid Titer Kit (Takara, REF, 632250) to determine the titer of the recombinant adenovirus. The operation is carried out according to the instructions attached to the kit. The specific method is as follows:

[0160] 1) Inoculate HEK293 cells into a 24-well plate. The cell density is 2.5×10 5 cells / mL, inoculate 1 mL per well, and the culture medium is DMEM + 10% FBS.

[0161] 2) Use a culture medium to serially dilute the virus to be detected from 10 -2 to 10 -7 times, preparing a series of virus samples with different dilutions. Add 50 μL of each sample to the cells in each well.

[0162] 3) Incubate the cells in a 37 °C, 5% CO₂ incubator for 48 hours.

[0163] 4) Aspirate the culture medium from the cells and let the cells air-dry slightly (but not overly dry). Gently add 0.5 mL of ice-cold methanol to each well and incubate at -20 °C for 10 minutes to fix the cells.

[0164] 5) Aspirate the methanol and gently wash the cells 3 times with PBS + 1% BSA. Add 0.25 mL of anti-Hexon antibody dilution (diluted 1:1000) to each well and incubate at 37 °C for 1 hour.

[0165] 6) Aspirate the anti-Hexon antibody and gently wash the cells 3 times with PBS + 1% BSA. Add 0.25 mL of HRP-labeled Rat Anti-Mouse Antibody (diluted 1:500) to each well and incubate at 37 °C for 1 hour.

[0166] 7) Before aspirating 0.25 mL of the HRP-labeled Rat Anti-Mouse Antibody, dilute the 10× DAB substrate with 1× Stable Peroxidase Buffer to prepare a 1× DAB working solution and let it reach room temperature.

[0167] 8) Aspirate the Rat Anti-Mouse Antibody dilution and gently wash the cells 3 times with PBS + 1% BSA. Add 0.25 mL of the DAB working solution to each well and incubate at room temperature for 10 minutes.

[0168] 9) Aspirate the DAB working solution and gently wash the cells 2 times with PBS.

[0169] 10) Count the brown / black positive cells under a microscope. Randomly count at least 3 fields of view in each well and calculate the average number of positive cells.

[0170] 11) Calculate the infection titer (ifu / mL).

[0171] 12) The formula is as follows: Infection titer (ifu / mL) = Number of positive cells in the field of view × Number of fields of view per well / (Volume of virus (mL) × Dilution factor).

[0172] 13) The results of titer determination showed that after concentration, the infection titer of the purified recombinant adenovirus reached 1 × 10 10 ifu / mL or higher.

[0173] (2) Determination of virus particle number

[0174] Mix equal volumes of 20 mmol / L Tris-HCl, 2 mmol / L EDTA (pH 7.5) solution and 2% SDS solution to prepare a virus lysis solution. Take an appropriate volume of the virus sample to be tested, add 1 / 19 volume of the virus lysis solution, pipette and mix repeatedly 10 times, and vortex for 1 minute. Place it in a 56 °C constant temperature water bath and shake and digest for 10 minutes, centrifuge at 12,000 rpm for 5 minutes, take the supernatant, and measure the OD values at 260 nm and 280 nm. Calculate the number of adenovirus particles. The results of the virus particle number determination show that the purified recombinant adenovirus reaches 1×10 12 VP / mL or more after concentration.

[0175] Example 3. Efficacy experiment of intranasal immunization with MAF peptide vaccine in treating pulmonary fibrosis in mice

[0176] To evaluate the ability of intranasal immunization with MAF peptide vaccine to treat pulmonary fibrosis in mice. As Figure 2 , on days 0, 7, and 14, intranasally inject 20 μL of different drugs (normal saline, 20 μg TLR7, and 50 μg MAF peptide vaccine) into mice respectively. On day 1, establish a mouse pulmonary fibrosis model by retrograde instillation of 50 μL of bleomycin (3 mg / kg) into the back of the mouse tongue. On day 28 after modeling, collect the lung tissues of mice to observe the therapeutic efficacy of the vaccine. It is found that intranasal immunization with MAF peptide vaccine can improve the body weight of mice and can significantly reduce the lung weight of fibrotic mice ( Figure 2 A - B), and the results of pathological sections show that the pulmonary inflammation in the MAF peptide vaccine group is significantly relieved, the Szapiel score is reduced, indicating a reduction in the area of injury and fibrotic alveolitis, and the pulmonary collagen deposition is reduced, and the Ashcroft score is reduced, indicating a reduction in the fibrotic area ( Figure 2 C - E). Type I collagen Colla1 (Collagen1), fibronectin, and α - smooth muscle actin (α - SMA) are markers of pulmonary fibrosis. The immunohistochemical results show that intranasal immunization with MAF peptide vaccine can significantly reduce the deposition and expression of the pulmonary fibrosis markers α - SMA and Colla1 ( Figure 2 F). The qRT-PCR results show that intranasal immunization with MAF peptide vaccine can significantly reduce the relative gene expression levels of pulmonary fibrosis markers, including Acta2, Col1α1, and Fn1 genes ( Figure 2 G). Based on the above results, intranasal immunization with MAF peptide vaccine can effectively treat pulmonary fibrosis in a bleomycin-induced mouse pulmonary fibrosis model.

[0177] Example 4. Efficacy experiment of intranasal immunization with MAF peptide vaccine in preventing pulmonary fibrosis in mice

[0178] To evaluate the ability of intranasal immunization with MAF peptide vaccine to prevent pulmonary fibrosis in mice. As Figure 3 , on days 0, 14, and 21, mice were intranasally immunized with 20 μL of different drugs (saline, 20 μg TLR7, and 50 μg MAF peptide vaccine). On day 22, a mouse model of pulmonary fibrosis was established by retrograde instillation of 50 μL of bleomycin (3 mg / kg) into the posterior part of the tongue of the mice. On day 28 after modeling, the lung tissues of the mice were collected to observe whether intranasal immunization with MAF peptide vaccine had the efficacy of a preventive vaccine. Preventive intranasal immunization with MAF peptide vaccine could improve the body weight and survival curve of mice and significantly reduce the lung weight of fibrotic mice ( Figure 3 A-C). The results of H&E staining and Masson staining showed that preventive intranasal immunization with MAF peptide vaccine significantly alleviated pulmonary inflammation and collagen deposition in fibrotic mice ( Figure 3 D-E). The immunohistochemical results showed that intranasal immunization with MAF peptide vaccine could significantly reduce the expression of pulmonary fibrosis markers Colla1 and α-SMA ( Figure 3 F). The qRT-PCR results showed that intranasal immunization with MAF could significantly reduce the relative expression levels of Col1α1, Fn1, and Acta2 genes ( Figure 3 G). The Western blot results showed that intranasal immunization with MAF could significantly reduce the protein expression levels of Col1α1, Fn1, and α-SMA ( Figure 3 H). Based on the above results, intranasal immunization with MAF peptide vaccine had the efficacy of preventing pulmonary fibrosis in a bleomycin-induced mouse model of pulmonary fibrosis.

[0179] Example 5. Efficacy experiment of intranasal immunization with MAF adenovirus vaccine in treating pulmonary fibrosis in mice

[0180] To evaluate the ability of intranasal immunization with MAF adenovirus vaccine to treat pulmonary fibrosis in mice. We intranasally immunized mice with 20 μL of different drugs (saline, 1×10 9 VP empty adenovirus and 1×10 9 VP MAF adenovirus) on days 0 and 14 respectively. On day 7, a mouse model of pulmonary fibrosis was established by retrograde instillation of 50 μL of bleomycin (3 mg / kg) into the posterior part of the tongue of the mice. On day 35, the lung tissues of the mice were collected to observe whether intranasal immunization with MAF adenovirus vaccine had the efficacy of a therapeutic vaccine. Intranasal immunization with MAF adenovirus vaccine could improve the body weight and survival curve of mice ( Figure 4 A-B), and significantly reduce the lung weight of fibrotic mice ( Figure 4 C). The results of H&E staining and Masson staining showed that therapeutic intranasal immunization with MAF adenovirus significantly alleviated pulmonary inflammation and collagen deposition in fibrotic mice ( Figure 4D-E). In addition, the qRT-PCR results showed that intranasal immunization with MAF could significantly reduce the relative gene expression levels of pulmonary fibrosis markers, including Col1α1 and Fn1( Figure 4 F). Based on the above results, intranasal immunization with the MAF adenovirus vaccine can also effectively treat pulmonary fibrosis in a bleomycin-induced mouse model of pulmonary fibrosis.

[0181] Example 6. Safety evaluation of the MAF peptide vaccine in mice

[0182] To evaluate the safety of the MAF peptide vaccine, mice were intranasally immunized three times with different vaccines (saline, 20 μg TLR7, and 50 μg MAF peptide vaccine) according to the prophylactic vaccine immunization protocol. One week after the third immunization, fresh anticoagulated whole blood and serum were collected. Complete blood count and serum biochemical tests were performed, and there were no statistically significant differences among the blank group, the TLR7 adjuvant group, and the MAF peptide vaccine group( Figure 5 A, 5B). The results of H&E staining of pathological sections showed that there were no obvious pathological changes in the heart, liver, spleen, lung, kidney, small intestine, skin, and skeletal muscle of the immunized mice( Figure 6 ).

Claims

1. A MAF vaccine, characterized in that: The invention uses MAF protein as a model antigen, and is a MAF adenovirus vaccine constructed based on an adenovirus vector and / or a peptide vaccine encapsulated with auxiliary components; the gene sequence of the model antigen contains an amino acid sequence as shown in SEQ ID NO:

1.

2. The MAF vaccine according to claim 1, characterized in that: The MAF vaccine dosage form is nasal drops, injection, spray or inhalation; preferably, the MAF vaccine dosage form is nasal drops.

3. The MAF vaccine according to claim 1 or 2, characterized in that: The MAF adenovirus vaccine contains a recombinant MAF adenovirus vector containing an exogenous gene encoding a MAF protein antigen, the amino acid sequence of which is shown in SEQ ID NO: 2, or has more than 80% homology with SEQ ID NO: 2 and has the same or similar biological activity.

4. The MAF vaccine according to claim 3, characterized in that: The nucleotide sequence corresponding to the MAF protein antigen is shown in SEQ ID NO:

3.

5. The MAF vaccine according to claim 3 or 4, characterized in that: The adenovirus vector is selected from human type 5, type 35, type 26 and / or chimpanzee AdC68, AdC7 replication-deficient adenovirus; preferably, selected from human type 5 replication-deficient adenovirus lacking E1 and / or E3.

6. The MAF vaccine according to claim 5, characterized in that: The recombinant adenovirus vector comprises a CMV promoter, and its nucleotide sequence is shown in SEQ ID NO:

4.

7. The MAF vaccine according to any one of claims 3 to 6, characterized in that: The active ingredient of the MAF adenovirus vaccine is MAF adenovirus, and the adenovirus is obtained by transfecting a recombinant MAF adenovirus vector into packaging cells to obtain a replication-deficient recombinant adenovirus, which is then amplified and purified.

8. The MAF vaccine according to claim 1 or 2, characterized in that: The MAF peptide vaccine contains a MAF peptide, and the amino acid sequence is shown in SEQ ID NO:

1.

9. The MAF vaccine according to claim 8, characterized in that: The auxiliary component in the peptide vaccine is the immune adjuvant 1V209-Cho-Lip liposome.

10. Use of the MAF vaccine according to any one of claims 1 to 9 in preventing and / or treating fibrotic interstitial lung disease.

11. The use according to claim 10, characterized in that: The fibrotic interstitial lung disease comprises at least one of idiopathic pulmonary fibrosis or rheumatoid arthritis-associated interstitial lung disease.

12. The method for preparing the MAF adenovirus in the MAF vaccine according to any one of claims 1 to 7, characterized in that: The method comprises the following steps: inserting an exogenous gene encoding a MAF protein antigen, whose nucleotide sequence is shown in SEQ ID NO: 3, into an adenovirus shuttle plasmid, and then co-transfecting the shuttle plasmid and the backbone plasmid of the adenovirus system into a host cell to package the recombinant adenovirus to obtain a replication-deficient recombinant adenovirus, and then expanding the culture and purifying the adenovirus.

Citation Information

Cited By

  • Anti-fibrotic peptide, vaccine, preparation method for peptide vaccine, and use thereof

    WO2026026264A1