Drug target gene and encoding protein MoRsc1 thereof
The expression of RSC1 gene of rice blast bacteria was blocked by gene knockout, which solved the problem of high pathogenicity of rice blast bacteria, and significantly reduced the virulence and lesions formation of rice blast bacteria.
Patent Information
- Application Number
- CN202510300252.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art is difficult to effectively reduce the pathogenicity of rice blast bacteria, especially in the formation of attached cells and infecting plant cells.
Through gene knockout technology, the RSC1 gene knockout vector of rice blast pathogen was constructed, and it was introduced into the protoplast of rice blast bacteria to obtain the RSC1-deleted mutant ΔRSC1, blocking or inhibiting the expression of RSC1 gene, thereby reducing the pathogenicity of rice blast bacteria.
The loss of RSC1 significantly reduced the virulence of blastobacteria and could not form obvious lesions on rice and barley leaves, proving that MoRSC1 is necessary for the formation and pathogenicity of blastobacteria.
Smart Images

Figure CN120173974A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant genetic engineering, and particularly to a drug target gene and its encoded protein MoRsc1. Background Art
[0002] Rice blast is a fungal disease caused by a filamentous ascomycete fungus Magnaporthe oryzae (asexual state: Pyricularia oryzae). The infection of Magnaporthe oryzae runs through all growth stages and different parts of rice, causing seedling blast, leaf blast, neck blast, and node blast. Due to the wide infection range and fast spreading speed of rice blast, this disease occurs all over the world. According to statistics, the annual economic loss of rice caused by rice blast globally is about 66 billion US dollars, and the lost rice can feed 60 million people. Therefore, controlling the occurrence of rice blast is crucial for ensuring national food safety. Studying the pathogenic mechanism of Magnaporthe oryzae and exploring potential drug targets can provide important references for scientific and green prevention and control of rice blast.
[0003] The infection process of Magnaporthe oryzae on rice mainly includes: (1) Conidia are spread by wind and rain and adhere to the surface of rice leaves; (2) Conidia germinate to form germ tubes; (3) Germ tubes differentiate into appressoria; (4) Appressoria differentiate into infection pegs; (5) Infection pegs penetrate host cells and form infection hyphae in host cells, expanding between cells. Among them, the key process for Magnaporthe oryzae to successfully infect rice lies in the formation of a highly specialized infection structure - appressorium. The turgor pressure generated after the appressorium matures can enable the infection peg to penetrate the rice cuticle, thus successfully infecting rice cells. When Magnaporthe oryzae cannot form a complete appressorium, its pathogenicity is significantly weakened.
[0004] With the rapid development of genomics, proteomics, and bioinformatics, new drug target screening technologies have emerged one after another, such as RNA interference, combinatorial chemistry technology, gene chips, etc. The emergence of these emerging technologies has improved the efficiency of screening drug targets and accelerated the research and development of new drugs. Currently, the commonly used drug target screening methods at the gene level mainly include gene interference, gene knockout, and gene editing. Among them, gene knockout plays an important role in discovering gene functions and determining new drug action targets. Using high-throughput gene knockout technology in pathogenic fungi makes it possible to directly knockout genes to screen for drug targets.
[0005] The RSC complex is the most abundant chromatin remodeling complex in Saccharomyces cerevisiae and consists of 17 subunits. In yeast, the RSC complex is involved in not only transcriptional regulation but also cell cycle regulation, and the deletion of the RSC complex causes cell division to arrest at the G2-M phase. In Candida albicans, the RSC complex plays an important role in regulating pathogenicity. In Sclerotinia sclerotiorum, the RSC complex is involved in regulating vegetative growth, reactive oxygen species accumulation, and pathogenicity. In addition, the RSC complex is also involved in DNA damage repair, including excision repair, end joining, and recombination repair. The structure and function of the RSC complex have been studied to some extent in other fungi, but the biological function of the RSC complex subunit Rsc1 in Magnaporthe oryzae and its potential as a drug target remain to be explored. Summary of the Invention
[0006] In order to overcome the disadvantages and deficiencies of the prior art, the purpose of the present invention is to provide a drug target gene and its encoded protein MoRsc1. The drug target gene is the Magnaporthe oryzae gene RSC1, which can effectively reduce the pathogenicity of Magnaporthe oryzae.
[0007] By searching the NCBI database for the gene sequence and protein sequence of RSC1 (MGG_13532), it was found that the full length of its coding region is 3159 bp, containing 5 exons and 4 introns, encoding 1052 amino acids. Using the SMART (http: / / smart.embl-heidelberg.de / ) website to predict the protein domain, it was found that the RSC1 protein contains 2 conserved domains. One is the BROMO domain that can specifically bind to acetylated lysine and is usually present in chromatin structural proteins and histone acetyltransferases; the other is the BAH domain, which mainly mediates protein-protein interactions and plays an important role in gene transcriptional silencing and chromatin remodeling processes. Experiments have shown that the deletion of RSC1 significantly reduces the virulence of Magnaporthe oryzae, and no obvious lesions can be formed on rice leaves.
[0008] The purpose of the present invention is achieved by the following technical solutions:
[0009] The present invention provides the application of the drug target gene and its encoded protein MoRsc1 in reducing the pathogenicity of Magnaporthe oryzae. The drug target gene is the Magnaporthe oryzae gene RSC1, and the amino acid sequence of the encoded protein MoRsc1 is as shown in SEQ ID NO.2.
[0010] Preferably, the reduction of the pathogenicity of Magnaporthe oryzae is manifested as a decrease in the formation of appressoria of Magnaporthe oryzae, a slowdown in the vegetative growth of Magnaporthe oryzae, and / or a decrease in the sporulation ability of Magnaporthe oryzae.
[0011] The present invention also provides the application of the drug target gene and its encoded protein MoRsc1 in preventing and treating rice blast caused by Magnaporthe oryzae. The drug target gene is the Magnaporthe oryzae gene RSC1, and the prevention and treatment are achieved by blocking or inhibiting the expression of the Magnaporthe oryzae gene RSC1.
[0012] The present invention also provides the application of the Magnaporthe oryzae gene RSC1 as a target for drugs used in the prevention and treatment of plant diseases, and the plant disease is rice blast caused by Magnaporthe oryzae.
[0013] Preferably, the nucleotide sequence of the Magnaporthe oryzae gene RSC1 is the DNA sequence shown in SEQ ID NO.1.
[0014] The present invention also provides the application of an agent that blocks or inhibits the expression of the Magnaporthe oryzae gene RSC1 in the preparation of a drug. The agent is the antisense RNA or siRNA of the Magnaporthe oryzae gene RSC1, and the amino acid sequence encoded by the Magnaporthe oryzae gene RSC1 is shown in SEQ ID NO.2; the drug is used to control plant rice blast caused by Magnaporthe oryzae.
[0015] Preferably, the nucleotide sequence of the Magnaporthe oryzae gene RSC1 is the DNA sequence shown in SEQ ID NO.1.
[0016] The present invention also provides a method for preventing and treating rice blast caused by Magnaporthe oryzae, which includes blocking or inhibiting the expression of the Magnaporthe oryzae gene RSC1. The amino acid sequence encoded by the Magnaporthe oryzae gene RSC1 is shown in SEQ ID NO.2. The nucleotide sequence of the Magnaporthe oryzae gene RSC1 is the DNA sequence shown in SEQ ID NO.1.
[0017] The applications of the knockout vector and recombinant bacteria containing the above-mentioned Magnaporthe oryzae gene RSC1 in the above aspects also belong to the protection scope of the present invention.
[0018] The present invention constructs a gene knockout vector, introduces it into the protoplasts of Magnaporthe oryzae; uses the homologous recombination method to knockout the gene RSC1 from Magnaporthe oryzae to obtain the knockout mutant ΔRSC1; this mutant has defects in appressorium formation. The pathogenicity determination results show that the knockout mutant ΔRSC1 cannot form obvious lesions on rice leaves. The above experiments prove that the Magnaporthe oryzae gene RSC1 is a pathogenicity-related gene of Magnaporthe oryzae.
[0019] The beneficial effects of the present invention:
[0020] The gene RSC1 of Magnaporthe oryzae provided by the present invention can reduce the pathogenicity of Magnaporthe oryzae. Pathogenicity tests show that the deletion of MoRSC1 significantly reduces the virulence of Magnaporthe oryzae, and obvious lesions cannot be formed on rice and barley leaves. The present invention confirms that MoRSC1 is essential for the appressorium formation and pathogenicity of Magnaporthe oryzae. The present invention helps to deeply clarify the pathogenic molecular mechanism of Magnaporthe oryzae and provides a target gene for the development of effective medicaments. Brief Description of the Drawings
[0021] Figure 1 Figure shows the homology comparison results of Rsc1 in different fungi;
[0022] Figure 2 Figure shows the principle of gene knockout of RSC1 in Magnaporthe oryzae (A) and the verification results of positive transformants (B and C); Different letters indicate that the statistical results are significantly different from the wild type (p<0.05);
[0023] Figure 3 Figure shows the effects of Rsc1 on vegetative growth (A and B) and sporulation (C and D) of Magnaporthe oryzae; Different letters indicate that the statistical results are significantly different from the wild type (p<0.05);
[0024] Figure 4 Figure shows the effects of Rsc1 on the germination (A and B) of conidia and the formation of appressoria (C) of Magnaporthe oryzae; Among them, the bar graphs in C are WT, Δrsc1.1, Δrsc1.2, Δrsc1-C from left to right; Different letters indicate that the statistical results are significantly different from the wild type (p<0.05);
[0025] Figure 5 Figure shows the effects of Rsc1 on the pathogenicity of Magnaporthe oryzae; Among them, A shows the effects of inoculating different strains on barley in vitro on the pathogenicity of Magnaporthe oryzae; B shows the effects of spraying different strains on rice leaves on the pathogenicity of Magnaporthe oryzae; C shows the proportion of different strains of infecting hyphae types in the rice sheath inoculation experiment; D shows the expression levels of pathogenicity-related genes in the wild type and mutant Δrsc1, * indicates p<0.05. Detailed Embodiments
[0026] Example 1 Bioinformatics Analysis of Rsc1 in Magnaporthe oryzae
[0027] Searching for the gene sequence and protein sequence of RSC1 (MGG_13532) through the NCBI database, it was found that the full length of its coding region is 3159 bp, containing 5 exons and 4 introns, encoding 1052 amino acids. Using the SMART (http: / / smart.embl-heidelberg.de / ) website to predict protein domains, it was found that the Rsc1 protein contains 2 conserved domains. One is the BROMO domain that can specifically bind to acetylated lysine, which is usually present in chromatin structural proteins and histone acetyltransferases; the other is the BAH domain, which mainly mediates protein-protein interactions and plays an important role in gene transcriptional silencing and chromatin remodeling. Phylogenetic tree analysis found that Rsc1 is conservatively present in fungi, indicating that the function of Rsc1 in fungi may be universal( Figure 1 ).
[0028] Example 2 Obtaining of Magnaporthe oryzae RSC1 knockout mutants and complemented strains
[0029] In order to study the biological function of chromatin structure remodeling factors in Magnaporthe oryzae, using the principle of homologous recombination( Figure 2 A) Construction of the RSC1 knockout vector. First, sequences about 1 kb upstream and downstream of RSC1 and the resistance gene HPH fragment were amplified separately. The upstream and downstream flanking sequences of the gene and the resistance gene were connected to the knockout vector pFGL821 by homologous recombination to obtain the RSC1 knockout vector.
[0030] The knockout vector was transferred into the wild-type Magnaporthe oryzae strain B157 by Agrobacterium-mediated genetic transformation. After two rounds of hygromycin screening, transformants with hygromycin resistance to be detected were obtained. Genomic DNA was extracted as a template for PCR detection. Using the internal reference gene Tublin F / R as a control, the internal primers RSC1-in-F / R of the target gene (the sequence is shown in SEQ ID NO.1) could not amplify a band in Δrsc1, while a target band of about 600 bp could be amplified in the strain. Further detection was carried out using the upstream primer RSC1-tF of the gene and a primer p821-5R on the knockout vector. Δrsc1 could amplify the recombinant fragment, while the wild type could not amplify the target fragment, indicating that the gene MGG_13532 in Δrsc1 was successfully knocked out( Figure 2 B). Total RNA was extracted and reverse transcribed to obtain cDNA. The results of qRT-PCR analysis showed that compared with WT, MGG_13532 could hardly be detected in the two Δrsc1 strains. The results indicated that two Δrsc1 knockout mutants were successfully obtained, named Δrsc1.1 and Δrsc1.2( Figure 2 C). The primers used above are shown in Table 1.
[0031] Table 1
[0032] Primer 5’-3’ Tublin-F CACCTGCTTGCGTTTCCC Tublin-R TACGACGAGTTCTTGTTCTG RSC1-in-F ATGATGATGTCCACAAGAAACGTGGTC RSC1-in-R CTCTGGTCTGTAGTACCAACAAGCG RSC1-tF TTGTCATCGGCCATAACTCTAAGAAC P821-5R ACCTCCACTAGCTCCAGCCAAG
[0033] To clarify that the defective phenotype of Δrsc1 is caused by the deletion of the RSC1 gene, the RSC1 gene containing its own promoter was amplified from the wild-type genome, and the target fragment was ligated to the pFGL822 vector by homologous recombination to construct a complementation vector. Using the Agrobacterium-mediated genetic transformation method, the constructed complementation vector was transferred into the Δrsc1 strain. After screening with glufosinate antibiotic, the correct transformants were obtained through phenotypic observation and qRT-PCR analysis. The growth phenotype of the successfully complemented strain was consistent with that of the wild type, and qRT-PCR analysis showed that the expression level of the RSC1 gene in the complemented strain was restored to the wild-type level, proving that the RSC1 gene in Δrsc1-C was successfully complemented. Figure 2 C and Figure 3 A).
[0034] Example 3 Rsc1 is involved in regulating the vegetative growth and sporulation of Magnaporthe oryzae
[0035] To study the effects of the chromatin structure remodeling factor Rsc1 on the vegetative growth and sporulation ability of Magnaporthe oryzae, the wild type, the mutant Δrsc1, and the complemented strain Δrsc1-C were inoculated onto CM solid medium and cultured for 7 days to observe the changes in growth rate. The results showed that the colony diameters of WT, Δrsc1, and Δrsc1-C on CM medium were 5.2 cm, 4.3 cm, and 5.3 cm, respectively. Compared with the wild type, the colony diameter of Δrsc1 was significantly smaller, and the center of the colony showed dark green with more melanin accumulation. Figure 3 A - B). The cultured strains were cut into rectangular strips with a blade and placed on a glass slide for 24 h for conidia induction experiments. Observation of the morphology of conidiophores found that on the wild type and the complemented strain Δrsc1-C, the conidiophores on the aerial hyphae were denser and produced more conidia; while the number of conidiophores and conidia formed by Δrsc1 was significantly reduced. Figure 3 C). After measuring the sporulation amount with a hemocytometer, it was found that compared with the wild type and Δrsc1-C, the sporulation amount of Δrsc1 was significantly reduced, and the number of spores was only 3% of that of the wild type. Figure 3 D). The above results indicate that the deletion of RSC1 leads to a slowdown in the vegetative growth of Magnaporthe oryzae, sparse conidiophores, and a significant reduction in conidia.
[0036] Example 4 Rsc1 affects the germination of conidia and the formation of appressoria in Magnaporthe oryzae
[0037] To study whether the deletion of RSC1 affects the germination of conidia and the formation of appressoria in Magnaporthe oryzae, the collected spore suspension was induced to culture on hydrophobic glass slides for 4 h and 24 h respectively, and the morphology was observed under a microscope and the data were recorded. The results showed that after 4 h of culture, conidia of the wild type, Δrsc1 and Δrsc1-C could all germinate, the wild type and Δrsc1-C could form appressoria, while Δrsc1 could not produce appressoria. After 24 h of induced culture, although all strains could normally produce appressoria, the mutant Δrsc1 showed abnormal germ tube morphology, resulting in hindered appressorium formation. The appressorium formation rate of Δrsc1 (92%) was significantly lower than that of the wild type (98.5%) ( Figure 4 A-C). The results indicate that Rsc1 is involved in regulating the formation of appressoria in M. oryzae.
[0038] Example 5 Rsc1 affects the pathogenicity of Magnaporthe oryzae
[0039] The appressorium, an infection structure formed by the germination of conidia of Magnaporthe oryzae, is a necessary prerequisite for M. oryzae to successfully infect plants. Since the deletion of RSC1 leads to a decrease in the number of conidia and a reduction in the appressorium formation rate, the effect of Rsc1 on the pathogenicity of M. oryzae was further studied. Two methods, barley leaf detached inoculation and rice spray inoculation, were used for pathogenicity detection. Only a few small lesions were produced on barley leaves inoculated with Δrsc1 mycelial blocks after 4 days, while a large number of typical lesions were produced on barley leaves inoculated with wild type and Δrsc1-C mycelial blocks ( Figure 5 A). The spore suspension concentrations of the wild type, Δrsc1 and Δrsc1-C were adjusted to 5×10 4 cells / mL and sprayed on rice leaves respectively, and their phenotypes were observed 7 days after inoculation. Similar results were obtained in rice spray inoculation and barley leaf detached inoculation. A large number of necrotic lesions were produced on rice leaves inoculated with the wild type and Δrsc1-C, while the number of lesions produced on rice leaves inoculated with Δrsc1 was significantly less than that of the wild type and Δrsc1-C, and the lesions were scattered and had weak expansion ability ( Figure 5 B). The results of barley leaf detached inoculation and rice leaf spray inoculation indicate that Rsc1 plays an important role in the pathogenicity of Magnaporthe oryzae.
[0040] To further explore the reason for the weakened pathogenicity of Δrsc1 during the infection process, we conducted a rice sheath inoculation experiment. The main types of infection hyphae formed in the sheaths dropped with wild type and Δrsc1-C spore suspensions were type 3 and type 4, accounting for more than 80% of the 4 types; on the contrary, the infection hyphae formed in the sheaths dropped with Δrsc1 were mainly type 1, and the proportion of other types of infection hyphae was less than 20%. Δrsc1 could form appressoria, but 80% could not differentiate into infection hyphae ( Figure 5 C). In addition, the expression levels of pathogenicity-related genes in the Δrsc1 mutant were significantly lower than those of the wild type.Figure 5 D). Among them, MGG_04163: Magnaporthe oryzae host defense suppression pathogenicity gene; MGG_10193: encodes the Gγ subunit, and its T-DNA insertion mutation results in defects in the pathogenicity of Magnaporthe oryzae; MGG_00501: encodes a protein highly similar to Saccharomyces cerevisiae Msn2, and Msn2 is a highly conserved transcriptional activator with a C2H2 zinc finger domain; MGG_07312: encodes the SLN1P protein, which is necessary for pathogenic fungi to penetrate the cuticle of host plants; MGG_00527: encodes the MTP1 protein, which is necessary for appressorium formation and host infection; MGG_05336: encodes a type III transmembrane protein. The results show that Rsc1 is involved in regulating the pathogenic process of Magnaporthe oryzae, and the weakened pathogenicity is due to the reduced formation rate of infection pegs and the decreased ability of infection hyphae to expand.
Claims
1. Application of a drug target gene and its encoding protein MoRsc1 in reducing the pathogenicity of rice blast fungus, wherein the drug target gene is the rice blast fungus gene RSC1, and the amino acid sequence of the encoding protein MoRsc1 is shown in SEQ ID NO.
2.
2. The use according to claim 1, characterized in that: The reduction of the pathogenicity of the rice blast fungus is manifested in reducing the formation of the attachment spores of the rice blast fungus, slowing down the vegetative growth of the rice blast fungus and / or reducing the spore production ability of the rice blast fungus.
3. Application of a drug target gene and its encoding protein MoRscl in preventing and controlling rice blast caused by rice blast fungus, wherein the drug target gene is the rice blast fungus gene RSC1, and the prevention and control is achieved by blocking or inhibiting the expression of the rice blast fungus gene RSC1.
4. Application of the rice blast fungus gene RSC1 as a target for drugs used in plant disease control, wherein the plant disease is rice blast caused by rice blast fungus.
5. The use according to any one of claims 1 to 4, characterized in that: The nucleotide sequence of the rice blast fungus gene RSC1 is the DNA sequence shown in SEQ ID NO.
1.
6. Use of an agent for blocking or inhibiting the expression of the rice blast fungus gene RSC1 in the preparation of a drug, wherein the agent is an antisense RNA or siRNA of the rice blast fungus gene RSC1, and the amino acid sequence encoded by the rice blast fungus gene RSC1 is shown in SEQ ID NO.2; The drug is used for controlling rice blast disease caused by rice blast fungus.
7. The use according to claim 6, characterized in that: The nucleotide sequence of the rice blast fungus gene RSC1 is the DNA sequence shown in SEQ ID NO.
1.
8. A method for preventing and controlling rice blast caused by rice blast fungus, characterized in that: The method comprises blocking or inhibiting the expression of the rice blast fungus gene RSC1, wherein the amino acid sequence encoded by the rice blast fungus gene RSC1 is shown in SEQ ID NO.
2.
9. The method for preventing and controlling rice blast caused by rice blast fungus according to claim 8, characterized in that: The nucleotide sequence of the rice blast fungus gene RSC1 is the DNA sequence shown in SEQ ID NO.1.
Citation Information
Patent Citations
Application of magnaporthe oryzae gene MoRMD1 in regulating and controlling magnaporthe oryzae pathogenicity
CN110183521A
Drug target gene and encoding protein MoPh1 thereof
CN116144678A