Application of isosuprem hydrochloride in resisting porcine Seneca virus
By using isosuprin hydrochloride preparation, the problem of lack of effective prevention and control and treatment measures for Seneca virus disease in pigs was solved, and significant inhibition of SVA infection was achieved, and scientific and reliable prevention and treatment plans were provided.
Patent Information
- Application Number
- CN202510477722.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-06-20
AI Technical Summary
The existing technology lacks effective prevention and control and treatment measures to deal with Seneca virus disease in pigs, especially due to the continuous evolution of the virus and genomic mutation, which has led to the hindering of the vaccine development process.
Isusuprin hydrochloride is used as a new drug by preparing liquid preparations containing pharmacologically effective concentrations of isusuprin hydrochloride to prevent and treat SVA infection of Seneca type A.
Isusuprin hydrochloride significantly reduces SVA's infection to cells, inhibits the adsorption, replication, assembly and release stages of viruses, and provides a scientific basis for the prevention and treatment of Seneca virus disease in pigs.
Smart Images

Figure CN120168441A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of the application of active components, and particularly relates to the application of isoxsuprine hydrochloride in the prevention of Seneca virus in pigs. Background Art
[0002] Senecavirus A (SVA), formerly known as Seneca valley virus (SVV), is the only member of the genus Senecavirus in the family Picornaviridae. Senecavirus is a positive single-stranded RNA virus without an envelope. It is a spherical virus particle with a diameter ranging from 26 to 30 nm and icosahedral symmetry. Porcine Senecavirus disease is caused by SVA. The main symptoms are vesicular lesions. Vesicles and ulcers appear on the skin or mucous membranes of the snout, muzzle, and coronary band of diseased pigs. In severe cases, it can cause the acute death of newborn piglets. Clinically, this disease is difficult to distinguish from porcine foot-and-mouth disease, vesicular stomatitis, porcine infectious vesicular disease, etc., and can only be identified by laboratory means, which easily causes panic among pig breeding enterprises. The virus has spread widely worldwide, affecting major pig breeding countries such as the United States, Canada, and Thailand. SVA was first introduced into Guangdong Province, China in 2015, and has since been widely prevalent in many provinces and regions of China, causing serious economic losses to the pig breeding industry in China. As of 2019, SVA has been prevalent in at least 16 provinces, municipalities, and autonomous regions in China, causing significant economic losses.
[0003] The prevention and control of newly emerging and sudden infectious diseases is a common problem faced worldwide. Porcine Senecavirus disease caused by SVA, as a newly emerging pig disease, has no effective prevention and control technical means. Among them, commercial vaccines and antibodies are still in the development stage, and few research teams have reported on drug research and development. In addition, in recent years, SVA has been constantly evolving, and its strains frequently show genomic variation and recombination phenomena, further hindering the research and development process of effective vaccines. In the prevention and control of animal diseases, chemical drugs have the characteristics of easy use, low price, and obvious effects, and can be used in combination with vaccines to prevent the occurrence of diseases. Therefore, the timely research and development of drugs with SVA antagonistic activity is of great research significance for the prevention and treatment of SVA. Summary of the Invention
[0004] The purpose of the present invention is to provide the application of isoxsuprine hydrochloride in the prevention of Seneca virus in pigs, so as to make up for the deficiencies of the existing technology.
[0005] The present invention first provides a new use of isoxsuprine hydrochloride, which is its application in the preparation of products for preventing and treating Senecavirus A (SVA) infection; The product is a liquid preparation.
[0006] In another aspect, the present invention also provides a liquid preparation for preventing and / or treating SVA infection, and the liquid preparation contains isoxsuprine hydrochloride at a pharmacologically effective concentration; As specifically recorded in some embodiments, the pharmacologically effective concentration is 10 - 100 μmol / L.
[0007] Preferably, the concentration of isoxsuprine hydrochloride in the preparation is 20 - 80 μmol / L.
[0008] Preferably, the concentration of isoxsuprine hydrochloride in the preparation is 40 - 60 μmol / L.
[0009] Furthermore, the liquid preparation is PBS buffer or DMSO.
[0010] Preferably, the concentration of the PBS buffer is 0.05 - 0.15 mol / L.
[0011] Preferably, the concentration of the PBS buffer is 0.08 - 0.12 mol / L.
[0012] The present invention has determined that isoxsuprine hydrochloride has a very significant effect against SVA infection, can reduce cell infection caused by SVA, and inhibit the adsorption, replication, assembly and release stages of SVA, providing a scientific and reliable theoretical basis for the clinical treatment of porcine Seneca virus disease. Description of the Drawings
[0013] Figure 1 Under a fluorescence microscope, a photograph showing the effect of isoxsuprine hydrochloride on the infection efficiency of SVA-infected BSR cells; Figure 2 Diagram of the effect of isoxsuprine hydrochloride on SVA infection on BSR cells; where A is the effect of isoxsuprine hydrochloride on SVA infection on BSR cells measured by Western blot; B is the effect of isoxsuprine hydrochloride on SVA infection on BSR cells measured by TCID50; C is the effect of isoxsuprine hydrochloride on SVA infection on BSR cells measured by fluorescence quantitative RT-PCR; Figure 3 Diagram of the effect of isoxsuprine hydrochloride on SVA adsorption on BSR cells measured by fluorescence quantitative RT-PCR; Figure 4 Diagram of the effect of isoxsuprine hydrochloride on SVA entry into cells on BSR cells; where A is the effect of isoxsuprine hydrochloride on SVA entry into cells on BSR cells measured by Western blot; B is the effect of isoxsuprine hydrochloride on SVA entry into cells on BSR cells measured by fluorescence quantitative RT-PCR; Figure 5Figure showing the effect of isoxsuprine hydrochloride on SVA replication in BSR cells; among them, A shows the effect of isoxsuprine hydrochloride on SVA replication in BSR cells determined by Western blot; B shows the effect of isoxsuprine hydrochloride on SVA replication in BSR cells determined by TCID50; C shows the effect of isoxsuprine hydrochloride on SVA replication in BSR cells determined by fluorescence quantitative RT-PCR. Figure 6 Figure showing the effect of isoxsuprine hydrochloride on the assembly and release of SVA in BSR cells; among them, A shows the effect of isoxsuprine hydrochloride on SVA assembly in BSR cells determined by fluorescence quantitative RT-PCR, and B shows the effect of isoxsuprine hydrochloride on the release of SVA determined by TCID50. Detailed implementation mode
[0014] The isoxsuprine hydrochloride used in the present invention can be a conventional commercially available product.
[0015] The present invention also provides a preparation for preventing and / or treating SVA infection. The concentration of isoxsuprine hydrochloride in the preparation is 10 - 100 μmol / L, preferably 20 - 80 μmol / L, more preferably 40 - 60 μmol / L, and most preferably 50 μmol / L. In the present invention, the drug is preferably a liquid preparation, and the solvent of the drug is preferably PBS buffer or DMSO; when the solvent is PBS buffer, the concentration of the PBS buffer is preferably 0.05 - 0.15 mol / L, more preferably 0.08 - 0.12 mol / L, and most preferably 0.1 mol / L.
[0016] The technical solutions provided by the present invention will be described in detail below in conjunction with the examples and the drawings.
[0017] Example 1: Determine that isoxsuprine hydrochloride has an effect against Seneca virus type A Prepare two isoxsuprine hydrochloride preparations. One preparation is to dissolve isoxsuprine hydrochloride in 0.1 mol / L PBS buffer, and the concentration of isoxsuprine hydrochloride is 10 mmol / L.
[0018] The other is to dissolve isoxsuprine hydrochloride in DMSO, and the concentration of isoxsuprine hydrochloride is 10 mmol / L.
[0019] Verify the effect of isoxsuprine hydrochloride on the infection efficiency caused by SVA. The specific experimental method is as follows: Dilute and count the BSR cells digested with trypsin with a nutrient solution containing 10% fetal bovine serum, and according to 5×10 5The cells were seeded into a six-well plate at a concentration of cells per well and placed in an incubator at 37 °C with 5% CO2. After the cells grew to a density of 80-90% (about 24 h), the cells were washed three times with PBS solution, pretreated with empty DMEM and PBS solutions of different concentrations of isoxsuprine hydrochloride (10 μM, 25 μM, 50 μM) for 1 h, and then infected with SVA strain (MOI = 1). After 1 h, the medium was changed, and the infection lasted for 24 h with the drug present all the time. The infection of the cells was observed under a fluorescence microscope. As shown in the results, isoxsuprine hydrochloride can reduce the green fluorescence produced by SVA ( Figure 1 ), indicating that isoxsuprine hydrochloride can effectively reduce the infection of SVA.
[0020] Example 2: Verify the effect of isoxsuprine hydrochloride in inhibiting its infectivity during the entire SVA infection cycle (Western blot, fluorescence quantitative PCR, and TCID 50 assay).
[0021] 1) Western blot was used to determine the activity of isoxsuprine hydrochloride in inhibiting SVA infection on BSR cells The BSR cells were digested and diluted with DMEM nutrient solution containing 10% FBS by volume concentration, and added dropwise to a 6-well plate at a concentration of 5×10 5 / well. After the cells adhered to form a monolayer in an incubator at 37 °C with 5% CO2 (about 24 h), the cells were washed three times with PBS solution. After sucking out the residual PBS, isoxsuprine hydrochloride (50 μM) diluted to the corresponding concentration with 1 mL of serum-free DMEM was added, and after incubating with the BSR cells at 37 °C for 1 h, the cells were infected with SVA (MOI = 1) in the presence of isoxsuprine hydrochloride at the corresponding concentration (50 μM). After incubating in an incubator at 37 °C with 5% CO2 for 1 h, it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS and maintained in the presence of isoxsuprine hydrochloride at the corresponding concentration (50 μM), and cultured in an incubator at 37 °C with 5% CO2. At 8 h, 12 h, 24 h, and 36 h after infection, the cell supernatants were collected (1 mL was stored at -70 °C for preparation for the later TCID50 assay). After washing three times with PBS and sucking out the residual liquid, the cells were lysed with a lysis buffer containing protease inhibitors. After measuring the concentration of the lysis buffer, 5× protein loading was added to collect the cell samples, boiled in a metal bath at 96 °C for 15 min, and then detected by Western blot. It was found that isoxsuprine hydrochloride reduced the expression of SVA VP3 protein, preliminarily confirming that isoxsuprine hydrochloride reduced the infection of SVA.
[0022] 2) TCID 50 assay was used to determine the activity of isoxsuprine hydrochloride in inhibiting SVA infection on BSR cells The BSR cells were digested and diluted with DMEM nutrient solution containing 10% FBS by volume, and added dropwise to a 96-well plate at a concentration of 2×10 4 / well. After being placed in an incubator at 37 °C and 5% CO2 until the cells adhered to form a monolayer, they were washed three times with PBS. After sucking out all the residual liquid, the virus supernatant collected in the previous experiment diluted with serum-free DMEM was added. Eight replicates were made for each concentration. After 1.5 h of infection, it was replaced with DMEM containing 2% FBS for maintenance. After 72 h of infection, the cell infection situation was observed until 120 h after infection. It was found that isoxsuprine hydrochloride decreased the virus titer of the SVA-infected supernatant ( Figure 2 B), confirming that isoxsuprine hydrochloride decreased the infection of SVA.
[0023] 3) Detection of the inhibitory activity of isoxsuprine hydrochloride on SVA infection on BSR cells by fluorescence quantitative RT-PCR The BSR cells were digested and diluted with DMEM nutrient solution containing 10% FBS by volume, and added dropwise to a 6-well plate at a concentration of 5×10 5 / well. After being placed in an incubator at 37 °C and 5% CO2 until the cells adhered to form a monolayer (about 24 h), the cells were washed three times with PBS solution. After sucking out the residual PBS, isoxsuprine hydrochloride (10 μM) diluted to the corresponding concentration with 1 mL of serum-free DMEM was added. After incubating with the BSR cells at 37 °C for 1 h, the cells were infected with SVA in the presence of isoxsuprine hydrochloride (10 μM). After incubating in an incubator at 37 °C and 5% CO2 for 1 h, it was replaced with 2 mL of DMEM nutrient solution containing 2% FBS and the corresponding concentration of isoxsuprine hydrochloride (10 μM) for maintenance, and placed in an incubator at 37 °C and 5% CO2 for culture. After 24 h of infection, it was directly frozen and stored in a -70 °C refrigerator. After being repeatedly frozen and thawed 3 times, the viral RNA was extracted for detection by real-time fluorescence quantitative RT-PCR method. The fluorescence quantitative RT-PCR primers used were: SVA-F CTGCGCTGGGACCGTATCTCA, SVA-R CGCCGCGCCACCTCATT, SVA-P TCGCCGTAAGCGTGCACCGAGACAG. The 20 μL reaction system used contained 5×One Step U + Mix 4 μL, OneStep U + Mix 1 μL, 0.4 μL of each upstream and downstream primer, 0.2 μL of the probe, 14.0 μL of RNase-free water, and 5 μL of the template. The amplification procedure was reverse transcription at 55 °C for 15 min, pre-denaturation at 95 °C for 2 min 30 s, and the PCR reaction was denaturation at 95 °C for 8 s and annealing at 60 °C for 16 s, for a total of 45 cycles, and fluorescence was read at 60 °C. The results were as Figure 2As shown in C, isoxsuprine hydrochloride can reduce the SVA nucleic acid copy number, confirming that isoxsuprine hydrochloride reduces SVA infection.
[0024] Example 3: Verification of the effect of isoxsuprine hydrochloride on SVA adsorption After digestion, BSR cells were diluted with DMEM nutrient solution containing 10% FBS and added dropwise to a 6-well plate at a concentration of 5×10 5 / well. After being placed in an incubator at 37°C and 5% CO2 until the cells adhered to form a monolayer (about 24 h), the cells were washed three times with PBS solution. After sucking out the residual PBS, isoxsuprine hydrochloride diluted to the corresponding concentration (10 μM, 25 μM, 50 μM) with 1 mL of serum-free DMEM was added. After incubating with BSR cells at 37°C for 1 h, it was replaced with cold serum-free DMEM, and SVA was infected at 4°C in the presence of isoxsuprine hydrochloride at the corresponding concentration (10 μM, 20 μM, 50 μM). After incubating for 1 h, it was washed three times with cold PBS, 1 mL of cold serum-free DMEM containing was added, and it was frozen in a -70°C refrigerator. After repeated freezing and thawing three times, viral RNA was extracted for fluorescence quantitative RT-PCR determination. The results are as Figure 3 shown. It was found that isoxsuprine hydrochloride reduced the SVA nucleic acid copy number, confirming that isoxsuprine hydrochloride reduced SVA adsorption.
[0025] Example 4: Verification of the effect of isoxsuprine hydrochloride on SVA entry into cells (Western blot and fluorescence quantitative RT-PCR) The digested BSR cells were diluted to an appropriate density with DMEM nutrient solution containing 10% FBS and added dropwise to a 6-well plate at a concentration of 5×10 5 / well. After being placed in an incubator at 37°C and 5% CO2 until the cells adhered to form a monolayer (about 24 h), the cells were washed 3 times with PBS. After sucking out the residual PBS, 1 mL of cold serum-free DMEM was added and SVA (MOI = 10) was infected. After incubating at 4°C for 1 h, the cells were washed three times with cold PBS and the residual liquid was sucked out. 1 mL of cold DMEM containing 2% FBS and dipotassium glycyrrhizinate at the corresponding concentration (0 μM, 10 μM, 25 μM, and 50 μM) was added. After incubating at 37°C for 1 h, it was washed three times with citric acid and then three times with PBS, and the residual liquid was sucked out. It was replaced with 2 mL of DMEM nutrient solution containing 2% FBS for maintenance and placed in an incubator at 37°C and 5% CO2 for culture. After 18 h of infection, cell samples were collected for Western blot and fluorescence quantitative RT-PCR detection. The results are as Figure 4 shown. Isoxsuprine hydrochloride did not reduce the expression of SVA VP3 protein entering the cells, nor did it reduce the amount of SVA nucleic acid entering the cells, confirming that isoxsuprine hydrochloride did not reduce the level of SVA entry into cells.
[0026] Example 5: Verification of the effect of isosuprine hydrochloride on SVA replication (Western blot, TCID50, fluorescent quantitative RT-PCR) Dilute the BSR cells to an appropriate density of 5 × 10 cells / mL in DMEM with 10% FBS. 5 / well concentration was added to a 6-well plate and placed in a 37°C, 5% CO2 incubator until the cells adhered to the wall and formed a monolayer (about 24 hours). The cells were washed three times with PBS solution, and after the residual PBS was aspirated, 1 ml of empty DMEM containing SVA virus (MOI=1) was added. After incubation at 37°C for 1 hour, the cells were washed three times with PBS, and 2 ml of DMEM containing 10 μmol / L, 25 μmol / L and 50 μmol / L isoprene hydrochloride (containing 2% serum) was added to the cells. After incubation at 37°C for 12 hours, Western blot, TCID50, and fluorescence quantitative RT-PCR were performed, and the results are shown as follows. Figure 5 As shown in , it was found that isosuprine hydrochloride reduced the expression of SVA VP3 protein, reduced the SVA nucleic acid copy number and virus titer, confirming that isosuprine hydrochloride can inhibit SVA replication.
[0027] Example 6: Verification of the effect of isosuprine hydrochloride on SVA assembly and release (Western blot, TCID50, fluorescent quantitative RT-PCR) BSR cells were cultured on different cell plates and grown to a monolayer. After SVA (MOI=1) infected BSR cells for 1 h at 37 °C, the cells were washed 3 times with PBS and the residual liquid was aspirated. The cells were incubated with 2% DMEM culture medium containing 0 μmol / L, 10 μmol / L, 25 μmol / L and 50 μmol / L reboxetine mesylate for 12 h, which was about one viral replication cycle. The supernatant was taken for later use. The cells were added with 1 mL of PBS and repeatedly frozen and thawed 3 times before the solution was collected. Within a replication cycle, when the viral assembly and release mechanisms are normal, the ratio of viral titer and nucleic acid in the supernatant and cells should be basically constant. TCID50 was used to detect the ratio of SVA virus titer in the supernatant to that in the cells, and fluorescent quantitative RT-PCR was used to detect the ratio of SVA nucleic acid copy number in the supernatant to that in the cells. The results are shown in Figure 6 As shown in A, isosuprine hydrochloride can reduce the ratio of SVA nucleic acid inside and outside the cell, proving that isosuprine hydrochloride can inhibit the SVA assembly process. Figure 6 As shown in B, isoxuprine hydrochloride reduces the titer ratio of extracellular and intracellular SVA, confirming that isoxuprine hydrochloride can inhibit the release of SVA.
[0028] In summary, the present invention finds that isosuprine hydrochloride can reduce the adsorption of SVA, inhibit the replication and release of SVA, and thus can effectively prevent and treat SVA.
Claims
1. Use of isosuprine hydrochloride in the preparation of products for preventing and treating Seneca virus type A (SVA) infection.
2. A liquid preparation for preventing and / or treating SVA infection, characterized in that: The liquid preparation contains isoxuprine hydrochloride in a pharmacologically effective concentration.
3. The liquid preparation according to claim 2, characterized in that The pharmacologically effective concentration is 10 to 100 μmol / L.
4. The liquid preparation according to claim 2, characterized in that The pharmacologically effective concentration is 20 to 80 μmol / L.
5. The liquid preparation according to claim 2, characterized in that The pharmacologically effective concentration is 40-60 μmol / L.
6. The liquid preparation according to claim 2, characterized in that The liquid preparation is PBS buffer or DMSO.
7. The liquid preparation according to claim 6, characterized in that The concentration of the PBS buffer is 0.05-0.15 mol / L.
8. The liquid preparation according to claim 6, characterized in that The concentration of the PBS buffer is 0.08-0.12 mol / L.