Genetically engineered bacterium and application thereof in production of cis-3-hydroxy-L-proline

By constructing genetically engineered E. coli strains, silencing specific genes and overexpressing specific enzyme genes, the problem of lack of fermentation in the prior art of using E. coli to produce cis-3-hydroxy-L-proline is solved, and efficient and low-cost production results are achieved.

CN120192903APending Publication Date: 2025-06-24SHANGHAI SYNTHEALL PHARM CO LTD

Patent Information

Application Number
CN202311779624.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-21
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The prior art lacks a method for producing cis-3-hydroxy-L-proline using E. coli fermentation using glucose as a substrate.

Method used

By constructing genetically engineered strains, the proline dehydrogenase gene putA and the proline transport gene putP were silenced, and the γ-glutamyl kinase mutant gene proBD107N, the γ-glutamyl phosphate reductase gene proA and the cis-3-hydroxy-L-proline hydroxylase gene P3H were overexpressed, and fermented and produced using E. coli.

Benefits of technology

A high-yield cis-3-hydroxy-L-proline strain was successfully constructed, using glucose as a raw material, greatly saving production costs and having good industrial utilization value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004625099100000041
    Figure BDA0004625099100000041
  • Figure BDA0004625099100000051
    Figure BDA0004625099100000051
  • Figure BDA0004625099100000061
    Figure BDA0004625099100000061
Patent Text Reader

Abstract

The invention discloses a genetically engineered bacterium and an application of the genetically engineered bacterium in production of cis-3-hydroxy-L-proline. According to the genetically engineered bacterium, a proline dehydrogenase gene putA and a proline transporter gene putP in a starting bacterium are silenced, and meanwhile, a gamma-glutamyl kinase mutant gene proBD107N, a gamma-glutamyl phosphate reductase gene proA and a cis-3-hydroxy-L-proline hydroxylase gene P3H are subjected to overexpression. And by comparing a plurality of common escherichia coli, the cis-3-hydroxy-L-proline hydroxylase gene P3H and different gamma-glutamyl kinase mutant genes, the highest yield combination is preferably selected. The strain takes glucose as a raw material, so that the production cost is greatly saved, and the strain has a relatively good industrial utilization value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering, and particularly relates to a genetically engineered bacterium and its application in the production of cis-3-hydroxy-L-proline. Background Art

[0002] Hydroxyproline is a non-protein amino acid and has wide applications in the fields of medicine, chemical synthesis, etc. According to the position of hydroxy substitution, it can be divided into four stereoisomers: cis-4-hydroxy-L-proline, trans-4-hydroxy-L-proline, cis-3-hydroxy-L-proline, and trans-3-hydroxy-L-proline. Among them, cis-3-hydroxy-L-proline is an important component of collagen and can be used for the treatment of cancer and collagen diseases. It is also an important precursor for the synthesis of many drug molecules such as carbapenem antibiotics. In addition, it can act as an organometallic catalyst in asymmetric synthesis and can be used for the synthesis of organic polymer materials such as polyimide, having important value.

[0003] The existing methods for producing cis-3-hydroxy-L-proline can be divided into traditional chemical synthesis methods and biocatalytic methods. Traditional chemical synthesis for producing cis-3-hydroxy-L-proline has disadvantages such as expensive raw materials, cumbersome synthesis steps, complex separation and purification, and low yield, and cannot meet the industrial demand. The biocatalytic method uses L-proline as a raw material and utilizes microorganisms capable of expressing hydroxylase such as Streptomyces, Escherichia coli, etc., or uses hydroxylase preparations as catalysts to convert the substrate into cis-3-hydroxy-L-proline. The highest yield reported using the biocatalytic method is 23.9 g / L 1-5 . Currently, there is no report on using Escherichia coli fermentation to produce cis-3-hydroxy-L-proline with glucose as a substrate. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the lack of a method for using Escherichia coli fermentation to produce cis-3-hydroxy-L-proline with glucose as a substrate in the prior art, and to provide a genetically engineered bacterium and its application in the production of cis-3-hydroxy-L-proline.

[0005] The present invention solves the above technical problem through the following technical solutions:

[0006] In a first aspect of the present invention, there is provided a genetically engineered bacterium, wherein the genetically engineered bacterium silences the proline dehydrogenase gene putA and the proline transporter gene putP in the starting strain, and simultaneously overexpresses the γ-glutamyl kinase mutant gene proB D107N , the γ-glutamyl phosphate reductase gene proA, and the cis-3-hydroxy-L-proline hydroxylase gene P3H.

[0007] In some embodiments of the present invention, the isocitrate lyase gene aceA of the starting strain is further silenced in the genetically engineered bacterium.

[0008] In the present invention, the expression silencing is gene knockout.

[0009] In some embodiments of the present invention, the nucleotide sequence after P3H codon optimization is as shown in SEQ ID NO:1.

[0010] In some embodiments of the present invention, the starting strain is Escherichia coli; preferably Escherichia coli W3110(DE3).

[0011] The second aspect of the present invention provides a method for producing cis-3-hydroxy-L-proline, the method comprising: fermenting using the genetically engineered bacterium as described in the first aspect.

[0012] In some specific embodiments of the present invention, the fermentation includes shake flask fermentation or fermenter fermentation.

[0013] In some embodiments of the present invention, the method comprises the following steps: inoculating the genetically engineered bacterium into a fermentation medium and culturing overnight.

[0014] In some specific embodiments of the present invention, before inoculating into the fermentation medium, it further includes inoculating into a seed medium and culturing overnight.

[0015] In the present invention, the inoculation amount is 2% in both cases; and / or, the conditions for overnight culture are 37°C and 220 rpm.

[0016] In some embodiments of the present invention, the seed medium includes 1% tryptone, 0.5% yeast extract powder, and 1% sodium chloride.

[0017] In some embodiments of the present invention, when using shake flask fermentation, the fermentation medium includes 2% tryptone, 2.4% yeast extract powder, 1% glucose, and 100 mL / L phosphate buffer.

[0018] In some embodiments of the present invention, when using fermenter fermentation, the method comprises the following steps: after the glucose in the fermentation medium is exhausted, start feeding according to the sugar consumption rate of the cells and adjust the feeding rate so that the residual sugar content in the fermentation broth is controlled at 0.5% or less, stop feeding 1 - 2 hours before the end of fermentation, and stop fermentation until the residual sugar is 0%.

[0019] In some specific embodiments of the present invention, the fermentation conditions are as follows: inoculum amount 5-7.5%, tank temperature 33-35°C, ventilation ratio 1:1-2.5 vvm, tank pressure 0.0-0.05 Mpa, rotation speed 500-1500 rpm, pH 6.4-6.6, and culture time 40-72 h.

[0020] In some embodiments of the present invention, the fermentation medium used for culturing in a fermenter comprises 1-2% glucose, 0.1-0.2% ammonium sulfate, 1.25-1.5% dipotassium hydrogen phosphate trihydrate, 0.625-0.75% potassium dihydrogen phosphate, 0.1-0.2% magnesium sulfate heptahydrate, 0.02-0.025% ferrous sulfate heptahydrate, 0.6-0.8% yeast extract powder, 0.0023% anhydrous calcium chloride, 1-2 mL of trace elements, and 0.02-0.03 (v / v) antifoaming agent.

[0021] In some specific embodiments of the present invention, the fermentation medium comprises 2% glucose, 0.176% ammonium sulfate, 1.25% dipotassium hydrogen phosphate trihydrate, 0.625% potassium dihydrogen phosphate, 0.102% magnesium sulfate heptahydrate, 0.02% ferrous sulfate heptahydrate, 0.667% yeast extract powder, 0.0023% anhydrous calcium chloride, 0.0017% copper sulfate pentahydrate, 0.00083% manganese sulfate monohydrate, 0.00083% ammonium ferrous sulfate, and 0.001% zinc sulfate.

[0022] In some embodiments of the present invention, the medium used for feeding comprises 70-80% glucose, 1.25-1.5% yeast extract powder, 1-1.2% ammonium chloride, and 0.1-0.2% magnesium sulfate heptahydrate.

[0023] In some specific embodiments of the present invention, the medium comprises 80% glucose, 1.25% yeast extract powder, 1.2% ammonium chloride, and 0.1% magnesium sulfate heptahydrate.

[0024] The third aspect of the present invention provides the use of the genetically engineered bacterium as described in the first aspect in the production of cis-3-hydroxy-L-proline.

[0025] On the basis of conforming to the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0026] The reagents and raw materials used in the present invention are all commercially available.

[0027] The positive and progressive effects of the present invention are as follows:

[0028] The method of the present invention has successfully constructed a high-yield strain of cis-3-hydroxy-L-proline, and this strain uses glucose as a raw material, greatly saving the production cost and having good industrial utilization value. Detailed implementation mode

[0029] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0030] Example 1

[0031] 1) Construction of Escherichia coli gene knockout mutants

[0032] Knockout of genes putA, putP, and aceA in Escherichia coli W3110(DE3), MG1655, and BL21(DE3) was completed according to the gene knockout procedure of the published CRISPR / Cas9 system. 6 The target genes were amplified by PCR using the primers in Table 1 with the original pEcgRNA (Addgene, catalog NO: 166581) as the template. The gene knockout template UHA-DHA was amplified by overlap extension PCR using the primers in Table 1 (the bold part is the guiding sequence) with the genomic DNA of the corresponding Escherichia coli as the template. The sequences of the three genes putA, putP, and aceA in W3110(DE3) and MG1655 are exactly the same, and the putA, putP, and aceA genes of BL21(DE3) are only different in a few bases from W3110(DE3) and MG1655; the guiding sequence is a conserved sequence of the three Escherichia coli strains. Similarly, the primers for amplifying UHA and DHA are conserved sequences of the three Escherichia coli strains. Each obtained gene knockout mutant (Table 2) was verified by PCR using the corresponding verification primers in Table 1.

[0033] Table 1. Primer sequences

[0034]

[0035]

[0036]

[0037] Table 2. Escherichia coli mutants

[0038]

[0039]

[0040] 2) Codon optimization and synthesis of gene P3H

[0041] According to the gene sequences of L-proline-cis-3-hydroxylase (GeneBank IDs are O09345.1 and P96010.1 respectively) publicly available in the NCBI database, codon optimization of Escherichia coli was carried out to obtain genes P3H_1 and P3H_2 (the DNA sequences are shown below). The four genes were separately cloned into plasmid pET-30a(+), obtaining pET-30a(+)-P3H_1 and pET-30a(+)-P3H_2. Codon optimization and gene synthesis were completed by Genewiz.

[0042] P3H_1 sequence

[0043] ATGCGCAGCCATATTCTGGGCAAAATTGAACTGGATCAGACCCGCCTGGCGCCGGATCTGGCGTATCTGGCGGCGGTGCCGACCGTGGAAGAGGAATATGATGAATTTAGCAACGGCTTTTGGAAACATGTGCCGCTGTGGAACGCGAGCGGCGATAGCGAAGATCGCCTGTATTGCGATCTGAAAGATGCGGCCGCGCAGCCGACCGCGCATGTGGAACATGTGCCGTATCTGAAAGAAATTGTGACCATTGTGTTTGATGGCACCTATCTGCAGATGGCGCGCAGCCGCAACCTGAAAAACGCGATTGTGATTCCGCATCGCGATTTTGTGGAACTGGATCGCGAAGTGGATCGCTATTTTCGCACCTTTATGGTGCTGGAAGATAGCCCGCTGGCGTTTCATAGCAACGAAGATACCGTGATTCACATGCGCCCGGGCGAAATTTGGTTTCTGGATGCGGCGACCGTGCATAGCGCGGTGAACTTTAGCGAAATTAGCCGTCAGAGCCTGTGCGTGGATTTTGCGTTTGATGGCCCGTTTGATGAAAAAGAAATTTTTGCGGATGCGACCCTGTATGCGCCGGGCAGCACCCCGGATCTGCCGGAACGCCGCCCGTTTACCGCGGAACATCGCCGTCGCATTCTGAGCCTGGGCCAAGTGATTGAACGCGAAAACTTTCGCGATATTCTGTTTCTGCTGAGCAAAGTGCATTATAAATATGATGTGCATCCGAGCGAAACCTATGATTGGCTGATTGAAATTAGCAAACAAGCGGGCGATGAAAAAATGGTGGTGAAAGCGGAACAGATTCGCGATTTTGCGGTGGAAGCGCGCGCGCTGAGCGAACGCTTTAGCCTGACGAGCTGGTAA(SEQ ID NO:1)

[0044] P3H_2 sequence

[0045] ATGCGTAGCCACATTCTGGGCCGTATCGAACTGGATCAGGAACGTCTGGGTCGTGACCTGGAATATCTGGCGACTGTTCCGACCGTTGAAGAAGAGTATGACGAATTCAGCAACGGCTTCTGGAAAAACATCCCGCTGTATAACGCATCTGGCGGCTCTGAGGATCGTCTGTACCGTGACCTGGAAGGTTCTCCAGCGCAGCCTACTAAGCATGCGGAACAGGTACCGTATCTGAACGAAATCATTACTACCGTCTACAACGGTGAACGCCTGCAGATGGCTCGTACCCGTAACCTGAAAAACGCCGTCGTTATCCCGCATCGTGATTTCGTTGAACTGGACCGTGAACTGGACCAGTACTTTCGTACGCACCTGATGCTGGAGGACTCTCCGCTGGCTTTTCATTCTGATGATGATACGGTCATCCACATGCGTGCAGGCGAAATTTGGTTCCTGGATGCTGCGGCTGTGCACAGCGCAGTTAACTTTGCTGAATTCTCCCGTCAGTCTCTGTGCGTTGATCTGGCCTTTGACGGCGCCTTTGATGAGAAGGAGGCGTTTGCGGACGCGACTGTATATGCTCCAAACCTGAGCCCGGATGTGCGTGAGCGTAAACCGTTTACGAAAGAACGTGAAGCTGGTATCCTGGCGCTGTCTGGCGTAATCGGTCGTGAAAACTTTCGTGACATCCTGTTCCTGCTGTCTAAGGTTCACTACACCTACGACGTCCACCCGGGTGAAACTTTTGAGTGGCTGGTGTCCGTGTCTAAAGGTGCAGGCGACGACAAAATGGTGGAAAAAGCAGAACGCATTCGTGACTTCGCTATCGGTGCGCGTGCTCTGGGTGAACGTTTCTCCCTGACCACCTGG(SEQ ID NO:40)

[0046] 3) Construction of plasmid ptrp-P3H-proB M -proA

[0047] Using plasmid pET-30a(+)-P3H_1 and pET-30a(+)-P3H_2 as templates respectively, DNA fragments P3H_1 and P3H_2 were obtained by PCR amplification with the corresponding primers P3H-F and P3H-R in Table 1. Using the genomic DNA of Escherichia coli as a template, the fragment proBA was amplified with primers proBA-F and proBA-R. Using the in-house plasmid pTrc99A-trp of the company as a template (trp promoter sequence: ggaattcctcgaggcctcgaggccgacatcataacggttctggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcaagttcacgtaaaaaggg (SEQ ID NO:41)), the plasmid backbone ptrp containing the trp promoter was amplified with primers ptrp-F and ptrp-R. The fragments P3H, proBA and ptrp were then assembled by NEB HiFi Assembly Kit to obtain the plasmid ptrp-P3H-proB-proA. Using this plasmid as a template, plasmids ptrp-P3H-proB M -proA (Table 3) were obtained by PCR with primers D107N-F / D107N-R and D107A-F / D107A-R respectively. After the plasmid was verified to be correct by sequencing, it was transformed into Escherichia coli wild type or mutant strains, and the cis-3-hydroxy-L-proline producing strains were obtained.

[0048] Table 3. Plasmids

[0049] Plasmid Characteristics ptrp-P3H_1-proB-proA P3H_1, proB ptrp-P3H_2-proB-proA P3H_2, proB <![CDATA[ptrp-P3H_1-proB D107N -proA]]> <![CDATA[P3H_1,proB D107N > <![CDATA[ptrp-P3H_2-proB D107N -proA]]> <![CDATA[P3H_2,proB D107N > <![CDATA[ptrp-P3H_1-proB D107A -proA]]> <![CDATA[P3H_1,proB D107A > <![CDATA[ptrp-P3H_2-proB D107A -proA]]> <![CDATA[P3H_2,proB D107A >

[0050] 4) Shake flask fermentation

[0051] The Escherichia coli cis-3-hydroxy-L-proline producing strain was inoculated into 10 mL of seed medium (tryptone: 1%, yeast extract powder: 0.5%, sodium chloride: 1%, sodium ampicillin: 100 mg / L), and cultured overnight at 37 °C and 220 rpm. Then it was inoculated at 2% into 20 mL of fermentation medium (tryptone: 2%, yeast extract powder: 2.4%, glucose: 1%, phosphate buffer 100 mL / L, sodium ampicillin: 100 mg / L), and cultured overnight at 33 °C and 220 rpm. After centrifugation of the fermentation broth, the supernatant was taken, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD.

[0052] 5) Fermenter fermentation

[0053] The formula of the seed culture medium is as follows: tryptone: 1%, yeast extract powder: 0.5%, sodium chloride: 1%, sodium ampicillin: 50 mg / L (added before inoculation), natural pH.

[0054] The formula of the fermenter culture medium is as follows: glucose: 1 - 2%, ammonium sulfate: 0.1 - 0.2%, dipotassium hydrogen phosphate trihydrate: 1.25 - 1.5%, potassium dihydrogen phosphate: 0.625 - 0.75%, magnesium sulfate heptahydrate: 0.1 - 0.2%, ferrous sulfate heptahydrate: 0.02 - 0.025%, yeast extract powder: 0.6 - 0.8%, anhydrous calcium chloride: 0.0023%, trace elements: 1 - 2 mL, antifoaming agent: 0.02 - 0.03 (v / v), sodium ampicillin: 50 mg / L (added when cooled to room temperature).

[0055] Specifically, glucose 2%, ammonium sulfate 0.176%, dipotassium hydrogen phosphate trihydrate 1.25%, potassium dihydrogen phosphate 0.625%, magnesium sulfate heptahydrate 0.102%, ferrous sulfate heptahydrate 0.02%, yeast extract powder 0.667%, anhydrous calcium chloride 0.0023%, copper sulfate pentahydrate 0.0017%, manganese sulfate monohydrate 0.00083%, ammonium ferrous sulfate 0.00083%, zinc sulfate 0.001%.

[0056] The formula of the feeding culture medium: glucose: 70 - 80%, yeast extract powder: 1.25 - 1.5%, ammonium chloride: 1 - 1.2%, magnesium sulfate heptahydrate: 0.1 - 0.2%, sodium ampicillin: 50 mg / L (added when cooled to room temperature).

[0057] Specifically, glucose 80%, yeast extract powder 1.25%, ammonium chloride 1.2%, magnesium sulfate heptahydrate 0.1%.

[0058] Fermentation control conditions: inoculation amount: 5 - 7.5%, tank temperature: 33 - 35 °C, ventilation ratio: 1:(1 - 2.5) vvm, tank pressure: 0.0 - 0.05 Mpa, rotation speed: 500 - 1500 rpm, pH: 6.4 - 6.6, culture time: 40 - 72 hours.

[0059] Feeding control parameters: When the glucose in the basal medium is exhausted, feeding starts, and the feeding rate is continuously adjusted according to the sugar consumption rate of the bacteria, so that the residual sugar content in the fermentation broth is controlled at 0.5% and below. Feeding stops 1 - 2 hours before the end of fermentation, and fermentation stops until the residual sugar is 0%.

[0060] After centrifuging the fermentation broth, the supernatant is taken, and the content of cis - 3 - hydroxy - L - proline is quantitatively detected by HPLC - CAD.

[0061] 6) HPLC - CAD detection of cis - 3 - hydroxy - L - proline

[0062] Waters ArcTM HPLC chromatograph; chromatographic column: Waters Xbridge C18, 150×4.6 mm, 3.5 μm column; detection wavelength: 210 nm; injection volume: 5 μL; column temperature: 35 °C; mobile phase A: water (0.05% TFA); mobile phase B: acetonitrile (0.05% TFA); mobile phase gradient: 0 - 8 min 60 - 5% A, 8 - 9 min 5% A, 9 - 9.1 min 5 - 60% A, 9.1 - 13 min 60% A.

[0063] Example 2

[0064] W3110(DE3)::△2 / ptrp - P3H_1 - proB D107N - proA

[0065] Plasmid ptrp - P3H_1 - proB D107N - proA was transformed into Escherichia coli mutant strain W3110::△2 to obtain cis - 3 - hydroxy - L - proline - producing strain W3110::△2 / ptrp - P3H_1 - proB D107N - proA. After the above shake - flask fermentation, the supernatant was taken after centrifugation of the fermentation broth. The content of cis - 3 - hydroxy - L - proline was quantitatively detected by HPLC - CAD to be 1.69 g / L. After the above fermentation in the fermenter for 41 h, the supernatant was taken after centrifugation of the fermentation broth. The content of cis - 3 - hydroxy - L - proline was quantitatively detected by HPLC - CAD to be 106 g / L.

[0066] W3110(DE3)::△3 / ptrp - P3H_1 - proB D107N - proA

[0067] Plasmid ptrp - P3H_1 - proB D107N - proA was transformed into Escherichia coli mutant strain W3110(DE3)::△3 to obtain cis - 3 - hydroxy - L - proline - producing strain W3110(DE3)::△3 / ptrp - P3H_1 - proB D107N - proA. After the above shake - flask fermentation, the supernatant was taken after centrifugation of the fermentation broth. The content of cis - 3 - hydroxy - L - proline was quantitatively detected by HPLC - CAD to be 1.9 g / L. After the above fermentation in the fermenter using fermentation medium formula 1 for 45 h, the supernatant was taken after centrifugation of the fermentation broth. The content of cis - 3 - hydroxy - L - proline was quantitatively detected by HPLC - CAD to be 136 g / L.

[0068] Comparative example

[0069] Wild-type MG1655 / ptrp-P3H_2-proB D107A -proA

[0070] Plasmid ptrp-P3H_2-proB D107A -proA was transformed into wild-type Escherichia coli MG1655 to obtain the cis-3-hydroxy-L-proline-producing strain MG1655 / ptrp-P3H_2-proB D107A -proA. After the above shake-flask fermentation, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 0.90 g / L. After the above fermenter fermentation for 41 h, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 29 g / L.

[0071] Wild-type BL21(DE3) / ptrp-P3H_2-proB D107A -proA

[0072] Plasmid ptrp-P3H_2-proB D107A -proA was transformed into wild-type Escherichia coli BL21(DE3) to obtain the cis-3-hydroxy-L-proline-producing strain BL21(DE3) / ptrp-P3H_2-proB D107A -proA. After the above shake-flask fermentation, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 0.95 g / L. After the above fermenter fermentation for 46 h, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 30 g / L.

[0073] Wild-type W3110(DE3) / ptrp-P3H_2-proB D107A -proA

[0074] Plasmid ptrp-P3H_3-proB D107A -proA was transformed into wild-type Escherichia coli W3110(DE3) to obtain the cis-3-hydroxy-L-proline-producing strain W3110(DE3) / ptrp-P3H_2-proB D107A -proA. After the above shake-flask fermentation, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 1.11 g / L. After the above fermenter fermentation for 46 h, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 40 g / L.

[0075] Wild-type W3110(DE3) / ptrp-P3H_1-proB D107A -proA

[0076] Plasmid ptrp-P3H_1-proB D107A -proA was transformed into wild-type Escherichia coli W3110(DE3) to obtain the cis-3-hydroxy-L-proline-producing strain W3110(DE3) / ptrp-P3H_1-proB D107A -proA. After the above shake-flask fermentation, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 1.26 g / L. After the above fermentor fermentation for 46 h, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 44 g / L.

[0077] Wild-type W3110(DE3) / ptrp-P3H_1-proB D107N -proA

[0078] Plasmid ptrp-P3H_1-proB D107N -proA was transformed into wild-type Escherichia coli W3110(DE3) to obtain the cis-3-hydroxy-L-proline-producing strain W3110(DE3) / ptrp-P3H_1-proB D107N -proA. After the above shake-flask fermentation, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 1.33 g / L. After the above fermentor fermentation for 46 h, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 50 g / L.

[0079] W3110(DE3)::△1 / ptrp-P3H_1-proB D107N -proA

[0080] Plasmid ptrp-P3H_1-proB D107N -proA was transformed into the Escherichia coli mutant W3110::△1 to obtain the cis-3-hydroxy-L-proline-producing strain W3110::△1 / ptrp-P3H_1-proB D107N-proA. After the strain was fermented in the above shake flask, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 1.48 g / L. After the strain was fermented in the above fermenter for 41 h, the supernatant was taken after centrifugation of the fermentation broth, and the content of cis-3-hydroxy-L-proline was quantitatively detected by HPLC-CAD to be 87 g / L.

[0081] References

[0082] 1. Robert M. Johnston, Linda N. Chu, Mark Liu, Steven L. Goldberg, Animesh Goswami, Ramesh N. Patel, Hydroxylation of l-proline to cis-3-hydroxy-l-proline by recombinant Escherichia coli expressing a synthetic l-proline-3-hydroxylase gene, Enzyme and Microbial Technology, 2009, 45, 6–7, 484-490, https: / / doi.org / 10.1016 / j.enzmictec.2009.08.006.

[0083] 2. Zhang Jinxiu, Wang Lian, Chen Jiaojiao, Zhao Liwei. A gene for modifying cis-3-hydroxy-l-proline hydroxylase and its application. CN105177026A.

[0084] 3. Zhang Zhenyu, Yao Xuena, Ding Cancan, Shen Song. A method for fermenting and producing cis-3-L-hydroxyproline by recombinant Escherichia coli. CN104726386A.

[0085] 4. Zhang Zhenyu, Huang Jianhua, Wang Xiaojiao, Yao Dongbang, Wei Zhaohui. A method for effectively improving the conversion rate of proline in a system for producing cis-3-hydroxy-L-proline by biosynthesis method. CN105543265A

[0086] 5. Huang Jianhua, Wang Xiaojiao, Wei Zhaohui, Zhang Zhenyu, Sun Fubao. Directed modification of cis-3-hydroxyproline hydroxylase in Escherichia coli. Food and Fermentation Industries 2017, Vol. 43. Issue(1): 7.

[0087] 6. Li Q, Sun B, Chen J, Zhang Y, Jiang Y, Yang S. A modified pCas / pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim Biophys Sin (Shanghai). 2021 Apr 15;53(5):620-627. doi: 10.1093 / abbs / gmab036.

[0088] It should be noted that, for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention.

Claims

1. A genetically engineered bacterium, characterized in that, The genetically engineered bacterium silenced the proline dehydrogenase gene putA and the proline transporter gene putP in the starting strain, and simultaneously overexpressed the mutant gene proB of γ-glutamyl kinase, D107N , the γ-glutamyl phosphate reductase gene proA and the cis-3-hydroxy-L-proline hydroxylase gene P3H.

2. The genetically engineered bacterium according to claim 1, characterized in that, The genetically engineered bacterium further silences the isocitrate lyase gene aceA of the starting bacterium; preferably, the silencing is gene knockout.

3. The genetically engineered bacterium according to claim 1 or 2, characterized in that, The nucleotide sequence after P3H codon optimization is shown in SEQ ID NO:

1.

4. The genetically engineered bacterium according to claim 1, characterized in that, The starting strain is Escherichia coli; preferably Escherichia coli W3110(DE3).

5. A method for producing cis-3-hydroxy-L-proline, characterized in that, The method includes: fermenting using the genetically engineered bacterium as described in claim 1 or 2; preferably, the fermentation includes shake flask fermentation or fermenter fermentation.

6. The method according to claim 5, wherein The method includes the following steps: inoculating the genetically engineered bacterium into a fermentation medium and culturing overnight; Preferably, before inoculating into the fermentation medium, it also includes inoculating into a seed medium and culturing overnight; More preferably, the inoculation amount is 2% in both cases; and / or, the conditions for overnight culture are 37°C and 220 rpm.

7. The method according to claim 6, wherein The seed medium includes 1% tryptone, 0.5% yeast extract powder, and 1% sodium chloride.

8. The method according to claim 6 or 7, characterized in that, When using shake flask fermentation, the fermentation medium includes 2% tryptone, 2.4% yeast extract powder, 1% glucose, and 100 mL / L phosphate buffer.

9. The method according to claim 6 or 7, characterized in that, When using fermenter fermentation, the method includes the following steps: after the glucose in the fermentation medium is exhausted, start feeding according to the sugar consumption rate of the cells and adjust the feeding rate so that the residual sugar content in the fermentation broth is controlled at 0.5% or less, stop feeding 1-2 hours before the end of fermentation, and stop fermentation until the residual sugar is 0%; Preferably, the conditions for fermentation are an inoculation amount of 5-7.5%, a tank temperature of 33-35°C, an aeration ratio of 1:1-2.5 vvm, a tank pressure of 0.0-0.05 Mpa, a rotation speed of 500-1500 rpm, a pH of 6.4-6.6, and a culture time of 40-72 h.

10. The method according to claim 9, wherein, The fermentation medium includes 1-2% glucose, 0.1-0.2% ammonium sulfate, 1.25-1.5% dipotassium hydrogen phosphate trihydrate, 0.625-0.75% potassium dihydrogen phosphate, 0.1-0.2% magnesium sulfate heptahydrate, 0.02-0.025% ferrous sulfate heptahydrate, 0.6-0.8% yeast extract powder, 0.0023% anhydrous calcium chloride, 1-2 mL of trace elements, and 0.02-0.03 (v / v) antifoaming agent; Preferably, the fermentation medium includes 2% glucose, 0.176% ammonium sulfate, 1.25% dipotassium hydrogen phosphate trihydrate, 0.625% potassium dihydrogen phosphate, 0.102% magnesium sulfate heptahydrate, 0.02% ferrous sulfate heptahydrate, 0.667% yeast extract powder, 0.0017% copper sulfate pentahydrate, 0.00083% manganese sulfate monohydrate, 0.00083% ammonium ferrous sulfate, and 0.001% zinc sulfate.

11. The method according to claim 9, wherein The medium used for feeding includes 70-80% glucose, 1.25-1.5% yeast extract powder, 1-1.2% ammonium chloride, and 0.1-0.2% magnesium sulfate heptahydrate; Preferably, the medium includes 80% glucose, 1.25% yeast extract powder, 1.2% ammonium chloride, and 0.1% magnesium sulfate heptahydrate.

12. Use of the genetically engineered bacterium according to any one of claims 1 to 4 in the production of cis-3-hydroxy-L-proline.

Citation Information

Patent Citations

  • Method for producing cis-3-L-hydroxyproline by fermenting recombinant escherichia coli

    CN104726386A

  • Cis-3-hydroxy-L-proline hydroxylase modified gene and application thereof

    CN105177026A

  • Method for effectively improving proline conversion rate in system for producing Cis-3-hydroxy-L-proline according to biosynthesis method

    CN105543265A

Cited By

  • Proline dehydrogenase, gene, mutant and application of proline dehydrogenase

    CN120330151A

  • Proline dehydrogenase, genes and mutants and uses thereof

    CN120330151B