Application of Lingo1 as postoperative cognitive impairment treatment target

Abstract

The invention provides application of Lingo1 as a postoperative cognitive impairment treatment target, and belongs to the technical field of medicine. The research finds that the POCD can lead to the obvious improvement of the Lingo1mRNA and protein expression level, so that the Lingo1mRNA and protein expression level can be used for auxiliary diagnosis of the POCD; secondly, research finds that POCD can be generated due to up-regulation of the expression level of Lingo1mRNA and protein, while POCD can be improved due to down-regulation of the expression level of Lingo1mRNA and protein, so that Lingo1 can be used as a POCD intervention target, and the medicine for inhibiting the expression level of Lingo1mRNA or protein can be used for preventing, improving and even treating postoperative cognitive impairment. The invention provides an important target for the development of POCD clinical intervention drugs, and has important clinical significance and application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to the use of Lingo1 as a therapeutic target for postoperative cognitive dysfunction. Background Art

[0002] Postoperative cognitive dysfunction (POCD) is a serious complication of the central nervous system after anesthesia surgery, with memory loss, inattention and decreased language and social skills as the main clinical manifestations. Studies have shown that the incidence of POCD in elderly patients over 60 years old is about 25.8% within 1 week after non-cardiac surgery, and the incidence is about 10% within 3 months after surgery, while the incidence of POCD in patients undergoing cardiac surgery is still as high as 42% from 3 to 6 months after surgery. With the development of anesthesia and surgical techniques, the number of elderly patients undergoing surgery has increased year by year. Cognitive impairment caused by perioperative factors has seriously affected the postoperative quality of life of elderly patients and increased the risk of postoperative death in elderly patients. The occurrence of POCD is closely related to multiple factors such as patient conditions, surgical methods and anesthesia methods, and is regulated by multiple pathophysiological processes. However, there is currently a lack of biomarkers for the clinical diagnosis of POCD in clinical practice, and the key molecular mechanisms mediating its occurrence and development are still unclear, which has brought difficulties to the clinical diagnosis and prevention of POCD. Therefore, finding the key regulatory factors of POCD and discovering effective clinical intervention targets are of great significance to the clinical prevention and treatment of POCD, and are major issues that urgently need to be addressed in the health field.

[0003] The occurrence of POCD is the result of the combined action of multiple factors, including patient age, surgical method and anesthesia method, patient physical condition, postoperative pain and infection, etc. Therefore, the molecular mechanism involved in regulating the occurrence of POCD is complex. Previous studies have reported that multiple molecules are involved in the occurrence and development of POCD, such as Smad7, TLR3, DNMT3a, etc. The discovery of the above regulatory factors provides candidate targets for the clinical diagnosis and prevention of POCD.

[0004] At present, most of the clinical therapeutic targets developed for POCD focus on the molecular regulatory processes related to neuroinflammation and neuroapoptosis. However, the key molecules that regulate the inhibition of neuronal myelination and the hyperphosphorylation of Tau protein under anesthesia and surgical stress are still unclear, making it possible that the existing potential therapeutic targets for POCD may not be able to achieve clinical intervention for all POCD patients. At the same time, the complexity of the pathogenesis of POCD makes it possible that the above targets may not be able to achieve the development of clinical intervention strategies for all POCD patients. Therefore, it is urgent to further explore the important regulatory factors that mediate the occurrence of POCD and discover new potential therapeutic targets. Summary of the invention

[0005] POCD is a common neurological complication that occurs after anesthesia surgery, mainly manifested by the decline of memory, attention, language comprehension ability, social ability, etc. It has a relatively high incidence, especially in elderly surgical patients, seriously affecting the quality of life of surgical patients and imposing a heavy medical burden on the patients' families and society. At present, the key mechanisms and regulatory molecules mediating the occurrence of POCD are not clear, which brings difficulties to the development of targeted therapeutic drugs. In addition, anti-inflammatory treatment or changing the anesthesia plan is usually used for the prevention and treatment of POCD in clinical practice, but the existing treatment strategies have not achieved satisfactory results. Therefore, finding effective treatment targets for POCD is of great significance for the development of drugs for POCD and the establishment of relevant clinical prevention and treatment strategies.

[0006] In order to solve the problems existing in the prior art, the present invention provides the use of Lingo1 as a therapeutic target for postoperative cognitive dysfunction.

[0007] The present invention provides the use of a Lingo1 detection reagent in the preparation of a detection kit for postoperative cognitive dysfunction; the Lingo1 detection reagent is a reagent for detecting the expression level of Lingo1 mRNA or a reagent for detecting the expression level of Lingo1 protein.

[0008] Furthermore, the reagent for detecting the expression level of Lingo1 mRNA is a gene chip reagent, a Northern blot reagent or a quantitative PCR reagent;

[0009] and / or, the reagent for detecting the expression level of Lingo1 protein is a reagent for enzyme-linked immunosorbent assay, a reagent for immunoblotting, a reagent for immunoelectrophoresis, a reagent for tissue immunostaining, a reagent for immunoprecipitation analysis, a reagent for radioimmunoassay, a reagent for radioimmunodiffusion assay, a reagent for complement fixation analysis, a reagent for fluorescence-activated cell sorting, a reagent for mass analysis or a reagent for protein microarray.

[0010] Furthermore, the reagent for detecting the expression level of Lingo1 mRNA or the reagent for detecting the expression level of Lingo1 protein is a reagent for detecting the expression level of Lingo1 mRNA or the expression level of Lingo1 protein in the hippocampal tissue.

[0011] The present invention also provides a detection kit for postoperative cognitive dysfunction, which comprises a reagent for detecting the expression level of Lingo1 mRNA and / or a reagent for detecting the expression level of Lingo1 protein;

[0012] Preferably,

[0013] the reagent for detecting the expression level of Lingo1 mRNA is a gene chip reagent, a Northern blot reagent or a quantitative PCR reagent;

[0014] And / or, the reagent for detecting the expression level of Lingo1 protein is a reagent for enzyme-linked immunosorbent assay, a reagent for immunoblotting, a reagent for immunoelectrophoresis, a reagent for tissue immunostaining, a reagent for immunoprecipitation analysis, a reagent for radioimmunoassay, a reagent for radioimmunodiffusion assay, a reagent for complement fixation analysis, a reagent for fluorescence-activated cell sorting, a reagent for mass spectrometry analysis, or a reagent for protein microarray.

[0015] Furthermore, the reagent for detecting the expression level of Lingo1 mRNA or the reagent for detecting the expression level of Lingo1 protein is a reagent for detecting the expression level of Lingo1 mRNA or Lingo1 protein in the hippocampal tissue.

[0016] The present invention also provides the use of a Lingo1 inhibitor in the preparation of a drug for preventing and / or treating postoperative cognitive dysfunction; the Lingo1 inhibitor is a reagent for inhibiting the expression level of Lingo1 mRNA and / or the expression level of Lingo1 protein;

[0017] Preferably, the Lingo1 inhibitor is a reagent for inhibiting the function of Lingo1 protein.

[0018] Furthermore, the reagent for inhibiting the expression level of Lingo1 mRNA is a drug delivery system loaded with a gene interfering with the expression of Lingo1 mRNA, a lentivirus, an adenovirus, or an adeno-associated virus;

[0019] Preferably, the reagent for inhibiting the expression level of Lingo1 mRNA is an adeno-associated virus loaded with an siRNA gene or an shRNA gene interfering with the expression of Lingo1 mRNA.

[0020] Furthermore, the reagent for inhibiting the expression level of Lingo1 protein is a small molecule inhibitor, a polypeptide inhibitor, a protein inhibitor, an antibody inhibitor, or a drug delivery system containing the above inhibitors for inhibiting the expression of Lingo1 protein.

[0021] Furthermore, the administration route of the drug is oral administration, intranasal administration via the olfactory bulb, intravenous injection, intramuscular injection, subcutaneous injection, or stereotactic injection into the brain tissue;

[0022] Preferably, the administration route is stereotactic injection into the brain tissue.

[0023] The present invention also provides a drug for preventing and / or treating postoperative cognitive dysfunction, which is a pharmaceutical preparation prepared with a Lingo1 inhibitor as an active ingredient, plus pharmaceutically acceptable excipients or auxiliary components;

[0024] The Lingo1 inhibitor is a reagent that inhibits the expression level of Lingo1 mRNA and / or the expression level of Lingo1 protein;

[0025] Preferably, the Lingo1 inhibitor is a reagent that inhibits the function of Lingo1 protein.

[0026] In the present invention, the Nogo receptor interacting protein-1 (Leucine-rich repeat and immunoglobulin domain-contain protein-1, Lingo1) rich in leucine repeats and immunoglobulin domains is a key negative regulator of myelination, specifically expressed in the central nervous system, forms a ternary receptor complex with NgR, p75NTR or TROY, mediates transmembrane signal transduction through signal pathways such as RhoA and PI3K and causes a series of downstream cascade reactions, and is involved in the regulation of central nervous system function and related diseases. In the present invention, it was found by real-time fluorescence quantitative PCR, Western blot and immunofluorescence experiments that the expression of both Lingo1 protein and mRNA was up-regulated in the hippocampal tissue of aged mice undergoing anesthesia surgery, and it played an important role in the occurrence and development of POCD.

[0027] Based on the above findings, the present invention firstly provides an adeno-associated virus vector expressing Lingo1, the vector contains the coding gene or mRNA of Lingo1, preferably, the above gene is the Lingo1 coding gene, named AAV-Lingo1. In a specific embodiment of the present invention, the above Lingo1 overexpression vector was injected into the CA1 and CA3 regions of the mouse hippocampus by stereotaxic injection technique. Western blot experiments confirmed that the injection of AAV-Lingo1 significantly up-regulated the expression level of Lingo1 protein in the mouse hippocampal tissue. At the same time, the up-regulation of Lingo1 protein expression caused a significant impairment of the cognitive function of the mice, further confirming that the up-regulation of Lingo1 protein expression in the hippocampal tissue provided by the present invention is a key factor mediating the occurrence of POCD. Therefore, inhibiting the biological function of Lingo1 protein or inhibiting the expression of Lingo1 will contribute to the cognitive improvement of POCD patients.

[0028] Based on the above-mentioned correlation between Lingo1 expression and postoperative cognitive dysfunction, the present invention provides technical solutions for treating POCD at the gene level or protein level. The technical solutions at the gene level may be drug delivery systems loaded with interfering genes, lentiviruses, adenoviruses, and adeno-associated viruses. The technical solutions at the protein level may be inhibitors such as small molecules, polypeptides, proteins, antibodies, and drug delivery systems loaded with the above inhibitors. Preferably, the technical solution is an adeno-associated virus loaded with small interfering RNA (siRNA) or short hairpin RNA (shRNA) interfering genes. More preferably, the interfering virus is shRNA.

[0029] The adeno-associated virus vector of the present invention is delivered to the corresponding lesion through the administration route for expression, forms siRNA by enzymatic cleavage in the cell, further forms a silencing complex, and achieves the purpose of gene silencing by specifically targeting and degrading mRNA, ultimately inhibiting the expression of Lingo1 protein. The administration route may be oral administration, intranasal olfactory bulb administration, intravenous injection, intramuscular injection, subcutaneous injection, or stereotactic injection into the brain tissue. Preferably, the administration route is stereotactic injection into the brain.

[0030] In a specific embodiment of the present invention, the adeno-associated virus vector loaded with Lingo1 shRNA (named Lingo1-shRNA) is injected into the bilateral hippocampal CA1 and CA3 regions of mice through stereotactic injection technology. Western blot analysis shows that injection of AAV-shRNA into the hippocampal CA1 and CA3 regions of mice can significantly inhibit the expression of Lingo1 protein and simultaneously significantly improve the impairment of postoperative cognitive ability in aged mice. Therefore, the present invention proposes the application of Lingo1 in the hippocampal tissue in the preparation of drugs for treating POCD, that is, inhibiting the expression or function of Lingo1 protein in the hippocampal tissue through gene expression intervention technology or inhibitors will help improve or terminate the cognitive function damage caused by anesthesia and surgery.

[0031] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0032] The present invention provides the application of Lingo1 as a therapeutic target for POCD. First, the present invention discovers through research that POCD can lead to a significant increase in the expression levels of Lingo1 mRNA and protein. Therefore, the expression levels of Lingo1 mRNA and protein can be used to assist in the diagnosis of POCD. Secondly, the present invention discovers through research that the up-regulation of the expression levels of Lingo1 mRNA and protein will lead to the occurrence of POCD, while the down-regulation of the expression levels of Lingo1 mRNA and protein can improve POCD. Therefore, Lingo1 can be used as an intervention target for POCD, and drugs that inhibit the expression level of Lingo1 mRNA or protein can be used as drugs for preventing, improving, and even treating postoperative cognitive dysfunction. The present invention provides an important target for the development of clinical intervention drugs for POCD, and has important clinical significance and application prospects.

[0033] In the present invention, the drugs that inhibit the expression level of Lingo1 mRNA or protein can be gene drugs, chemical drugs, or biological drugs. The above drugs can target Lingo1 at the gene level or protein level, inhibit the expression of Lingo1 protein by blocking the transcription and translation of Lingo1, or block the downstream signal transduction by binding to the active site of Lingo1 protein, and finally improve the occurrence and development of POCD by inhibiting the function of Lingo1 protein.

[0034] Obviously, based on the above content of the present invention, according to the common general technical knowledge and customary means in the art, without departing from the above basic technical idea of the present invention, various other forms of modifications, substitutions, or changes can be made.

[0035] The following is a further detailed description of the above content of the present invention through specific embodiments in the form of examples. However, this should not be understood as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. Description of the Drawings

[0036] Figure 1 It is the result of detecting the postoperative motor ability of mice by the open field test.

[0037] Figure 2 It is the result of evaluating the cognitive function of mice by the Y maze. The left figure is the statistical result of the number of shuttle times of mice in the Y maze, and the right figure is the statistical result of the spontaneous alternation of mice in the Y maze, *P < 0.05, **P < 0.01, ***P < 0.001.

[0038] Figure 3 It is to evaluate the cognitive ability of mice by the novel object recognition test. The left figure is the statistical result of the exploration of the same object by mice in the training stage, and the right figure is the statistical result of the exploration of novel objects by mice, *P < 0.05, ***P < 0.001.

[0039] Figure 4 Results of evaluating the expression of Lingo1 protein in the hippocampus of mice by qRT-PCR.

[0040] Figure 5 Results of evaluating the expression of Lingo1 protein in the hippocampal tissue of mice by Western blot. The left figure is the Western blot detection result of Lingo1 protein, and the right figure is the statistical result of the relative expression level of Lingo1 protein.

[0041] Figure 6 Results of evaluating the expression level of Lingo1 protein in different regions of the hippocampal tissue of mice by immunofluorescence experiment. The upper figure is the immunofluorescence result, and the lower figure is the statistical result of the relative fluorescence intensity. **P < 0.01, ****P < 0.0001.

[0042] Figure 7 Results of evaluating after the up-regulation of Lingo1 expression in the hippocampal tissue by Western blot. The left figure is the Western blot detection result, and the right figure is the statistical result of the relative expression level of Lingo1 protein. ****P < 0.0001.

[0043] Figure 8 Results of detecting the motor ability of mice with up-regulated Lingo1 expression in the hippocampal tissue by open field test.

[0044] Figure 9 Results of detecting the motor ability of mice with up-regulated Lingo1 expression in the hippocampal tissue by Y-maze. The left figure is the statistical result of the number of shuttle times of mice in the Y-maze, and the right figure is the statistical result of the spontaneous alternation of mice in the Y-maze. *P < 0.05, **P < 0.01.

[0045] Figure 10 Results of evaluating the cognitive ability of mice with up-regulated Lingo1 expression in the hippocampal tissue by novel object recognition experiment. The left figure is the statistical result of the exploration of the same object by mice in the training stage, and the right figure is the statistical result of the exploration of novel objects by mice. *P < 0.05, **P < 0.01.

[0046] Figure 11 Results of evaluating after the down-regulation of Lingo1 expression in the hippocampal tissue by Western blot. The left figure is the Western blot detection result, and the right figure is the statistical result of the relative expression level of Lingo1 protein. **P < 0.01, ***P < 0.001.

[0047] Figure 12Results of detecting the motor ability of mice with down-regulated Lingo1 expression in the hippocampal tissue by the open field test.

[0048] Figure 13 Results of detecting the motor ability of mice with down-regulated Lingo1 expression in the hippocampal tissue by the Y maze. The left figure shows the statistical results of the number of shuttle times of mice in the Y maze, and the right figure shows the statistical results of the spontaneous alternation of mice in the Y maze, **P < 0.01.

[0049] Figure 14 Results of evaluating the cognitive ability of mice with down-regulated Lingo1 expression in the hippocampal tissue by the novel object recognition test. The left figure shows the statistical results of the exploration of the same object by mice during the training stage, and the right figure shows the statistical results of the exploration of novel objects by mice, *P < 0.05, **P < 0.01. Specific implementation manners

[0050] The raw materials and equipment used in the specific implementation manners of the present invention are all known products and are obtained by purchasing commercially available products.

[0051] Example 1: Construction and evaluation of the POCD model

[0052] 1. Construction of the animal model

[0053] Place 16-month-old male C57BL / 6 mice in an anesthesia induction chamber, induce anesthesia in mice with 3% isoflurane until the righting reflex disappears. After meeting the requirements of surgical anesthesia, place them on a warming pad, fix them on the operating table, maintain anesthesia with 1.5% isoflurane, and detect the rectal temperature of the mice. After fixing the mice in the right lateral position, use depilatory cream to remove the hair of the skin about 2 cm × 2 cm under the left costal margin of the mice to expose the surgical area. After disinfection with iodophor, use scissors to horizontally cut the skin about 1.5 cm below the left costal margin, about 1 cm long, bluntly separate the subcutaneous tissue, cut open the muscle, bluntly separate, and expose the abdominal cavity. Find the kidney below the spleen, gently hold the kidney with a microsurgical straight forceps in the right hand, and slowly remove the kidney. Gently strip the perirenal connective tissue and renal capsule with a microsurgical straight forceps, use a 5-0 suture to ligate the renal pedicle, one place about 0.5 cm away from the root of the renal hilum, and one place close to the root of the renal hilum, pay attention to avoid tying the intestine, cut the ureter and perirenal blood vessels between the two ligation points, remove the left kidney, disinfect the skin around the incision with iodophor, and use a 5-0 suture to suture the muscle and skin layer by layer. Finally, inject 40 μL of 0.2% ropivacaine subcutaneously before closing the incision for postoperative analgesia. Place the postoperative mice back in the cage to recover, and return them to the animal room for breeding after the mice wake up. The control group mice are placed in the same surgical environment without receiving anesthesia and surgical treatment. Evaluate the motor ability and cognitive function of the mice by the open field test, Y maze and novel object recognition test on the 1st, 3rd and 7th days after surgery.

[0054] 2. Open field test

[0055] In this invention, an open field test was conducted to observe whether the surgical operation would affect the spontaneous activity ability of mice. The experimental device consisted of two parts: one was an open field reaction chamber, and the other was a data automatic acquisition and processing system. The temperature of the behavioral test room was controlled at about 22 °C, and moderate sound insulation was adopted to reduce external interference. At 1, 3, and 7 days after the operation, the mice were gently placed in the middle of the open field reaction chamber (60×40×20 cm), and the digital camera directly above the open field reaction chamber was used to record and analyze the spontaneous movement distance of the mice within 5 min. After the experiment of each mouse was completed, the entire experimental chamber was wiped with 75% alcohol to exclude the influence of odor on the experimental results and ensure the consistency of the experiment. There were 15 mice in each of the surgical group and the control group.

[0056] The results of the open field test showed that there was no significant difference in the total movement distance of the mice in the surgical group and the control group on the 1st, 3rd, and 7th days after the operation ( Figure 1 ), indicating that the operation had no negative impact on the motor ability of the mice.

[0057] 3. Y maze

[0058] The Y maze device was composed of three closed arms with an included angle of 120°. One hour before the start of the experiment, the mice were sent into the behavioral experiment room equipped with the Y maze device to adapt to the environment. The total number of arm entries and the spontaneous alternation rate of the mice in the Y maze were automatically recorded and analyzed through a small animal behavioral video tracking system. During the test, the mice were gently placed in one arm (A) of the maze and allowed to freely explore the Y maze for 8 min. After the test of each mouse, the Y maze was cleaned with 75% alcohol to remove the excreta and odor of the mice before the next mouse was tested. There were 15 mice in each of the surgical group and the control group. The definition of spontaneous alternation was that the mice continuously chose to enter different three arms (ABC, BCA, or CAB, but not including BAB, CAC, or CBC). The calculation formula of the spontaneous alternation rate was as follows: % spontaneous alternation = number of spontaneous alternations / (total number of arm entries - 2) × 100%.

[0059] The results of the Y maze test showed that there was no difference in the number of shuttles of the mice in the surgical group and the control group in the Y maze ( Figure 2 ), and at the same time, there was no statistical difference in the spontaneous alternation rate of the two groups of mice in the Y maze before the operation ( Figure 2 ), indicating that the motor ability of the mice in the Y maze did not change before and after the operation, and the cognitive levels of the two groups of mice before the operation were comparable. However, the spontaneous alternation rate of the mice in the surgical group in the Y maze on the 1st, 3rd, and 7th days after the operation was significantly reduced ( Figure 2 ), indicating that the operation had an important adverse impact on the spatial memory ability of the elderly mice.

[0060] 4. Novel object recognition experiment

[0061] One hour before the experiment, the mice were placed in the new object recognition experiment room to adapt to the environment. The exploration times of each object by the mice in the novel object recognition test (NOR test) were automatically recorded and analyzed through a small animal ethology video tracking system. The behaviors of the mice such as grasping, touching, and sniffing the objects were all exploratory behaviors. The test was carried out in three stages. Adaptation stage: The mice were gently placed in the test box and allowed to freely explore the test box for 20 minutes. Training stage: Four hours after the end of the adaptation stage, training was carried out. Two identical objects were placed in the test box, and the same mouse was gently placed with its back to the objects in the test box and allowed to freely explore the objects for 5 minutes, and the usage time of each object was recorded. Test stage: Twenty-four hours after the end of training, the novel object recognition test was carried out. One of the two identical objects used in the training process was replaced with a novel object, and the mice were allowed to freely explore for 5 minutes, and the usage time of each object was recorded. After each mouse's training or test, the test box was cleaned with 75% alcohol to remove the mouse excrement and odor before the next mouse's training or test. There were 15 mice in each of the surgical group and the control group. The calculation formula for the exploration rate of the mice for the same object was as follows: % exploration rate = number of explorations of a single object / total number of explorations × 100%; the calculation formula for the cognitive index was as follows: % cognitive index = number of explorations of the novel object / total number of explorations × 100%.

[0062] The novel object recognition experiment showed that there was no difference in the exploration rate of the two exactly identical objects between the surgical group and the control group during the training stage( Figure 3 ), while during the test stage, the exploration rate of the novel object by the mice in the surgical group was significantly lower than that of the control group on the 3rd and 7th days after surgery( Figure 3 ), indicating that the mice had significant learning and memory impairment after surgery.

[0063] The above results showed that the anesthesia surgery had no significant adverse effect on the motor ability of the mice, while the mice had significant cognitive function decline after surgery.

[0064] Example 2. Evaluation of Lingo1 expression in the hippocampal tissue of mice after surgery

[0065] 1. Specimen collection

[0066] Perform surgical modeling according to the method described in Example 1. Three days after mouse modeling (3 days after surgery), anesthetize the mice by intraperitoneal injection of tribromoethanol at a dose of 0.2 mL / 10 g body weight. After anesthesia, fix the mice in the supine position on the animal experiment board. Tissue sample collection: After collecting blood from the right atrium, immediately sacrifice the mice and cut off their heads. Then, cut open the skull, remove the skull with forceps, take out the whole brain, place it in frozen PBS to isolate the hippocampal tissue, temporarily store it in liquid nitrogen, and then transfer it to an -80°C refrigerator for storage; for pathological staining samples, anesthetize the mice, open the chest cavity to expose the heart, perfuse 20 mL of pre-cooled 0.9% normal saline through the heart, and then perfuse 20 mL of pre-cooled 4% paraformaldehyde. After perfusion, the brain tissue becomes white and hard. Immediately behead the mice to take out the brain and place it in 4% tissue fixative for preservation.

[0067] 2. Real-time fluorescence quantitative (qRT) PCR experiment

[0068] Take out the mouse hippocampal tissue from the -80°C refrigerator, transfer it to an enzyme-free centrifuge tube, add 500 μL of TRIzol, homogenize and break the tissue in a low-temperature tissue homogenizer. After centrifuging the homogenate at 4°C and 12,000 rpm for 15 min, collect the supernatant. Add 200 μL of chloroform to the supernatant, vortex and mix well, then let it stand on ice for 5 min. After the sample layers, centrifuge and separate at 4°C and 12,000 rpm for 15 min. Carefully transfer the upper clear liquid to a new centrifuge tube, add 80% DEPC water-ethanol and mix well, then let it stand on ice for 15 min. Transfer the above sample to a centrifugal column, centrifuge at 4°C and 12,000 rpm for 20 min, discard the filtrate. Transfer the centrifugal column to a new enzyme-free collection tube, add 30 μL of DEPC water, centrifuge at 4°C and 12,000 rpm for 15 min. The 30 μL of filtrate in the collection tube is the RNA solution. Further, use a ultra-micro spectrophotometer to measure the RNA concentration in the sample. Clean the sample stage with DEPC water and then wipe it dry. Set the program to the RNA measurement option, and sequentially aspirate 1 μL of the RNA solution for measurement. Record the displayed RNA concentration and the A260 / A280, A260 / 230 values. Prepare a total system of 16 μL of Mix reverse transcription mixture in a 200 μL enzyme-free centrifuge tube: Add X μL of RNA template, 4 μL of 4×gDNA wipermix, and 16 - X μL of RNase-free double-distilled water according to the ratio, so that the total RNA amount is between 1 pg - 1 μg. The RNA concentration is calculated according to the measured sample concentration to make the total RNA concentration of each tube consistent. After gently pipetting and mixing the liquid in each tube, heat it at 42°C for 2 min, and then add 4 μL of 5×HiScriptⅡqRT SuperMixⅡ to form a 20 μL reverse transcription reaction system. Reverse transcription reaction: React at 50°C for 15 min and at 85°C for 5 s. The reverse-transcribed cDNA solution is used for the subsequent qRT-PCR reaction. Add 5 μL of SYBR Green supermix, 3 μL of DEPC water, 1 μL of primer (0.5 μL each of the upstream primer and the downstream primer), and 1 μL of sample cDNA to an enzyme-free 96-well PCR plate. After gently mixing the added reaction system, place the PCR plate in a centrifuge and centrifuge at 4°C for 5 min, with the rotation speed set at 2000 rpm. Place the PCR plate in a dual-channel Real-Time PCR instrument and select the qRT PCR reaction program for amplification.

[0069] The qRT-PCR results showed that Lingo1 mRNA was significantly up-regulated in the hippocampal tissue of the surgical group mice compared with the control group, and the results were significantly different. ( Figure 4 )。

[0070] 3. Western Blot experiment

[0071] Add mouse hippocampal tissue to RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors, grind it thoroughly with a tissue grinder on ice, then place it in an ice bath for 60 min for sufficient lysis. Centrifuge at 4°C and 12,000 rpm for 15 min, collect the supernatant protein sample, and quantitatively analyze the protein concentration using a BCA protein quantification kit. Add the protein sample to the SDS-PAGE gel and separate the proteins at a voltage of 120 V. Determine the appropriate electrophoresis time according to the position of the Protein Ladder and the molecular weight of the target protein. Cut a PVDF membrane of appropriate size and activate it in methanol for 30 s. Make a "sandwich" in the order of sponge - filter paper - gel - PVDF membrane - filter paper - sponge, place it in a transfer tank, fill it with transfer buffer, and transfer the proteins at 4°C and 250 mA. Set the transfer time according to the molecular weight of the target protein. After the transfer is completed, block the PVDF membrane with 5% skim milk for 60 min, wash it 3 times with TBST, then add the primary antibody diluted in an appropriate ratio and incubate overnight. After incubation, wash the PVDF membrane 3 times with TBST, add the secondary antibody and continue to incubate at room temperature for 60 min, and then wash the PVDF membrane 3 times with TBST. Place the membrane in a chemiluminescent imager, add the developing solution, and expose and develop according to the appropriate time for the target protein.

[0072] The Western Blot results also showed that the Lingo1 protein in the hippocampal tissue was significantly upregulated on the 3rd day after surgery in aged mice, and the results were significantly different ( Figure 5 ).

[0073] 4. Immunofluorescence staining experiment

[0074] Transfer the whole mouse brain tissue stored in 4% paraformaldehyde to 30% sucrose solution for dehydration for 72 h. Vertically place the mouse brain tissue on the supporting base of the cryostat, and use OCT tissue embedding agent for tissue freezing and embedding. Set the cryostat parameters, the working temperature is -20 °C, and the thickness of the brain tissue section is 40 μm. Place the cut brain slices in ice-cold PBS and store them in a 4 °C refrigerator. Add 300 μL of ice-cold PBS to a clean 48-well plate, gently pick out the brain slices with a brush and transfer them to the wells, and wash them 3 times with ice-cold PBS, 5 min each time. Discard the PBS, add 300 μL of blocking solution, and block at room temperature for 1 h. Wash the blocked brain slices 3 times with PBS, 5 min each time. Add the diluted primary antibody to each well and incubate overnight in a 4 °C refrigerator. Wash the incubated brain slices 3 times with PBS, 5 min each time. Then add the appropriate concentration of secondary antibody solution, incubate in the dark at room temperature for 1 h, and then wash 3 times with PBS, 5 min each time. After picking out the brain slices in the well plate with a brush, carefully attach them to the glass slide. After waiting for the glass slide to dry completely, use a mounting medium containing DAPI for mounting. The mounted specimens can then be observed and photographed under a microscope.

[0075] The results of the immunofluorescence experiment showed that compared with the control group, the expression of Lingo1 protein was up-regulated in the neurons of the CA1, CA2, and CA3 subregions of the hippocampal tissue in the surgical group mice ( Figure 6 ), indicating that the up-regulation of the expression of Lingo1 mRNA and protein in the mouse hippocampal region may be related to the occurrence of POCD in aged mice.

[0076] From the above results, it can be seen that the expression levels of Lingo1 mRNA and protein are related to postoperative cognitive dysfunction. When postoperative cognitive dysfunction occurs, the expression levels of Lingo1 mRNA and protein are significantly increased.

[0077] Example 3. Evaluation of cognitive impairment induced by up-regulated Lingo1 expression in hippocampal neurons

[0078] 1. Construction of overexpression adeno-associated virus vector: Determine the mouse Lingo1 gene sequence, and select the construction of Lingo1 overexpression adeno-associated virus vector containing the specific tag 3×FLAG and hSyn promoter: pAAV-hSyn-Lingo1-3xFLAG-P2A-EGFP-WOP and the control virus vector pAAV-hSyn-3xFLAG-P2A-EGFP-WOPE with green fluorescence. The above vectors were all constructed by Shanghai Genechem Co., Ltd.

[0079] 2. Stereotaxic injection into the brain

[0080] After anesthetization, 3-month-old male C57BL / 6 mice were placed in a prone position under a brain stereotaxic instrument. The hair on the head of the mouse was carefully removed with a hair remover. After disinfection with iodine, a 1-cm long incision was cut vertically along the midline with scissors, and the subcutaneous fascia was carefully separated with forceps to expose the skull. The stereotaxic instrument parameters were set according to the mouse brain anatomical atlas: 2.0 mm backward from the anterior fontanelle, 1.8 mm to both sides of the midline, and 1.7 mm deep under the skull, which was the CA1 region of the hippocampus; 2.1 mm backward from the anterior fontanelle, 2.0 mm to both sides of the midline, and 2.0 mm deep under the skull, which was the CA3 region of the hippocampus. The micro-skull drill was turned on and holes were carefully drilled at the corresponding positions (CA1 and CA3 regions). 1 μL of Lingo1 overexpression vector was injected into the corresponding position using a micro-syringe, and the control group was injected with an equal amount of control virus vector, with an injection speed of 0.5 μL / min. After each injection, the needle was left for 10 minutes before being pulled out. After the end, iodine was used for disinfection. Use 4-0 silk sutures to suture the incision skin and disinfect again. After the operation is completed, place the mouse in a cage for observation and wait for it to wake up. Pay attention to the breathing rate of the mouse. If there is no abnormality after the mouse wakes up, it can be returned to the original cage and animal room.

[0081] 3. Lingo1 expression detection

[0082] After 21 days of viral expression, the mice were euthanized, and the mouse hippocampus tissue was quickly isolated. The expression of Lingo1 in the mouse hippocampus was evaluated according to the Western blot procedure described in Example 2. The mice injected with equal amounts of PBS and control virus were used as blank control and experimental control, respectively.

[0083] Western blot results showed that the expression level of Lingo1 in the hippocampus of mice injected with AAV-Lingo1 was greatly increased ( Figure 7 ).

[0084] 4. Evaluation of the effect of Lingo1 overexpression in hippocampal tissue on cognitive behavior of mice

[0085] After 21 days of viral expression, the cognitive behavior of the mice was evaluated according to the open field test, novel object recognition test and Y-maze test protocol described in Example 1. The results of the open field test showed that there was no significant difference in the total movement distance of mice injected with PBS, AAV vector and AAV-Lingo1 in the open field ( Figure 8 ); The Y-maze results showed that there was no significant difference in the total number of shuttling in the Y-maze between mice injected with PBS, AAVvector and AAV-Lingo1, and the spontaneous alternation rate in the Y-maze of mice injected with AAV-Lingo1 was significantly lower than that of the control group ( Figure 9) The results of the new object recognition experiment showed that there was no statistical difference in the exploration rate of the same object among the mice in the PBS, AAV vector, and AAV-Lingo1 injection groups during the training stage. During the testing stage, the exploration rate of the novel object in the AAV-Lingo1 group of mice was significantly lower than that of the control group ( Figure 10 ). Based on the above results, it was found that the mice injected with AAV-Lingo1 showed significant cognitive function decline compared with the other two groups of mice, and the occurrence of these behaviors was not directly related to the motor ability of the mice, indicating that the up-regulation of the expression of Lingo1 protein in hippocampal neurons is an important factor for the cognitive function impairment in mice.

[0086] Example 4: Down-regulation of Lingo1 expression in hippocampal neurons improved the impairment of postoperative cognitive function in mice

[0087] 1. Construction of the knockdown adeno-associated virus vector

[0088] An adeno-associated virus vector containing the green fluorescent reporter gene EGFP and the shRNA interference gene was selected to specifically knockdown the expression of Lingo1 in mouse hippocampal neurons. This virus vector was named pAAV-U6-shRNA(Lingo1)-CMV-EGFP-WPRE(Lingo1-shRNA). The target sequence corresponding to Lingo1 in this virus vector was: GCAACACAAAGCACAACATCG (SEQ.NO1), and the control virus NC sequence was CCTAAGGTTAAGTCGCCCTCG (SEQ.NO2), named pAAV-U6-shRNA(NC2)-CMV-EGFP-WPRE(vector). The above vectors were all constructed by Shanghai Genechem Co., Ltd.

[0089] 2. Stereotaxic injection into the brain

[0090] The blank vector and Lingo1-shRNA were injected into the CA1 and CA3 regions of the mouse hippocampus according to the stereotaxic injection protocol described in Example 3.

[0091] 3. Detection of Lingo1 expression

[0092] On the 21st day after virus expression, the mice were subjected to unilateral nephrectomy according to the method described in Example 1. On the third day after the operation, the mice were euthanized, and the hippocampal tissues of the mice were quickly isolated. The expression of Lingo1 in the mouse hippocampus was evaluated according to the Western blot procedure described in Example 2. The mice injected with an equal amount of the control virus were used as the experimental control group.

[0093] Western blot results showed that in the surgical group and the control group, the injection of Lingo1-shRNA interfering virus could effectively down-regulate the expression of Lingo1 protein in hippocampal neurons( Figure 11 ).

[0094] 4. Evaluation of the effect of Lingo1 down-regulation in hippocampal tissue on cognitive behavior of mice

[0095] On the 21st day after virus expression, unilateral nephrectomy was performed on the mice according to the method described in Example 1. On the third day after the operation, the cognitive ability of the mice was evaluated by the open field test, novel object recognition test and Y-maze test described in Example 1. The results of the open field test showed that the motor ability of each group of mice was not significantly affected( Figure 12 ). The results of the Y-maze showed that there was no significant difference in the number of shuttle times in the Y-maze after surgery between the mice injected with interfering virus and the blank vector. However, the spontaneous alternation rate of the surgical group mice injected with interfering virus was significantly higher than that of the surgical group mice injected with the blank vector( Figure 13 ), indicating that the down-regulation of Lingo1 protein expression in hippocampal neurons significantly improved the postoperative spatial memory ability of aged mice; in the novel object recognition test, it was found that the number of explorations of novel objects by the surgical group mice injected with Lingo1 interfering virus was also significantly higher than that of the control group mice after surgery( Figure 14 ), further proving that the down-regulation of Lingo1 expression in hippocampal neurons helps to improve the impairment of postoperative cognitive function in aged mice. In summary, the up-regulation of Lingo1 expression in hippocampal neurons is an important regulatory factor for the occurrence of POCD in aged mice. When the Lingo1 protein expression is down-regulated, the cognitive function damage caused by anesthesia surgery is significantly improved, indicating the potential feasibility of Lingo1 protein as an intervention target for POCD.

[0096] In summary, the present invention provides the application of Lingo1 as a therapeutic target for POCD. First, the present invention found that POCD would lead to a significant increase in the expression levels of Lingo1 mRNA and protein. Therefore, the expression levels of Lingo1 mRNA and protein can be used for the auxiliary diagnosis of POCD; secondly, the present invention found that the up-regulation of the expression levels of Lingo1 mRNA and protein would lead to the occurrence of POCD, while the down-regulation of the expression levels of Lingo1 mRNA and protein could improve POCD. Therefore, Lingo1 can be used as an intervention target for POCD, and drugs that inhibit the expression level of Lingo1 mRNA or protein can be used for the prevention, improvement and even treatment of postoperative cognitive dysfunction. The present invention provides an important target for the development of clinical intervention drugs for POCD, and has important clinical significance and application prospects.

Claims

1. Use of a Lingo1 detection reagent in the preparation of a detection kit for postoperative cognitive dysfunction; the Lingo1 detection reagent is a reagent for detecting the expression level of Lingo1 mRNA or a reagent for detecting the expression level of Lingo1 protein.

2. The use according to claim 1, wherein: the reagent for detecting the expression level of Lingo1 mRNA is a gene chip reagent, a Northern blot reagent or a quantitative PCR reagent; and / or, the reagent for detecting the expression level of Lingo1 protein is a reagent for enzyme-linked immunosorbent assay, a reagent for immunoblotting, a reagent for immunoelectrophoresis, a reagent for tissue immunostaining, a reagent for immunoprecipitation analysis, a reagent for radioimmunoassay, a reagent for radioimmunodiffusion assay, a reagent for complement fixation analysis, a reagent for fluorescence-activated cell sorting, a reagent for mass spectrometry or a reagent for protein microarray.

3. The use according to claim 1 or 2, wherein: the reagent for detecting the expression level of Lingo1 mRNA or the reagent for detecting the expression level of Lingo1 protein is a reagent for detecting the expression level of Lingo1 mRNA or the expression level of Lingo1 protein in the hippocampal tissue.

4. A detection kit for postoperative cognitive dysfunction, wherein: it comprises a reagent for detecting the expression level of Lingo1 mRNA and / or a reagent for detecting the expression level of Lingo1 protein; preferably, the reagent for detecting the expression level of Lingo1 mRNA is a gene chip reagent, a Northern blot reagent or a quantitative PCR reagent; and / or, the reagent for detecting the expression level of Lingo1 protein is a reagent for enzyme-linked immunosorbent assay, a reagent for immunoblotting, a reagent for immunoelectrophoresis, a reagent for tissue immunostaining, a reagent for immunoprecipitation analysis, a reagent for radioimmunoassay, a reagent for radioimmunodiffusion assay, a reagent for complement fixation analysis, a reagent for fluorescence-activated cell sorting, a reagent for mass spectrometry or a reagent for protein microarray.

5. The kit according to claim 4, wherein: the reagent for detecting the expression level of Lingo1 mRNA or the reagent for detecting the expression level of Lingo1 protein is a reagent for detecting the expression level of Lingo1 mRNA or the expression level of Lingo1 protein in the hippocampal tissue.

6. Use of a Lingo1 inhibitor in the preparation of a drug for preventing and / or treating postoperative cognitive dysfunction; the Lingo1 inhibitor is a reagent for inhibiting the expression level of Lingo1 mRNA and / or the expression level of Lingo1 protein; preferably, the Lingo1 inhibitor is a reagent for inhibiting the function of Lingo1 protein.

7. The use according to claim 6, wherein: the reagent for inhibiting the expression level of Lingo1 mRNA is a drug delivery system loaded with a gene interfering with the expression of Lingo1 mRNA, a lentivirus, an adenovirus or an adeno-associated virus; Preferably, the reagent for inhibiting the expression level of Lingo1 mRNA is an adeno-associated virus loaded with siRNA gene or shRNA gene interfering with the expression of Lingo1 mRNA.

8. The use according to claim 6, wherein: the reagent for inhibiting the expression level of Lingo1 protein is a small molecule inhibitor, polypeptide inhibitor, protein inhibitor, antibody inhibitor or a drug delivery system comprising the above inhibitors for inhibiting the expression of Lingo1 protein.

9. The use according to any one of claims 6 to 8, wherein: the administration route of the drug is oral administration, administration via the olfactory bulb, intravenous injection, intramuscular injection, subcutaneous injection or stereotactic injection into the brain tissue; preferably, the administration route is stereotactic injection into the brain tissue.

10. A drug for preventing and / or treating postoperative cognitive dysfunction, wherein: it is a pharmaceutical preparation prepared with a Lingo1 inhibitor as an active ingredient, plus pharmaceutically acceptable excipients or auxiliary components; the Lingo1 inhibitor is a reagent for inhibiting the expression level of Lingo1 mRNA and / or the expression level of Lingo1 protein; preferably, the Lingo1 inhibitor is a reagent for inhibiting the function of Lingo1 protein.

Images