Genetically engineered bacterium and application thereof in production of xylitol
By introducing the xylose reductase gene and xylose transporter gene into Vibrio sodium, genetically engineered bacteria was solved, and the problem that the wild-type Vibrio sodium was unable to use xylose efficiently was achieved, achieving the effect of efficient production of xylitol.
Patent Information
- Application Number
- CN202510593468.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2045-05-09
AI Technical Summary
Wild-type Vibrio requires sodium cannot efficiently use xylose to produce xylitol, and genetic engineering needs to be carried out to improve its metabolic ability to xylitol.
The xylose reductase gene and xylose transporter gene were introduced into Vibrio sodium to construct genetically engineered bacteria to realize the transport and reduction of xylose to xylitol.
A biological pathway that can efficiently metabolize xylitol in Vibrio sodium-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-demand-de
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a genetically engineered bacterium and its application in the production of xylitol. Background Art
[0002] Xylitol is a pentitol naturally present in animal and plant cells. Its physical properties are white solid, crystal or granular, and it is soluble in water. As a sugar substitute with the taste closest to sucrose, xylitol has wide application values in the fields of medicine, food, etc., and also has great application prospects in the fields of chemical industry, new materials, etc. At present, the chemical process for producing xylitol is mature, but it has disadvantages such as high energy consumption and high cost. The biological production of xylitol is expected to replace the traditional chemical route and become the main method for large-scale production of xylitol. Currently, microorganisms reported for the production of xylitol include Escherichia coli, Bacillus subtilis, yeast, and so on.
[0003] Vibrio natriegens is a Gram-negative, non-pathogenic marine bacterium to humans. Its doubling time is 7 - 10 minutes, and its passage speed is twice as fast as that of Escherichia coli. It is the free-living bacterium with the shortest known generation time and may be developed into a characteristic artificial cell factory. Research has found that the number of ribosomes in a single cell of Vibrio natriegens is as high as 115,000, while Escherichia coli only has about 70,000 - 90,000. This means that it has a faster biomass synthesis speed and a stronger protein expression ability. Through comprehensive analysis such as constructing a central metabolism model, detecting biomass components, and high-resolution 13 13C metabolic flux, it is found that Vibrio natriegens has a central metabolism model similar to that of Escherichia coli. Its growth rate in a glucose minimal medium is 1.70 L / h, and the conversion rate is 3.90 g / g / h, which is twice the metabolic rate of Escherichia coli.
[0004] Therefore, Vibrio natriegens is a chassis organism with great potential and can be developed for the production of xylitol. However, wild-type Vibrio natriegens cannot utilize xylose, which is widely available and inexpensive, and needs to be genetically engineered to enable it to efficiently metabolize xylose to produce xylitol. Summary of the Invention
[0005] In view of the existing demand for Vibrio natriegens that can utilize xylose, the present invention provides a genetically engineered bacterium and its application in the production of xylitol. The specific planning scheme is as follows: In the first aspect, the present invention provides a genetically engineered bacterium, including a host cell and a target gene inserted into the host cell. The host cell is Vibrio natriegens; the target genes are xylose reductase gene and xylose transporter gene.
[0006] In the present invention, the xylose reductase gene and the xylose transporter gene are transferred into Vibrio natriegens, and the resulting genetically engineered bacterium can normally express xylose reductase and xylose transporter. Among them, the xylose transporter can transport extracellular xylose into the cell and generate xylitol under the catalysis of intracellular xylose reductase. Using the obtained genetically engineered bacterium to ferment with a medium containing xylose and glucose, xylitol, the product, was detected in the fermentation medium, indicating that a biological pathway for metabolizing xylose to produce xylitol was successfully constructed in Vibrio natriegens.
[0007] Further, the Vibrio natriegens is a wild-type Vibrio natriegens or a wild-type Vibrio natriegens in which the glucose phosphorylation transporter encoding gene ptsG is knocked out.
[0008] Further, an RNA polymerase expression cassette for prokaryotic expression is integrated in the Vibrio natriegens.
[0009] Further, a T7 RNA polymerase expression cassette is integrated in the Vibrio natriegens.
[0010] Further, the T7 RNA polymerase expression cassette is inserted into the Vibrio natriegens genome dns at the locus.
[0011] In the Vibrio natriegens genome, dns the gene encodes a nuclease that degrades intracellular nucleic acids. Inserting at the dns locus can disrupt the dns gene, thereby avoiding the expression of the nuclease and preventing the xylose reductase gene and the xylose transporter gene introduced in this application from being degraded and losing their functions.
[0012] Further, the wild-type Vibrio natriegens is Vibrio natriegens ATCC14048.
[0013] Further, the xylose reductase has an accession number in the NCBI database of AF074484.1, AB002106.1, ALO17776.1, EAA34695.1, AAA99507.1 or Q9P8R5.1.
[0014] Furthermore, the xylose reductase has an accession number in the NCBI database of ALO17776.1.
[0015] Further, the xylose reductase is recombinantly expressed in the form of genomic integration or free plasmid.
[0016] Further, the copy number of the xylose reductase gene is 4 to 7.
[0017] The present invention discovers that for a genetically engineered bacterium expressing the xylose reductase gene in the form of a free plasmid, it has good catalytic ability for xylose. When the xylose reductase gene is expressed in the form of genomic integration, when the copy number of the xylose reductase gene is 4 to 7, the ability of the genetically engineered bacterium to catalyze xylose is superior to that in the form of a free plasmid. When the copy number is less than 4 or greater than 7, the ability of the genetically engineered bacterium using genomic integration to catalyze xylose is significantly worse than that in the form of a free plasmid.
[0018] Further, the xylose transporter gene is a xylose transporter gene derived from bacteria.
[0019] Further, the xylose transporter gene is a xylose transporter gene derived from Escherichia coli W3110 xylE or xylRFGH , the xylose transporter gene araE derived from Bacillus subtilis, or the xylose transporter gene derived from Halomonas HEO0208 .
[0020] In the present invention, the ability of the xylose reductase and xylose transporter transferred into Vibrio natriegens was detected, and it was found that xylose reductases derived from bacteria or fungi can be successfully expressed in Vibrio natriegens and have certain catalytic activities. For the xylose transporter, sources close to Vibrio natriegens at the species level need to be selected, such as Escherichia coli, Bacillus subtilis, and Halomonas among bacteria.
[0021] Further, the Vibrio natriegens is Vibrio natriegens ATCC14048.
[0022] In a second aspect, the present invention provides a method for producing xylitol. Using xylose and glucose as substrates and the genetically engineered bacterium described in claim 1 as a catalyst, a catalytic reaction system is formed to produce xylitol.
[0023] Further, the mass ratio of xylose to glucose is 1 to 4:1.
[0024] Further, the reaction temperature is 25 to 35 °C.
[0025] Compared with the prior art, the present invention has the following beneficial effects: The present invention introduces the xylose transporter gene and the xylose reductase gene into Vibrio natriegens. The obtained genetically engineered bacterium can functionally express and obtain the recombinant xylose transporter, thereby transporting extracellular xylose into the cell and using xylose reductase to convert xylose into xylitol. The present invention has for the first time constructed a Vibrio natriegens genetically engineered bacterium that can utilize xylose and produce xylitol, which is of great significance for the subsequent research on using Vibrio natriegens to produce xylitol. Detailed embodiments
[0026] To enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and only a part of the embodiments of the present invention, rather than all the embodiments.
[0027] All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.
[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in the art and can be obtained through commercial channels. The experimental methods without specified detailed conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers.
[0029] The materials and methods involved in the following examples are as follows: The primer synthesis and sequencing in the examples were all completed by a biological company. The molecular biology experiments in the examples, including plasmid construction, enzyme digestion, preparation of competent cells, transformation, etc., mainly refer to "Molecular Cloning: A Laboratory Manual" (Third Edition), edited by J. Sambrook and D.W. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002). The transformation method and the preparation method of natural competent cells of Vibrio natriegens both refer to the methods disclosed in the literature (Dalia, T. N., et al. Multiplex Genome Editing by Natural Transformation (MuGENT) for Synthetic Biology in Vibrio natriegens . ACS Synth Biol. 2017). Specific experimental conditions can be determined through simple experiments when necessary. The PCR amplification experiment is carried out according to the reaction conditions provided by the plasmid or DNA template supplier or the instructions of the kit. Adjustments can be made through simple experiments when necessary. Vibrio natriegens ATCC14048 was purchased from ATCC.
[0030] Composition of BHIv2 medium: Brain heart infusion broth 37 g / L, NaCl 11.92 g / L, MgCl 2 ·6H 2 O 4.7g / L, KCl 0.31g / L, autoclaved at 115 °C for 20 min.
[0031] Liquid-phase detection method for sugars and sugar alcohols: Determined by high-performance liquid chromatography, with ultrapure water as the mobile phase, Agilent Hi-Plex Ca chromatographic column (7.7 mm×300 mm), column temperature 85°C; flow rate 0.6 mL / min.
[0032] Explanation of gene names involved in the present invention is as follows: ptsG : Component II of the glucose phosphotransferase system enzyme.
[0033] XR : Xylose reductase.
[0034] XylE : Xylose transporter derived from Escherichia coli.
[0035] XylRFGH : That is XylR , XylF , XylG and XylH , a xylose transporter derived from Escherichia coli. These four genes are naturally linked together in Escherichia coli and are collectively referred to as XylRFGH .
[0036] HEO 0208: Xylose transporter derived from Halomonas.
[0037] AraE : Xylose transporter derived from Bacillus subtilis.
[0038] Example 1 Construction of Vibrio natriegens genetically engineered bacterium VnDX integrating T7 RNA polymerase Using Vibrio natriegens ATCC14048 as the starting strain, the T7RNA polymerase expression cassette on the genome of Escherichia coli E.coli BL21(DE3) was integrated into the genome of Vibrio natriegens ATCC14048 dns at the locus to obtain Vibrio natriegens VnDX (hereinafter simply referred to as VnDX). The specific method is as follows: (1) Construction of plasmid pMD19T-dnsaLR-T7RNAP-spec Plasmid pMD19T-dnsaLR-spec was digested with restriction endonuclease HindIII at 37°C for 3 h. Primer pairs T7RNAP-F and T7RNAP-F were designed to amplify the T7 RNA polymerase expression cassette lacI-P from the genome of Escherichia coli E.coli BL21(DE3) lacUV5-T7 RNAP was used to recover the DNA fragment. The linearized pMD19T-dnsaLR-spec plasmid and the T7 RNAP expression cassette were assembled to obtain the plasmid pMD19T-dnsaLR-T7RNAP-spec. The primer sequences are as follows: T7RNAP-F: ggataaagtcatactttttaaagactttaactgcatgcccgagaagatgttgagcaaac; T7RNAP-R: cacatgaactcgagtagggataacagggtaatcccgggcacagtatcaaggtattttat.
[0039] (2)Obtaining the repair template The pMD19T-dnsaLR-T7RNAP-spec plasmid was extracted and digested with the restriction endonuclease XbaI to obtain the linearized fragment dnsaLR-T7RNAP-spec, which is the repair template.
[0040] (3)Natural transformation The plasmid pMMB67EH-tfoX was electrotransformed into Vibrio natriegens ATCC14048 to obtain the strain ATCC14048 / pMMB67EH-tfoX. It was inoculated into a BHIv2 test tube containing 100 µg / mL Carb and 0.3 mM IPTG and cultured overnight. 3.5 µL of the overnight culture was taken and diluted in 350 µL of sea salt containing 100 µM IPTG. 50 ng of the dnsaLR-T7RNAP-spec fragment was added, gently mixed, and left to stand at 30 °C for 4 - 6 h. 1 mL of LBv2 medium was added, and the mixture was resuscitated at 30 °C and 200 rpm for 1 h and then spread on a Spec-resistant plate. PCR was performed using the corresponding PCR amplification system and PCR amplification conditions. The amplification products were detected by 1.0% agarose gel electrophoresis. The strains with positive bands were named VnDX.
[0041] The composition of the BHIv2 medium is: brain heart infusion broth 37 g / L, NaCl 11.92 g / L, MgCl 2• 6H 2 O 4.7 g / L, KCl 0.31 g / L.
[0042] Example 2 Knockout ptsG Construction of the Vibrio natriegens genetically engineered strain VnDX△ptsG with the ptsG gene knocked out Using Vibrio natriegens VnDX integrated with T7 RNA polymerase and wild-type Vibrio natriegens ATCC14048 as starting strains, the method of CRISPR-associated transposases (CAST) (Chromosome recombination and modification by LoxP-mediated evolution in Vibrio natriegens using CRISPR-associated transposases. Biotechnol Bioeng 2023) was used to knockout the glucose phosphorylation transporter-encoding gene ptsG on the Vibrio natriegens genome. The steps are as follows: (1) Construction of plasmid pTNSQcas-ptsG First, find the PAM site on the target gene. The sequence corresponding to 32 bp before the PAM site is the N32 sequence, and the corresponding crRNA primer pair N32-ptsG-F and N32-ptsG-R was designed. Plasmid pTNSQcas was digested with the restriction endonuclease BsaI at 37 °C for 2 h, and the primer pair N32-ptsG-F and N32-ptsG-R was annealed to each other. After the linearized plasmid and the primer annealing product were ligated at 25 °C for 15 min, they were transformed into Escherichia coli E.coli DH5α, and spread on an LB solid plate containing chloramphenicol. The clone with correct sequencing was the plasmid pTNSQcas-ptsG. The primer sequences are as follows, N32-ptsG-F: tttttgctaacctgcaaaaagtcggtaaatca; N32-ptsG-R: tgatttaccgactttttgcaggttagcaaaaa.
[0043] (2) Construction of plasmid pDonor-verA Using the publicly reported plasmid pDonor-verA as a template, a DNA fragment of about 1.9 kb was amplified with primers verA-F and verA-R, and subjected to agarose gel electrophoresis and recovery. Using the plasmid pMW118 as a template, a DNA fragment with a length of about 1.8 kb was amplified with primers SC101-F and SC101-R, and subjected to agarose gel electrophoresis and recovery. The two fragments were assembled and transformed into Escherichia coli E.coli DH5α, and spread on an LB solid plate containing kanamycin. The clone with correct sequencing was the pDonor-verA plasmid. The primer sequences are as follows, verA-F: cccagtcacgacgttgaagcggggttttttgcgaaaaaaa; verA-R: gctagcatgcctatttgtttatttttcta; SC101-F: aaacaaataggcatgctagcgcaccacatagcagacccgccataaaac; SC101-R: aacgtcgtgactgggctcattaggcaccgggatctg。
[0044] (3)Electroporation was used to transfer the pTNSQcas-ptsG plasmid into Vibrio natriegens VnDX or ATCC14048 strains a. Preparation of electrocompetent cells: Streak Vibrio natriegens stored at -80 °C on a solid medium plate without antibiotics and incubate overnight at 30 °C. Pick a single colony and inoculate it into a 5 mL BHIv2 test tube, and incubate overnight at 30 °C on a shaker at 220 rpm; the next day, transfer 1% to fresh BHIv2 medium and incubate at 30 °C on a shaker at 220 rpm for about 1 - 1.5 h; measure OD 600 : Pipette 1 mL of the bacterial solution and detect it with a spectrophotometer. When it grows to about 0.5 (0.4 - 0.6), it is okay; aliquot the bacterial solution into 1.5 mL EP tubes and centrifuge at 6000 rpm for 10 min at 4 °C, discard the supernatant; resuspend the bacterial cells with 1 mL of electrotransformation washing solution, centrifuge at 6000 rpm for 10 min at 4 °C, and discard the supernatant; repeat the above steps twice, and pay attention to pouring out the liquid from each centrifugation completely; after resuspending with 100 μL of washing solution, store it in an ultra-low temperature freezer at -80 °C or perform electrotransformation directly.
[0045] b. Electrotransformation: Place the prepared electrocompetent Vibrio natriegens cells on ice, add 800 ng of the pTNSQcas-ptsG plasmid under sterile conditions, mix gently, transfer it to a 1 mm electroporation cuvette, and perform electrotransformation at 800 V, 25 μF, and 200 Ω.
[0046] c. Transfer the bacterial cells to a sterile 1.5 mL EP tube with 800 μL of BHIv2 medium, resuscitate in a shaker at 30 °C and 220 rpm for 45 min, spread on a chloramphenicol-resistant plate, and incubate for 10 - 12 h.
[0047] d. Pick a single colony and inoculate it into a BHIv2 test tube, incubate in a shaker at 30 °C and 220 rpm for 10 - 12 h, store the glycerol bacteria, and obtain the genetically engineered bacteria VnDX / pTNSQcas-ptsG and ATCC / pTNSQcas-ptsG.
[0048] (4)Electrotransformation was used to transfer the pDonor-VerA plasmid into the strain VnDX / pTNSQcas-ptsG or ATCC / pTNSQcas-ptsG The method of electrotransforming the pDonor-VerA plasmid was the same as that in Example 1. Finally, the genetically engineered bacteria VnDX / pTNSQcas-ptsG / pDonor-VerA and ATCC / pTNSQcas-ptsG / pDonor-VerA containing two plasmids were obtained.
[0049] (5)Induction of transposase by anhydrotetracycline hydrochloride (aTC) Scrape 5 - 10 transformants on the transformation plate in 2.4, resuspend them in 100 μL of liquid LBv2 medium, and then spread them on a BHIv2 solid plate containing chloramphenicol, kanamycin, and 100 ng / mL aTc, and culture at 30 °C for 10 h. Perform PCR with the upstream and downstream primers at different insertion sites. If the size of the PCR band is approximately 1.3 kb, the terminator sequence (VerA) has been inserted into the ptsG gene, and thus the engineered bacteria with inactivated ptsG are obtained.
[0050] (6)Plasmid loss The engineered bacteria with positive PCR results in 2.5 were passaged continuously in antibiotic-free test tubes for 3 generations, then streaked on an antibiotic-free plate to separate single colonies, and the plasmid loss was identified by monoclonal dot blotting. The successfully plasmid-lost monoclonal colonies were inoculated into 5 mL of BHIv2 test tubes for activation and preservation, and the strains VnDX△ptsG and ATCC△ptsG were obtained.
[0051] Example 3 Knockout ptsG Construction of the genetically engineered Vibrio natriegens strains VnDX△ptsG::xylE and ATCC△ptsG::xylE with the xylose transporter gene knocked out and integrated Using the engineered bacteria VnDX△ptsG and ATCC△ptsG as the starting strains, the NT-CRISPR method (NT-CRISPR, combining natural transformation and CRISPR-Cas9 counterselection for markerless and scarless genome editing in Vibrio natriegens . Communications Biology 2022 Vol. 5 Issue 1 Pages 265) was used to integrate the xylose transporter gene from Escherichia coli XylE into the Vibrio natriegens genome. The specific method is as follows: (1)Construction of the NT-CRISPR tool plasmid pNT-Xylitol targeting the untranslated region of the genome The plasmid pNT-116 was digested with the restriction endonuclease BsaI at 37 °C for 2 h. Primer pairs N20-NT-F and N20-NT-R were designed for primer annealing and ligation. After the linearized plasmid and the primer annealing product were ligated at 25 °C for 15 min, they were transformed into Escherichia coli DH5α and spread on an LB solid plate containing chloramphenicol. The clone with correct sequencing was the plasmid pNT-Xylitol. The primer sequences are as follows. N20-NT-F: gtccaacaaaccaccgcaatgcgg; N20-NT-R: aaacccgcattgcggtggtttgtt.
[0052] (2)Transfer of pNT-xylitol into VnDX△ptsG The method of electrotransforming the pNT-xylitol plasmid was the same as in Example 2. The genetically engineered bacterium VnDX△ptsG / pNT-xylitol was obtained.
[0053] (3)Obtaining of the repair template Using the Escherichia coli W3110 genome as a template, PCR was performed with primer pairs xylE-F and xylE-R to obtain a DNA fragment with a length of approximately 1.7 kb. Using the Escherichia coli W3110 genome as a template, PCR was performed with primer pairs up-F and up-R to obtain a DNA fragment with a length of approximately 0.5 kb. Using the Escherichia coli W3110 genome as a template, PCR was performed with primer pairs down-F and down-R to obtain a DNA fragment with a length of approximately 0.5 kb. The three DNA fragments were recovered by agarose gel electrophoresis respectively. Using the three recovered DNA fragments as templates and up-F and down-R as primers, overlap extension PCR was performed, and a DNA fragment with a size of approximately 2.7 kb was recovered by agarose gel electrophoresis, namely the repair template up-xylE-down. The primer sequences are as follows. xylE-F: gaagcggcataaaaacccacttacgataattctctttcg; xylE-R: tgcatgcattttcgtttacagcgtagcagtttgttg; up-F: aatgctacgatgcaatcacgatatac; up-R: tttttatgccgcttctaagtgagtt; down-F: acgaaaatgcatgcacgacaaaa; down-R: ttcgattgattgggcgaaaatct.
[0054] (4) Natural transformation The method of natural transformation was the same as that in Example 1. Specific primer pairs were used to verify the transformants by PCR, and the genetically engineered Vibrio natriegens strains VnDX△ptsG::xylE and ATCC△ptsG::xylE with the xylose transporter gene integrated into the genome were obtained. xylE
[0055] Genetically engineered strains VnDX△ptsG::xylRFGH, VnDX△ptsG::HEO, VnDX△ptsG::araE, ATCC△ptsG::xylRFGH, ATCC△ptsG::HEO, and ATCC△ptsG::araE with xylose transporters from different sources integrated were constructed by the same method. Among them, xylE and xylRFGH are xylose transporter genes from Escherichia coli, HEO 0208 is a xylose transporter gene from Halomonas, araE is a xylose transporter gene from Bacillus subtilis. The specific sequence information is shown in Table 1.
[0056] Table 1 Xylose transporter genes from different sources
[0057] Example 4 Recombinant expression of xylose reductases from different sources using the T7 expression system (1) Obtaining xylose reductase genes from different sources According to the XR gene sequences publicly available on NCBI, 11 wild-type XR genes from different sources were screened out (the sequence information is shown in Table 2). The wild-type XR gene sequences from different sources were optimized for Escherichia coli codons and synthesized by whole gene synthesis to obtain plasmids containing XR genes from different sources.
[0058] (2) Transforming 11 pET-28a-XR plasmids into VnDX by electroporation The method for preparing electrocompetent cells and the electrotransformation method are shown in Example 2, and Vibrio natriegens VnDX / pET-28a-XR1, VnDX / pET-28a-XR2, VnDX / pET-28a-XR3, VnDX / pET-28a-XR4, VnDX / pET-28a-XR5, VnDX / pET-28a-XR6, VnDX / pET-28a-XR7, VnDX / pET-28a-XR8, VnDX / pET-28a-XR9, VnDX / pET-28a-XR10 and VnDX / pET-28a-XR11 are obtained.
[0059] (3) Shake flask fermentation for inducible expression of XR Activate 11 strains such as VnDX / pET-28a-XR1 by streaking on a solid plate. Pick a single colony and inoculate it into a test tube containing 5 mL of BHIv2 medium with 200 μg / mL kanamycin, and culture it overnight at 30 °C and 220 rpm. Take 0.3 mL of each overnight culture and inoculate it into 30 mL of BHIv2 medium with 200 μg / mL kanamycin, and culture it on a shaker at 30 °C and 220 rpm for 10 hours. Then add IPTG with a final concentration of 0.3 mM for induction, and culture it on a shaker at 28 °C and 220 rpm for 10 hours.
[0060] (4) Detection of xylose reductase enzyme activity Take 4 mL of the bacterial liquid from each of the above fermentation shake flasks, add 4 mL of Tris-HCl buffer (pH 7.5), and lyse the bacteria with an ultrasonic cell disruptor (operate for 3 s, pause for 7 s, 30 times) to obtain a crude enzyme solution.
[0061] Measure the enzyme activity of XR with an ultraviolet spectrophotometer. The total reaction system is 1 mL, including xylose with a final concentration of 0.5 M, NADPH with a concentration of 200 μM, 50 mM Tris-HCL (pH 7.5) and an appropriate amount of crude enzyme solution, and measure the change in absorbance at 340 nm. Calculate the enzyme activity of XR through the increase in absorbance. The calculation formula is U / mL = [△A × V (mL) × 10 6 × dilution factor] / [△t × 6220 × 1 × V 酶液 (mL)]. The enzyme libraries and enzyme activity measurement results of XR from different sources are shown in Table 2.
[0062] From the analysis of the XR enzyme activity results, when different XRs are recombinantly expressed in the engineered Vibrio natriegens strains, there are significant differences in enzyme activity. Among them, no enzyme activity was detected for XR9 and XR10; the enzyme activities of XR1, XR2, and XR8 were less than 1 U / mL; the enzyme activities of XR3, XR4, XR6, and XR7 were in the range of 1 - 10 U / mL; the enzyme activity of XR5 was the highest, reaching 43 U / mL.
[0063] Table 2 Enzyme activity assay results of recombinant expression of xylose reductase (XR) from different sources by Vibrio natriegens T7 system
[0064] Example 5 Recombinant expression of xylose reductase from different sources without T7 system (1) Construction of XR recombinant expression plasmid pJ23119-XR Using 11 pET-28a-XR plasmids as templates respectively, 11 XR gene sequences were amplified by specific primers. Using the existing pJ23119 plasmid in the laboratory as a template, a plasmid backbone containing chloramphenicol resistance, p15a replicon and J23119 constitutive promoter was amplified. The plasmid backbone was recombined with 11 XR gene sequences respectively to construct 11 XR expression plasmids.
[0065] (2) Transformation of 11 XR plasmids into ATCC14048 by electroporation The method for preparing electrocompetent cells and the electroporation method are shown in Example 2, and Vibrio natriegens ATCC / pJ23119-XR1, ATCC / pJ23119-XR2, ATCC / pJ23119-XR3, ATCC / pJ23119-XR4, ATCC / pJ23119-XR5, ATCC / pJ23119-XR6, ATCC / pJ23119-XR7, ATCC / pJ23119-XR8, ATCC / pJ23119-XR9, ATCC / pJ23119-XR10 and ATCC / pJ23119-XR11 were obtained.
[0066] (3) Shake flask fermentation for expressing XR Activate 11 strains such as ATCC / pJ23119-XR1 by solid plate streaking. Pick a single colony and inoculate it into a test tube containing 5 mL of BHIv2 medium with 25 μg / mL chloramphenicol, and culture it overnight at 30 °C and 220 rpm. Take 0.3 mL of the overnight culture broth and inoculate it into 30 mL of BHIv2 medium with 25 μg / mL chloramphenicol, and culture it on a shaker at 30 °C and 220 rpm for 15 hours.
[0067] (4) Detection of xylose reductase enzyme activity The enzyme activity of xylose reductase was detected according to the method in Example 4. The enzyme library and enzyme activity assay results of XR from different sources are shown in Table 3.
[0068] From the analysis of XR enzyme activity results, when different XRs were expressed using the J23119 constitutive promoter, there were also significant differences in enzyme activity. Among them, no enzyme activity was detected for XR2, XR8, and XR10; the enzyme activity of XR9 was less than 1 U / mL; the enzyme activities of XR1, XR3, XR6, XR7, XR9, and XR11 were in the range of 1 - 10 U / mL; the enzyme activity of XR5 was the highest, reaching 19.97 U / mL, and XR4 ranked second. When XRs were expressed using different expression systems, the differences in enzyme activity were caused by the differences in the strength of the expression systems.
[0069] Table 3 Enzyme Activity Determination Results of Recombinant Expression of Xylose Reductase in Vibrio natriegens Non-T7 System (J23119 Promoter)
[0070] Example 6 Shake-Flask Fermentation of Recombinant Expression of XR and Integration of Xylose Transporter to Produce Xylitol According to the results of XR enzyme activity determination in Example 4, Xylitol strains were constructed using XR5 with the highest enzyme activity and XR4 with the second highest enzyme activity, respectively. The corresponding plasmids pET-28a-XR5 and pET-28a-XR4 were transferred into the engineered bacteria integrated with different xylose transporters for testing.
[0071] (1) Electrotransformed plasmids pET-28a-XR5 and pET-28a-XR4 into the VnDX△ptsG::xylE strain The electrotransformation competent cells and electrotransformation method were the same as in Example 2 to obtain the engineered strain VnDX△ptsG::xylE / pET-28a-XR5, named strain S1. The engineered bacteria VnDX△ptsG::xylRFGH / pET-28a-XR5, VnDX△ptsG::HEO / pET-28a-XR5, VnDX△ptsG::araE / pET-28a-XR5, VnDX△ptsG::xylE / pET-28a-XR4, VnDX△ptsG::xylRFGH / pET-28a-XR4, VnDX△ptsG::HEO / pET-28a-XR4, and VnDX△ptsG::araE / pET-28a-XR4 were obtained in the same way and named strains S2, S3, S4, S5, S6, S7, and S8, respectively.
[0072] (2) Shake-flask fermentation a) Respectively picked well-growing monoclonal bacteria into 5 mL of BHIv2 medium supplemented with kanamycin and cultured at 30 °C for 5 - 10 h as the seed solution.
[0073] b) Inoculate the cultured seed liquid into the fermentation medium at an inoculation amount of 1% respectively, and culture at 30 °C until the OD reaches 0.6 - 0.8. Add the inducer IPTG with a final concentration of 0.3 mM, an appropriate amount of xylose, and a glucose mother liquor into each shake flask fermentation medium, so that the xylose concentration in the fermentation broth is 30 g / L and the glucose concentration is 15 g / L. After adding the substrates, culture at 30 °C for 12 h, sample regularly and detect the changes of relevant parameters. At the same time, each group of experiments includes 3 parallel experiments. The specific fermentation data are shown in Table 4.
[0074] The results of shake flask fermentation showed that xylose transporters from different sources could be functionally expressed in Vibrio natriegens and perform the xylose transport function, but the efficiencies of xylose transporters from different sources were different. Among them, HEO 0208 from Halomonas expressed the highest efficiency of transporting xylose in Vibrio natriegens, so the xylitol yield was also the highest.
[0075] Table 4 Effects of different xylose transporters on xylitol yield
[0076] Example 7 Construction of a genetically engineered bacterium with genomic integration and expression of XR According to the XR enzyme activity determination in Example 4 and the results of shake flask fermentation in Example 5, select the genetically engineered bacterium VnDX△ptsG::HEO integrated with HEO the 0208 xylose transporter and the xylose reductase XR5 for subsequent genomic integration of xylose reductase. Use the method of CRISPR-associated transposase (CAST) publicly reported in the literature to integrate multiple copies of xylose reductase into the genome of Vibrio natriegens to obtain an integrated xylitol-producing strain without the addition of antibiotics. The specific steps are as follows: (1) Construct the pTNSQcas-array8 and pDonor-XR5 plasmids Design a crRNA array that can simultaneously target 8 sites in the genome of Vibrio natriegens. This DNA sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd. The CAST plasmid pTNSQcas-array8 linked with the crRNA array was also constructed by Nanjing GenScript Biotechnology Co., Ltd.
[0077] Using the pDonor-verA plasmid as a template, PCR was performed with the primer pair pDonor-F and pDonor-R to obtain a DNA fragment approximately 3 kb in length. Using the pET-28a-XR5 plasmid as a template, PCR was performed with the primer pair XR5-F and XR5-R to obtain a DNA fragment 1.2 kb in length. The two DNA fragments were recovered by agarose gel electrophoresis, and then the two fragments were assembled by Gibson and chemically transformed into DH5α competent cells. The cells were spread on an LB plate with kanamycin resistance and cultured overnight at 37°C. The next day, colonies were picked and transferred to test tubes for preservation to obtain the plasmid pDonor-XR5. The primer sequences are as follows, pDonor-F: CTTACTGCAGTAGTTTTGCTGA; pDonor-R: gctggcgcctatatcTGGGTGTGATAATTATCAATT; XR5-F: gatataggcgccagcaaccgca; XR5-R: AACTACTGCAGTAAGgcggccgcttactggatctt.
[0078] (2) Construction of XR-integrated genetically engineered bacteria According to the method for preparing electrocompetent cells and electrotransformation in Example 2, the plasmids pTNSQcas-array8 and pDonor-XR5 were electrotransformed in sequence, and finally the genetically engineered bacteria VnDX△ptsG::HEO / pTNSQcas-array8 / pDonor-XR5 were obtained. According to the method in Example 2, the transposase was induced to express and transpose with the inducer anhydrotetracycline hydrochloride. According to the method of Example 2, 8 integrated genetically engineered bacteria with 1 to 8 copies of XR integrated were obtained.
[0079] Example 8 Shake flask fermentation of genetically engineered bacteria The shake flask fermentation culture experiment was the same as in Example 5. The results of the shake flask fermentation experiments of the integrated genetically engineered bacteria and the plasmid-type genetically engineered bacteria are shown in Table 5. It can be seen from Table 5 that the fermentation conversion efficiencies of the integrated genetically engineered bacteria with different copies of the XR gene are different. Comparing the results of the shake flask fermentation of the plasmid-type expression genetically engineered bacteria, it was found that the shake flask fermentation effects of the 5-, 6-, and 7-copy integrated genetically engineered bacteria were significantly better than those of the plasmid-type genetically engineered bacteria. The integrated genetically engineered bacteria had a higher xylose conversion rate. Among them, the integrated genetically engineered bacteria with 5 copies of the XR gene had the best xylitol production effect. After 12 h of fermentation, the xylitol concentration was 29.60 g / L, and the xylose conversion rate reached 99.0%.
[0080] Table 5 Results of shake flask fermentation of integrated genetically engineered bacteria
[0081] Comparative Example 1 Construct Escherichia coli BL21(DE3) recombinant strain expressing XR according to the method of Example 6. Similarly, conduct the enzyme activity determination experiment of the genetically engineered bacteria according to Example 6. The results are shown in Table 6. The highest XR enzyme activity is 0.38 U / mL, which is much lower than the enzyme activity of XR recombinantly expressed in Vibrio natriegens. E.coli
[0082] Table 6 Enzyme activity determination results of xylose reductase (XR) recombinantly expressed from different sources in Escherichia coli
[0083] Comparative Example 2 Construct the genetically engineered bacterium VnDX△ptsG without integrating heterologous xylose transporter according to the method of Example 2. Similarly, transfer the XR expression plasmid into VnDX△ptsG according to the method of Example 4, and conduct flask fermentation. Samples are taken at 12 h and 24 h respectively for analysis, and no production of xylitol is detected.
Claims
1. A genetically engineered bacterium comprising a host cell and a target gene inserted into the host cell, characterized in that: The host cell is Vibrio natriuresis; the target gene is a xylose reductase gene and a xylose transporter gene.
2. The genetically engineered bacterium according to claim 1, characterized in that: The natriuretic vibrio is a wild type natriuretic vibrio or a knockout glucose phosphorylation transporter encoding gene ptsG of the wild-type Vibrio natriuresis.
3. The genetically engineered bacterium according to claim 2, characterized in that: The Vibrio natriuresis is integrated with an RNA polymerase expression cassette for prokaryotic expression.
4. The genetically engineered bacterium according to claim 3, characterized in that: The RNA polymerase expression cassette is a T7 RNA polymerase expression cassette, which is inserted into the genome of Vibrio natriuresis DNS On the location.
5. The genetically engineered bacterium according to claim 2, characterized in that: The wild type Vibrio natriuresis is Vibrio natriuresis ATCC14048.
6. The genetically engineered bacterium according to claim 1, characterized in that: The accession number of the xylose reductase in the NCBI database is AF074484.1, AB002106.1, ALO17776.1, EAA34695.1, AAA99507.1 or Q9P8R5.
1.
7. The genetically engineered bacterium according to any one of claims 1 or 6, characterized in that: The xylose reductase gene is expressed in the host cell in one of the following ways: (A) Expressed in host cells in the form of a recombinant plasmid; (B) It is inserted into the untranslated region of the host cell genome in the form of an expression cassette for expression.
8. The genetically engineered bacterium according to claim 7, characterized in that: (A) The original expression vector of the recombinant plasmid is pET-28a.
9. The genetically engineered bacterium according to claim 7, characterized in that: In (B), the xylose reductase gene is expressed by the T7 promoter.
10. The genetically engineered bacterium according to claim 7, characterized in that: In (B), the copy number of the xylose reductase gene integrated into the genome is 4 to 7.
11. The genetically engineered bacterium according to claim 1, characterized in that: The xylose transporter gene is derived from bacteria.
12. The genetically engineered bacterium according to claim 11, characterized in that: The xylose transporter gene is a xylose transporter gene derived from Escherichia coli W3110 xy or xylRFGH , Xylose transporter gene from Bacillus subtilis araE , or a xylose transporter gene from Halomonas HEO0208 ; Said xy The gene accession number in the NCBI database is 948529; xylRFGH The accession numbers of the genes in the NCBI database are 948086, 948090, 948127 and 948083; araE The gene accession number in the NCBI database is 938567; HEO0208 The gene accession number in the NCBI database is CBV41047.
1.
13. The genetically engineered bacterium according to claim 1, characterized in that: The natriuretic vibrio is natriuretic vibrio ATCC14048.
14. A method for producing xylitol, characterized in that: Xylose and glucose are used as substrates, and the wet bacteria, crude enzyme solution, immobilized cells or lyophilized cells of the genetically engineered bacteria described in claim 1 are used as catalysts to form a catalytic reaction system to produce xylitol.
15. The method according to claim 14, characterized in that The mass ratio of xylose to glucose is 1-4:
1.
16. The method according to claim 14, characterized in that The reaction temperature is 25~35°C; the reaction pH is 5~9.
Citation Information
Patent Citations
Saccharomyces cerevisiae bacterial strain with high xylose transport capacity and application thereof
CN102559527A
Genetically engineered bacterium for preparing xylitol and application of genetically engineered bacterium
CN118581025A
Recombinant vibrio natriureticus and method for promoting secretory expression of foreign protein
CN118853519A
Production of xylitol and ethanol by recombinant saccharomyces cerevisiae expressing arabinose transporter
KR1020170114785A