Ep300 gene single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof

Abstract

The application discloses an EP300 gene single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof, and belongs to the technical field of livestock breeding. The application provides three SNP molecular markers in an EP300 gene which are significantly related to chicken carcass traits, the nucleotide sequences of the three SNP molecular markers are shown in SEQ ID NO. 1, and the SNP sites and polymorphisms are respectively a C>T mutation at the 697th position, a T>C mutation at the 707th position and a G>A mutation at the 732th position of the sequence shown in SEQ ID NO. 1. Experimental results show that the three molecular markers are significantly related to the whole net cavity weight and wing weight of chickens (P<0.05). The molecular markers provided by the application can accurately identify the carcass traits of chickens, provide a scientific basis for the selection of high-quality chickens with carcass traits, and have a wide application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of livestock breeding, in particular to a single nucleotide polymorphism molecular marker of an EP300 gene related to chicken carcass traits and application thereof. BACKGROUND

[0002] In modern poultry farming, chicken is an important economic animal, and its carcass traits are one of the core factors determining its market value. Single nucleotide polymorphism (SNP) is the most widely existing genetic variation in the genome, accounting for more than 90% of all known genetic variations. SNP refers to the variation of a single nucleotide in the genome, including base conversion, transversion, insertion or deletion. Recent studies have shown that SNPs in the genome have a significant impact on animal production performance, especially in growth rate, meat quality, feed conversion efficiency and disease resistance. In addition, SNP can also be used as an important tool for molecular marker-assisted selection (MAS), which can significantly improve breeding efficiency and selection effect through early screening and precise breeding, and provide strong support for the sustainable development of poultry industry.

[0003] The E1A binding protein p300 (EP300) gene encodes a transcription coactivator protein and belongs to the histone acetyltransferase (HAT) family. The gene regulates gene transcription through chromatin remodeling and plays an important role in biological processes such as cell proliferation, differentiation and cell cycle regulation. However, no SNP site or molecular marker based on the EP300 gene has been reported. SUMMARY

[0004] The purpose of the present application is to provide a single nucleotide polymorphism molecular marker of an EP300 gene related to chicken carcass traits and application thereof to solve the problems existing in the prior art. The present application found that multiple SNP sites of the chicken EP300 gene are significantly related to chicken carcass traits, and a new SNP molecular marker is provided for efficient screening of chicken breeds with outstanding carcass traits in combination with chicken carcass trait indicators.

[0005] To achieve the above purpose, the present application provides the following solutions:

[0006] The present application provides a molecular marker related to chicken carcass traits, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and a C>T mutation exists at position 697 of the sequence shown as SEQ ID NO. 1; the genotype of position 697 of the sequence shown as SEQ ID NO. 1 includes CC, CT and TT.

[0007] Preferably, the chicken carcass traits are eviscerated weight and wing weight, and the eviscerated weight and wing weight of the TT genotype are significantly greater than those of the CC genotype.

[0008] The present application provides a molecular marker related to chicken carcass traits, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, there is a T>C mutation at position 707 of the sequence shown as SEQ ID NO. 1; the genotype at position 707 of the sequence shown as SEQ ID NO. 1 includes TT, CT and CC.

[0009] Preferably, the chicken carcass traits are eviscerated weight and wing weight, and the eviscerated weight and wing weight of the CC genotype are significantly greater than those of the TT genotype.

[0010] The present application provides a molecular marker related to chicken carcass traits, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, there is a G>A mutation at position 732 of the sequence shown as SEQ ID NO. 1; the genotype at position 732 of the sequence shown as SEQ ID NO. 1 includes GG, GA and AA.

[0011] Preferably, the chicken carcass traits are eviscerated weight and wing weight, and the eviscerated weight and wing weight of the AA genotype are significantly greater than those of the GG genotype.

[0012] The present application also provides a molecular marker combination related to chicken carcass traits, the molecular marker combination includes at least two of the three molecular markers described above.

[0013] The present application also provides a primer pair for amplifying the molecular marker described above or the molecular marker combination described above, the primer pair includes an upstream primer with a nucleotide sequence shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO. 3.

[0014] The present application also provides the use of the molecular marker described above or the molecular marker combination described above or the primer pair described above in the preparation of a product for identifying chicken carcass traits.

[0015] Preferably, the product is a kit.

[0016] The present application also provides a kit for identifying chicken carcass traits, including the primer pair described above.

[0017] The present application also provides a method for identifying chicken carcass traits, including the following steps:

[0018] Extracting the DNA of the chicken to be tested, using the primer pair described above or the kit described above to amplify, and obtaining an amplification product;

[0019] sequencing the amplification product, detecting the genotype of the molecular marker mentioned above;

[0020] judging the carcass traits of the chicken to be tested according to the genotyping result.

[0021] Preferably, the carcass traits of the chicken are the whole carcass weight and the wing weight, when the genotype of the 697th position of the sequence shown in SEQ ID NO. 1 is TT, and / or

[0022] the genotype of the 707th position of the sequence shown in SEQ ID NO. 1 is CC, and / or

[0023] the genotype of the 732th position of the sequence shown in SEQ ID NO. 1 is AA, the whole carcass weight and the wing weight of the chicken to be tested are judged.

[0024] The application further provides the use of the above-mentioned molecular marker, the above-mentioned combination of molecular markers, the above-mentioned primer pair or the above-mentioned kit in identifying the carcass traits of a chicken.

[0025] The application further provides the use of the above-mentioned molecular marker, the above-mentioned combination of molecular markers, the above-mentioned primer pair or the above-mentioned kit in breeding the carcass traits of a chicken.

[0026] The application discloses the following technical effects:

[0027] The application discloses the following technical effects: BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced as follows. Obviously, the accompanying drawings in the following description only merely some embodiments of the present application, and for those skilled in the art, other drawings can be obtained from these drawings without any creative effort.

[0029] Figure 1 Schematic diagram for the location of EP300 gene on chromosome and primer design;

[0030] Figure 2 Schematic diagram for SNP site and nucleotide polymorphism of EP300 gene. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0032] It should be understood that the terms described in the present application are merely for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or stated range of intermediate values, and any other stated value or intermediate value within the stated range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the content of the specification and that of any document incorporated by reference, the content of the specification prevails.

[0034] Various modifications and changes can be made to the specific implementation of the present application described in the specification without departing from the scope or spirit of the application. Other implementations of the present application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0035] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended terms that are intended to mean including, but not limited to.

[0036] Example 1

[0037] 1. Materials and methods

[0038] 1.1 Animal samples

[0039] A total of 282 45-day-old small white-feathered broilers, slow-type yellow-feathered broilers and fast large white-feathered broilers were selected, 2 mL of subcutaneous venous blood was collected, and -80℃ was used for DNA extraction sample. The selection group of chest angle, chest depth, chest width, live weight, tibia length, tibia circumference, body oblique length, keel length, crown height, carcass weight, subcutaneous fat thickness, intermuscular fat width, half eviscerated weight, whole eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, half eviscerated percentage, whole eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage and other carcass traits were recorded.

[0040] 1.2 Main reagents

[0041] Blood DNA extraction kit (brand: OMEGA; item number: D3392; Guangzhou Feiyang Biological Engineering Co., Ltd.), 2x ES Taq Master Mix (Dye) (brand: Novozyme; item number: P222-01; Nanjing Novozyme Biological Technology Co., Ltd.), DNA marker (brand: Quansijin; item number: BM101-01; Beijing Quansijin Biological Technology Co., Ltd.), high-purity low-electrolyte agarose (brand: Qikexue; item number: TSJ001; Beijing Qikexue Biological Technology Co., Ltd.).

[0042] 1.3 Experimental methods

[0043] 1.3.1 Primer design

[0044] According to the sequence of EP300 gene of Gallus gallus domesticus published by NCBI (NC_052532.1), the primer was designed using Primer-BLAST tool of NCBI, and the primer synthesis service was provided by Guangzhou Qikexue Biological Technology Co., Ltd. The primer sequence related information is shown in Table 1, and the primer sequence and the sequence of EP300 gene are shown in Figure 1 .

[0045] Table 1 PCR amplification primer sequence

[0046]

[0047] 1.3.2 Blood sample DNA extraction

[0048] Refer to the blood sample DNA extraction kit operation manual to extract blood sample DNA.

[0049] 1.3.3 PCR amplification of the EP300 gene sequence

[0050] Using genomic DNA from blood samples of the above 282 chickens as templates, the following reaction system was followed: 2 μL template DNA, 15 μL 2×ES Taq Master Mix (Dye), 1.2 μL upstream primer, 1.2 μL downstream primer, and 10.6 μL ddH2O.

[0051] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 52℃ annealing for 15 s, 72℃ extension for 15 s, 34 cycles; 72℃ final extension for 5 min; store at 4℃.

[0052] The PCR products were sent to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger sequencing.

[0053] 1.3.4 SNP identification and genotyping

[0054] The Sanger sequencing results of PCR products were analyzed using SnapGene software to identify potential SNP sites.

[0055] Genotyping is performed by comparing the sequencing data of each sample using SnapGene software.

[0056] 1.3.5 Association analysis between genotype and carcass traits

[0057] The phenotypic data of SNP loci and corresponding individuals with genotypes were analyzed using SPSS 26.0.

[0058] 2. Results

[0059] 2.1 PCR amplification and SNP screening of EP300 gene sequence

[0060] PCR amplification was performed on the blood DNA samples of 282 chicken individuals selected above. The PCR products (nucleotide sequences shown in SEQ ID NO.1) were then subjected to Sanger sequencing. The sequencing peak diagrams were compared and analyzed, and three SNP sites were detected: NC_052532.1:g.49850393, NC_052532.1:g.49850383, and NC_052532.1:g.49850358. Figure 2 As shown.

[0061] The NC_052532.1:g.49850393 site is located at nucleotide 697 of the sequence shown in SEQ ID NO.1, and contains a C>T mutation; the genotypes include CC, CT, and TT.

[0062] The NC_052532.1: g.49850383 site is located at nucleotide 707 of the sequence set forth in SEQ ID NO. 1, with a T > C mutation; genotypes include TT, CT, and CC.

[0063] The NC_052532.1: g.49850383 site is located at nucleotide 732 of the sequence set forth in SEQ ID NO. 1, with a G > A mutation; genotypes include GG, GA, and AA.

[0064] SEQ ID NO. 1:

[0065] GTTGGGAGTTGCTTGTACCCTGGTGATGATCCTCTTTGACCTGGGAATACACAATGTAATTGTCATCTTGCTTTGAAGTGGCAGAATATTCTGCTGCTGCTGATAGCTAGTTTTTGTGGAAGCTTTCTAACTTTTCTAGCAGGAGAGTGGTAAGGGTGAACAAGAACTGTAGTGTTCTTAACCAGTTGATGTGCTTTTCTCTACCACCTGTTGGAGCTGATGATCTCCTGCAGATAAGCATGCGCATAGAGAGGGTTGTGCCATTTCAGCTTTGTTCTGTCTTCCTCTGTTTTCCTTTTCCCTCTTCCCCTTTCTGACTCCTTGGTCTTCCTGCCAAAATTTGCAAGATATCTTGTATCCTGTATCCTCATGGTTCTTAATGTTATTTTGGGCTCTTTGCATGACATGAACTGGGATATTTCTTGTTCTAAGAAAATAACAAAGTATGGCTGTTGAAGAGCTGAACCCTTCTGCCTTTAAACTCTGTGACGTGTGCTTCTGTTCTCAATTTTGAGCAAACAATCTCCTAAATACTTAAGGATTTCTTCTCAGCAGCTCAGAAGGAAAACAATGTTACTGAAATGACTGCTTGGGTCAAAATCTATTCTCCCTTTTCACAGTGGCTTTTCCAGACCTGGCATCTTACTTGCGTAGTCCTAGATGGGGACGTTTTGGTTCTGAACAACCAGCAGTCTCCTCCCTCTTTTTGTAGACCTCTTTGACTACCTCCC GCTGTCCTTACTAACTTTGGTGCATCTCTTCTAGCGCTACTGGGTGGAG CTGCAGTAGGACTTGCAAACACCGGCTCCGTGGGTGTGGGGCAGCAGACTACGCCCAGCATAAGCACTACCAGCCAGATA. Among them, the SNP site is marked by underline.

[0066] 2.2 Association analysis of SNP sites in EP300 gene sequence and carcass traits

[0067] The above three SNP sites and carcass traits (breast angle, breast depth, breast width, live weight, tibia length, tibia circumference, body oblique length, keel length, crown height, carcass weight, subcutaneous fat thickness, intermuscular fat width, half eviscerated weight, whole eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, half eviscerated percentage, whole eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.) were subjected to association analysis.

[0068] As shown in Table 2, the results showed that the NC_052532.1:g.49850393 site was significantly associated with whole eviscerated weight and wing weight (P<0.05), and the whole eviscerated weight and wing weight of TT genotype were significantly greater than those of CC genotype (P<0.05).

[0069] Table 2 Association of SNP sites and carcass traits

[0070]

[0071] Note: Different superscripts in lowercase letters represent significant differences (P<0.05).

[0072] As shown in Table 3, the results showed that the NC_052532.1:g.49850383 site was significantly associated with whole eviscerated weight and wing weight (P<0.05), and the whole eviscerated weight and wing weight of CC genotype were significantly greater than those of TT genotype (P<0.05).

[0073] Table 3 Association of SNP sites and carcass traits

[0074]

[0075] Note: Different superscripts in lowercase letters represent significant differences (P<0.05).

[0076] As shown in Table 4, the results show that the NC_052532.1:g.49850358 locus is significantly correlated with the whole carcass weight and wing weight (P<0.05), wherein the whole carcass weight and wing weight of the AA genotype are significantly greater than those of the GG genotype (P<0.05).

[0077] Table 4 Association of SNP loci with carcass traits

[0078]

[0079] Note: Different superscripts in lowercase letters indicate significant differences (P<0.05).

[0080] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application as defined by the claims.

Claims

1. Use of a primer pair detecting a molecular marker or a combination thereof in the manufacture of a product for identifying chicken carcass traits, characterized in that, The chicken carcass traits are eviscerated weight and wing weight; The molecular marker is any one or a combination of at least two of the following molecular markers 1-3: The nucleotide sequence of the molecular marker 1 is shown as SEQ ID NO. 1, a C>T mutation exists at position 697 of the sequence shown as SEQ ID NO. 1, the genotype at position 697 of the sequence shown as SEQ ID NO. 1 includes CC, CT and TT, the eviscerated weight and wing weight of TT genotype are significantly greater than those of CC genotype; The nucleotide sequence of the molecular marker 2 is shown as SEQ ID NO. 1, a T>C mutation exists at position 707 of the sequence shown as SEQ ID NO. 1, the genotype at position 707 of the sequence shown as SEQ ID NO. 1 includes TT, CT and CC, the eviscerated weight and wing weight of CC genotype are significantly greater than those of TT genotype; The nucleotide sequence of the molecular marker 3 is shown as SEQ ID NO. 1, a G>A mutation exists at position 732 of the sequence shown as SEQ ID NO. 1, the genotype at position 732 of the sequence shown as SEQ ID NO. 1 includes GG, GA and AA, the eviscerated weight and wing weight of AA genotype are significantly greater than those of GG genotype; The primer pair consists of an upstream primer with a nucleotide sequence shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO.

3.

2. A method of identifying carcass traits in chickens, characterized in that, The method comprises the following steps: extracting DNA of the chicken to be tested, amplifying by using the primer pair to obtain an amplification product; sequencing the amplification product to detect the genotype of the molecular marker; judging the carcass traits of the chicken to be tested according to the genotyping result; The primer pair consists of an upstream primer with a nucleotide sequence shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO.

3. The chicken carcass traits are eviscerated weight and wing weight; The molecular marker is any one or a combination of at least two of the following molecular markers 1-3: The nucleotide sequence of the molecular marker 1 is shown as SEQ ID NO. 1, a C>T mutation exists at position 697 of the sequence shown as SEQ ID NO. 1, the genotype at position 697 of the sequence shown as SEQ ID NO. 1 includes CC, CT and TT; The nucleotide sequence of the molecular marker 2 is shown as SEQ ID NO. 1, a T>C mutation exists at position 707 of the sequence shown as SEQ ID NO. 1, the genotype at position 707 of the sequence shown as SEQ ID NO. 1 includes TT, CT and CC; The nucleotide sequence of the molecular marker 3 is shown as SEQ ID NO. 1, a G>A mutation exists at position 732 of the sequence shown as SEQ ID NO. 1, the genotype at position 732 of the sequence shown as SEQ ID NO. 1 includes GG, GA and AA; when the genotype at position 697 of the sequence shown as SEQ ID NO. 1 is TT, and / or the genotype at position 707 of the sequence shown as SEQ ID NO. 1 is CC, and / or the genotype at position 732 of the sequence shown as SEQ ID NO. 1 is AA. when the genotype of the 732th position in the sequence shown in SEQ ID NO. 1 is AA, it is determined that the whole carcass weight and wing weight of the chicken to be tested are large.

3. Use of a primer pair detecting a molecular marker or a combination thereof in the identification of chicken carcass traits, characterized in that, the chicken carcass traits are whole carcass weight and wing weight; the molecular marker is any one or a combination of at least two of the following molecular markers 1-3: the nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, there is a C>T mutation at the 697th position in the sequence shown in SEQ ID NO. 1, the genotype of the 697th position in the sequence shown in SEQ ID NO. 1 includes CC, CT and TT, and the whole carcass weight and wing weight of the TT genotype are significantly larger than those of the CC genotype; the nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 1, there is a T>C mutation at the 707th position in the sequence shown in SEQ ID NO. 1, the genotype of the 707th position in the sequence shown in SEQ ID NO. 1 includes TT, CT and CC, and the whole carcass weight and wing weight of the CC genotype are significantly larger than those of the TT genotype; the nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO. 1, there is a G>A mutation at the 732th position in the sequence shown in SEQ ID NO. 1, the genotype of the 732th position in the sequence shown in SEQ ID NO. 1 includes GG, GA and AA, and the whole carcass weight and wing weight of the AA genotype are significantly larger than those of the GG genotype; the primer pair consists of an upstream primer with a nucleotide sequence shown in SEQ ID NO. 2 and a downstream primer shown in SEQ ID NO.

3.

4. Use of a primer pair detecting a molecular marker or a combination thereof in chicken carcass trait breeding, characterized in that, the chicken carcass traits are whole carcass weight and wing weight; the molecular marker is any one or a combination of at least two of the following molecular markers 1-3: the nucleotide sequence of the molecular marker 1 is shown in SEQ ID NO. 1, there is a C>T mutation at the 697th position in the sequence shown in SEQ ID NO. 1, the genotype of the 697th position in the sequence shown in SEQ ID NO. 1 includes CC, CT and TT, and the whole carcass weight and wing weight of the TT genotype are significantly larger than those of the CC genotype; the nucleotide sequence of the molecular marker 2 is shown in SEQ ID NO. 1, there is a T>C mutation at the 707th position in the sequence shown in SEQ ID NO. 1, the genotype of the 707th position in the sequence shown in SEQ ID NO. 1 includes TT, CT and CC, and the whole carcass weight and wing weight of the CC genotype are significantly larger than those of the TT genotype; the nucleotide sequence of the molecular marker 3 is shown in SEQ ID NO. 1, there is a G>A mutation at the 732th position in the sequence shown in SEQ ID NO. 1, the genotype of the 732th position in the sequence shown in SEQ ID NO. 1 includes GG, GA and AA, and the whole carcass weight and wing weight of the AA genotype are significantly larger than those of the GG genotype; the primer pair consists of an upstream primer with a nucleotide sequence shown in SEQ ID NO. 2 and a downstream primer shown in SEQ ID NO. 3.

Images