Recombinant Escherichia coli for producing xylitol by efficiently utilizing L-arabinose without adding glycerol and application of recombinant Escherichia coli

Abstract

The invention discloses recombinant Escherichia coli for producing xylitol by efficiently utilizing L-arabinose without adding glycerol and application, and belongs to the technical field of genetic engineering. Escherichia coli with an araBAD operon and an L-xylulokinase gene lyxK knocked out is used as a starting strain, a glucose specific transporter gene ptsG and a D-xylulokinase gene xylB in a genome are knocked out, and a global regulatory factor CRP is mutated; on the basis of an araA, dpe and lxr three-enzyme expression universal method reported at present, the gene arrangement sequence and copy number in three-enzyme tandem expression are optimized, a promoter and an RBS sequence are optimized and screened, and three-enzyme genes are integrated to a specific position of an escherichia coli chromosome in an optimized multi-copy form. According to the method, the inhibition effect of glucose on L-arabinose is achieved, the in-vivo multienzyme catalysis efficiency of existing synthesis of xylitol from arabinose is remarkably improved, and the yield of precursor arabitol and the yield of the product xylitol are greatly improved.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a recombinant Escherichia coli capable of efficiently utilizing L-arabinose to produce xylitol without adding glycerol and its application. Background Art

[0002] L-arabinose is a natural monosaccharide, named after being first extracted from the colloid secreted by the Arabian tree. L-arabinose is the main component of hemicellulose, accounting for about 10%-20% of the hemicellulose component, and is widely present in the waste of agricultural and sideline products such as corncobs, sugarcane bagasse, and rice husks. The sweetness of L-arabinose is equivalent to 50% of sucrose, and it will not cause changes in the blood glucose level of the human body. It is a low-calorie sweetener. However, due to factors such as its taste, its current market scale is small. Its annual output in 2023 was 15,000-20,000 tons, only 1 / 25 of the xylitol market. The market for arabinose directly as a sweetener still needs to be further cultivated and promoted. Xylitol, as a common sweetener, has the advantages of good heat resistance and non-cariogenicity. It is widely used in the production of food, beverages, candies, etc., and does not increase the blood glucose level. It is currently the mainstream sugar substitute sweetener. The market scale reached one billion US dollars in 2023 and is expected to grow at a rate of more than 5% per year, and the market demand will further expand. Xylitol is currently mainly prepared by hydrolyzing, purifying, and crystallizing hemicellulose to obtain high-purity xylose, and then further preparing xylitol by hydrogenation reduction using Raney nickel as a catalyst. During the production process of xylose, the concentration of arabinose in its crystallization mother liquor can reach 250 g / L. Due to the market scale limitation of the arabinose, if these abundant arabinose resources can be efficiently converted into xylitol, which is popular in the market, it will be able to more effectively improve the utilization value of hemicellulose resources.

[0003] Regarding the work of using arabinose to synthesize xylitol with Escherichia coli as the host, it was first reported by Japanese scholars in 2009. An ATX pathway capable of converting L-arabinose into xylitol was constructed, and this pathway contains three genes: araA, dpe, and lxr. araA encodes L-arabinose isomerase, which can convert L-arabinose into L-ribulose; dpe encodes D-psicose-3-epimerase, which can convert L-ribulose into L-xylulose; lxr encodes L-xylulose reductase, which can use NADH as a coenzyme to reduce L-xylulose to xylitol. This pathway was introduced into Escherichia coli ZUC99 in which araB, araD, and lyxK genes were knocked out. This strain used 11.8 g / L glycerol as an auxiliary substrate and produced 9.7 g / L xylitol from 10.5 g / L arabinose within 36 hours. (Sakakibara Y, Saha B C, Taylor P. Microbial production of xylitol from L-arabinose by metabolically engineered Escherichia coli[J]. Journal of Bioscience and Bioengineering, 2009, 107(5):506-511.)

[0004] Kiran et al. heterologously expressed the xylose reductase gene and genes related to the ATX pathway in Corynebacterium glutamicum, and the constructed strain Cg-ax3 obtained a xylitol yield of 6.7 g / L in batch fermentation. (Dhar K S, Wendisch V F, Nampoothiri K M. Engineering of Corynebacterium glutamicum for xylitol production from lignocellulosic pentose sugars[J]. Journal of Biotechnology, 2016, 230:63-71.)

[0005] Yuan used Escherichia coli W3110 in which araB, araD, and lyxK genes were knocked out as the starting strain, constructed a multi-enzyme expression module of the ATX pathway, and through adding glycerol and optimizing the culture medium, the xylitol yield could reach 9.46 g / L. (Yuan Dongxu. Global regulator modification combined with arabinose metabolic pathway reconstruction to enhance xylitol biosynthesis[D]. Zhejiang University, 2022.)

[0006] Following the work of Sakakibara et al., Li et al. also used Escherichia coli with the araB, araD, and lyxK genes knocked out as the starting strain to construct a multi-enzyme expression module for the ATX pathway. On the basis of this work, they studied the effects of enzymes from different sources and strengthened the glycerol utilization pathway, obtaining a strain capable of converting L-arabinose into xylitol. (Zhejiang Rongrui Technology Co., Ltd. Genetically engineered bacterium for producing xylitol using arabinose and its application: CN202411103463.0[P].2024.)

[0007] The common feature of the above work is that strains with genes related to L-arabinose metabolism and the lyxK gene knocked out are used as the starting strains, three enzymes of the ATX pathway are heterologously expressed, and glycerol needs to be added during fermentation to provide coenzyme NADH. Moreover, the concentration of arabinose used as the substrate in the current literature reports is only 10 g / L, far from meeting the requirements of industrial application. At the same time, due to the decline in biodiesel production in recent years, the supply of glycerol as a by-product has also decreased, and the price of glycerol is constantly rising, currently generally ranging from 5500 to 7000 yuan / ton, much higher than the price of glucose.

[0008] In hemicellulose resources, glucose usually coexists with arabinose, and the economy of separating arabinose alone is not high. To enable the engineered bacterium to utilize both glucose and arabinose, it is necessary to relieve the catabolite repression of arabinose by glucose. Summary of the Invention

[0009] The object of the present invention is to overcome the deficiencies of the prior art and provide a recombinant Escherichia coli capable of efficiently utilizing L-arabinose to produce xylitol without adding glycerol and its application. To achieve the above object, the present invention adopts the following technical solutions:

[0010] The present invention provides a recombinant Escherichia coli capable of efficiently utilizing L-arabinose to produce xylitol without adding glycerol. The recombinant Escherichia coli uses Escherichia coli (W3110-ΔaraBAD-ΔlyxK) with the araBAD operon and the L-xylulokinase gene lyxK knocked out as the starting strain, knocks out the glucose-specific transporter gene ptsG and the D-xylulokinase gene xylB in its genome; mutates the amino acids of the global regulatory factor CRP protein; and overexpresses the arabinose regulatory protein AraC;

[0011] The recombinant Escherichia coli also contains or integrates a catalytic module, and the catalytic module contains the sequences of the L-arabinose isomerase gene araA, the D-psicose-3-epimerase gene dpe, and the L-xylulose reductase gene lxr; the NCBI accession number of the L-arabinose isomerase gene is M15263, the NCBI accession number of the D-psicose-3-epimerase gene is AE008210, and the NCBI accession number of the L-xylulose reductase gene is AJ583159.

[0012] Among them, the catalytic module can be introduced into the host Escherichia coli in the form of a recombinant expression plasmid, or directly integrated into the genome of the host Escherichia coli. That is, the host Escherichia coli also contains a recombinant expression plasmid for expressing the L-arabinose isomerase gene araA, the D-psicose-3-epimerase gene dpe, and the L-xylulose reductase gene lxr; or, the gene sequences encoding L-arabinose isomerase, D-psicose-3-epimerase, and L-xylulose reductase are also integrated into its genome.

[0013] According to an alternative embodiment of the present invention, in the catalytic module, the L-arabinose isomerase gene araA, the D-psicose-3-epimerase gene dpe, and the L-xylulose reductase gene lxr are tandemly expressed in a polycistronic form under the arabinose-inducible promoter P BAD afterwards.

[0014] According to another alternative embodiment of the present invention, in the catalytic module, the L-arabinose isomerase gene araA, the D-psicose-3-epimerase gene dpe, and the L-xylulose reductase gene lxr are tandemly expressed in a polycistronic form under the inducible promoter P Trc or the constitutive promoter P J23119 afterwards.

[0015] According to the preferred embodiment of the present invention, the arrangement order of the L-arabinose isomerase gene araA, the D-psicose-3-epimerase gene dpe, and the L-xylulose reductase gene lxr after the promoter is one of: araA-dpe-lxr, dpe-araA-lxr, lxr-dpe-araA.

[0016] According to the preferred embodiment of the present invention, in the catalytic module, the RBS sequence carried before the L-arabinose isomerase gene araA is BBa_B0030, the RBS sequence carried before the D-psicose-3-epimerase gene dpe is BBa_B0034, and the RBS sequence carried before the L-xylulose reductase gene lxr is BBa_B0029.

[0017] According to a preferred embodiment of the present invention, the mutation of the amino acids of the global regulatory factor CRP protein specifically is: performing single-point or multi-point mutations on the amino acids at positions 112, 127, 128, and 144 of the global regulatory factor CRP protein, wherein, the isoleucine (I) at position 112 is mutated to leucine (L); the threonine (T) at position 127 is mutated to isoleucine (I) or leucine (L); the serine (S) at position 128 is mutated to proline (P) or glycine (G); the alanine (A) at position 144 is mutated to threonine (T).

[0018] According to an alternative embodiment of the present invention, the catalytic module is integrated at the IS5 locus of the Escherichia coli W3110 genome in 4 - 12 copies.

[0019] According to an alternative embodiment of the present invention, the catalytic module is integrated at the IS1, IS3, and IS186 loci of the Escherichia coli W3110 genome in 3 - 7 copies.

[0020] The present invention also provides an application of the recombinant Escherichia coli as described above in the fermentation production of xylitol.

[0021] The present invention also provides a method for efficiently producing xylitol by utilizing L - arabinose without adding glycerol, which is to inoculate the recombinant Escherichia coli into a fermentation broth containing L - arabinose and glucose, and xylitol is obtained after fermentation.

[0022] In the fermentation process and the fermentation broth of the present invention, glycerol is not added. Preferably, the concentration of L - arabinose in the fermentation broth is 10 - 30 g / L, and the concentration of glucose is 7.5 - 15 g / L, preferably 10 - 15 g / L. Preferably, the composition of the fermentation medium is: 24 g / L yeast powder, 12 g / L peptone, 12.54 g / L dipotassium hydrogen phosphate, 2.313 g / L potassium dihydrogen phosphate. Preferably, the fermentation conditions are: inoculating the recombinant Escherichia coli into the fermentation medium, culturing at 30 °C for 0 - 4 h, then adding 10 - 30 g / L L - arabinose and 7.5 - 15 g / L glucose, and fermenting at 30 °C for 24 h.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0024] (1) Based on knocking out the glucose-specific transporter gene ptsG and mutating the CRP protein, the present invention uses the strategy of overexpressing AraC to relieve the catabolic repression of glucose on arabinose. It solves the inhibitory effect of glucose contained in hemicellulose hydrolysate and xylose mother liquor on L-arabinose, enabling the strain to co-utilize glucose and L-arabinose to produce xylitol without the need to add costly glycerol. The D-xylulokinase gene xylB is knocked out to block the flow of the intermediate L-xylulose to other metabolic branches, further increasing the xylitol yield.

[0025] (2) The present invention compares the effects of enzyme arrangement sequences of the polycistronic module for converting L-arabinose to xylitol, replaces promoters with different strengths, replaces different RBS sequences, and integrates at different genomic sites and with different copy numbers, enabling L-arabinose to be almost completely converted into xylitol. Brief Description of the Drawings

[0026] Figure 1 It shows the conversion pathway of L-arabinose in Escherichia coli, where AraEFGH: arabinose transport system; PPP: pentose phosphate pathway; araB: ribulokinase; araD: L-ribulose-5-phosphate 4-epimerase.

[0027] Figure 2 It shows the shake flask fermentation results of the strain after knocking out the ptsG gene and mutating the CRP protein.

[0028] Figure 3 It shows the shake flask fermentation results of the strain after knocking out the ptsG gene and mutating the CRP protein with increased glucose concentration.

[0029] Figure 4 It shows the shake flask fermentation results of the strain after overexpressing AraC with increased glucose concentration.

[0030] Figure 5 It shows the shake flask fermentation results of the strain after knocking out the xylB gene.

[0031] Figure 6 It shows the plasmid maps of different gene arrangement sequences.

[0032] Figure 7 It shows the shake flask fermentation results of different gene arrangement sequences after the promoter.

[0033] Figure 8 It shows the shake flask fermentation results of replacing different promoters.

[0034] Figure 9 It shows the shake flask fermentation results of replacing different RBS sequences.

[0035] Figure 10Fermentation results of strain W-A-Δ4-CRP*-11IS5 in shake flasks with different substrate concentrations.

[0036] Figure 11 Shake flask fermentation process diagram of strain W-A-Δ4-CRP*-11IS5.

[0037] Figure 12 3L fermenter fermentation process diagram of strain W-A-Δ4-CRP*-11IS5. Specific implementation manners

[0038] The present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and are not used to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps or conditions of the present invention belongs to the scope of the present invention.

[0039] Unless otherwise specified, the test methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.

[0040] The strain used for plasmid construction in the following embodiments is Escherichia coli BL21, the strain used for expression is Escherichia coli W3110, and the starting strain for gene modification is W3110-ΔaraBAD-ΔlyxK, which is obtained by knocking out the araBAD gene and lyxK gene of wild-type Escherichia coli W3110 using well-known gene knockout methods in the art. The pEcCas and pEcgRNA plasmids for CRISPR / Cas9 gene editing and the chromosomal multi-copy integration tool (MUCICAT) ptrDonor and PtrpQCasTns plasmids are from addgene. The pBAD24-DLA plasmid was previously constructed in the laboratory. The gene sequences of LXR, DPE, and AraA enzymes were synthesized by Hangzhou Qingke Biotechnology Co., Ltd. The araA, dpe, and lxr genes were concatenated by overlapping extension PCR. The RBS sequence was selected as AGGAGG, and the RBS sequence was designed on the primers for amplifying the genes and inserted upstream of the start codon of each gene, thus obtaining a linearized multi-enzyme expression module, which was recombined into the pBAD24 plasmid (purchased from addgene), and the plasmid pBAD24-DLA was obtained.

[0041] The primers used for plasmid and strain construction are shown in Table 1.

[0042] Table 1

[0043]

[0044]

[0045] Reagents used in the following examples:

[0046] L-Arabinose: Shanghai Aladdin Biochemical Technology Co., Ltd.

[0047] D-Glucose monohydrate: Shanghai Macklin Biochemical Co., Ltd.

[0048] Yeast extract, peptone: OXOID

[0049] Sodium chloride: Sinopharm Chemical Reagent Co., Ltd.

[0050] Potassium dihydrogen phosphate: Sinopharm Chemical Reagent Co., Ltd.

[0051] Dipotassium hydrogen phosphate: Sinopharm Chemical Reagent Co., Ltd.

[0052] Rhamnose, kanamycin sulfate, spectinomycin hydrochloride, bleomycin sulfate, anhydrotetracycline, chloramphenicol: Shanghai Macklin Biochemical Co., Ltd.

[0053] Liquid phase detection method for sugars and sugar alcohols in fermentation samples:

[0054] After diluting the taken samples by an appropriate multiple, filter them using a 0.22 μm filter membrane. Use the Shimadzu LC-20AT high-performance liquid system to quantitatively detect xylitol and arabitol. Detector: RID-20A refractive index detector, analytical column: Aminex HPX-87C, mobile phase: pure water, flow rate: 0.6 mL / min, column temperature set: 76 °C.

[0055] Example 1: Construction of genetically engineered strain W3110-ΔaraBAD-ΔlyxK-ΔptsG

[0056] Using Escherichia coli W3110-ΔaraBAD-ΔlyxK (W-Δ2) as the starting strain, use the CRISPR / Cas9 method to knockout the ptsG gene (gene sequence see Gene ID: 945651) in its genome. The steps are as follows:

[0057] 1. Construction of plasmid pEcgRNA-ptsG-N20

[0058] Extract the original pEcgRNA plasmid, digest it with BsaI, and after verification, perform gel recovery for standby.

[0059] Preparation of ptsG-N20 short chain: Determine the appropriate N20 sequence (agacgaatttaccctcaatg), anneal the two synthesized N20 primers (ptsG-N20-F and ptsG-N20-R) to form a short double strand, ligate it with the above-mentioned digested backbone, transform the self-prepared BL21 competent cells in the laboratory, and screen on a Spec (50 μg / mL) resistant plate. Verify by colony PCR and extract the plasmid.

[0060] 2. Construction of plasmid pEcgRNA-ptsG-N20-Up-Down

[0061] Using the wild-type Escherichia coli W3110 genome as a template, amplify the upstream homologous arm of the ptsG gene with ptsG-U-F and ptsG-U-R as primers, and amplify the downstream homologous arm with ptsG-D-F and ptsG-D-R as primers. After verification, recover the gel for later use.

[0062] Digest plasmid pEcgRNA-ptsG-N20 with EcoRI and HindIII, and recover the fragment with the correct length after verification by gel extraction.

[0063] The digested backbone is subjected to seamless cloning with the upstream and downstream homologous arm fragments of ptsG, transform the BL21 competent cells, and screen on a Spec (50 μg / mL) resistant plate. Verify by colony PCR and send the extracted plasmid for sequencing.

[0064] 3. Electrotransform pEcCas plasmid

[0065] a. Streak W3110-ΔaraBAD-ΔlyxK stored at -80 °C on an LB plate and culture overnight at 37 °C. Pick a single colony into a liquid LB test tube and culture at 37 °C and 220 rpm for 8 - 12 h. Pipette 200 μL of the bacterial solution into a 10 mL liquid LB test tube and culture at 37 °C and 220 rpm until OD 600 is approximately 0.6 - 0.8, and let the bacterial solution stand on ice for 15 - 20 min.

[0066] b. Transfer the bacterial solution to a 50 mL sterile centrifuge tube, centrifuge at 4 °C and 4000 rpm for 10 min, and discard the supernatant.

[0067] c. Resuspend the cells with 10 mL of pre-cooled 10% glycerol, centrifuge at 4 °C and 4000 rpm for 10 min, and discard the supernatant.

[0068] d. Repeat step c once.

[0069] e. Resuspend with 200 μL of pre-cooled 10% glycerol, aliquot into sterile 1.5 mL centrifuge tubes (100 μL per tube) for later use.

[0070] f. Add 800 - 1000 ng of pEcCas plasmid. After mixing, transfer it to a pre-chilled 2 mm sterile electroporation cuvette for electroporation. Electroporation conditions: 2.5 kV, 25 μF, 200 Ω, and the electroporation time is about 9 ms.

[0071] g. Immediately after electroporation, add 800 μL of sterile liquid LB medium and transfer it to a 1.5 mL sterile centrifuge tube. Resuscitate at 37 °C and 220 rpm for 1 h.

[0072] h. Centrifuge the resuscitated bacterial solution at 4000 rpm for 5 min, discard the supernatant, and spread the remaining 100 μL evenly on a Kana (50 μg / mL) resistant plate. Incubate overnight at 37 °C.

[0073] i. Pick monoclonal transformants for PCR verification to obtain Escherichia coli W3110-ΔaraBAD-ΔlyxK-pEcCas.

[0074] 4. Electroporation of plasmid pEcgRNA-ptsG-N20-Up-Down

[0075] a. Use Escherichia coli W3110-ΔaraBAD-ΔlyxK-pEcCas obtained in step 3 as the starting strain, streak it on a Kana (50 μg / mL) resistant plate, and after overnight incubation at 37 °C, pick a single colony into a liquid LB test tube and culture it at 37 °C and 220 rpm for 8 - 12 h. Use a pipette to transfer 200 μL of the bacterial solution into a 10 mL liquid LB test tube, and add L-arabinose (final concentration 10 mM). Culture at 37 °C and 220 rpm until the OD 600 is approximately 0.6 - 0.8, and let the bacterial solution stand on ice for 15 - 20 min.

[0076] b. Repeat the method for preparing electrocompetent cells in step 3

[0077] c. Add 800 - 1000 ng of plasmid pEcgRNA-ptsG-N20-Up-Down. After mixing, transfer it to a pre-chilled sterile 2 mm electroporation cuvette

[0078] d. The methods of electroporation and resuscitation are the same as in step 3

[0079] e. Spread the bacterial solution on a resistant plate containing Kana (50 μg / mL) + Spec (50 μg / mL), and incubate overnight at 37 °C.

[0080] f. Pick monoclonal transformants for PCR verification to obtain Escherichia coli W3110-ΔaraBAD-ΔlyxK-ΔptsG-pEcCas-pEcgRNA with the ptsG gene knocked out.

[0081] g. Pick the transformants into an LB liquid test tube containing Kana (50 μg / mL) and rhamnose (final concentration 10 mM), and culture at 37 °C and 220 rpm for 12 hours to eliminate the plasmid pEcgRNA-ptsG-N20-Up-Down.

[0082] h. After culturing the strain W3110-ΔaraBAD-ΔlyxK-ΔptsG-pEcCas at 37 °C and 220 rpm for 12 hours as needed, streak on a sucrose LB plate (final concentration 10 g / L) to eliminate the plasmid pEcCas. Name the finally obtained strain W3110-ΔaraBAD-ΔlyxK-ΔptsG as W-Δ3.

[0083] Example 2: Construction of a mutant strain of the global regulatory factor CRP protein.

[0084] The key regulatory protein that mediates glucose catabolite repression in Escherichia coli is the transcriptional activator CRP. Based on the knockout of the ptsG gene, single or multiple point mutations were made on the amino acids at positions 112, 127, 128, and 144 of the CRP protein. Among them, the isoleucine (I) at position 112 was mutated to leucine (L); the threonine (T) at position 127 was mutated to isoleucine (I) or leucine (L); the serine (S) at position 128 was mutated to proline (P) or glycine (G); the alanine (A) at position 144 was mutated to threonine (T). The CRP proteins obtained by mutating these mutation sites helped alleviate glucose catabolite repression. One of the three-site mutants CRP*(I112L, T127I, A144T) obtained in this example was confirmed to enhance the regeneration ability of coenzyme NADH while alleviating glucose catabolite repression. The specific experimental procedure is as follows:

[0085] 1. Construction of CRP mutant strains

[0086] Using the pEcCas / pEcgRNA tool, design the mutation sites on the primers of the homologous arms to replace the original sequence; and perform synonymous mutations on the NGG sequence so that the Donor DNA is not recognized by the sgRNA. Plasmid construction and transformation were carried out according to the method of Example 1. Using W-Δ3 as the starting strain, after mutating the CRP protein, name the series of mutant strains as W-Δ3-CRP* (in this example, multiple strains with single and multiple point mutations of the CRP protein were constructed according to the aforementioned CRP protein mutation sites and the mutated amino acids).

[0087] 2. Transformation of pBAD24-DLA plasmid

[0088] According to the electrotransformation method in Example 1, the plasmid pBAD24-DLA (the arrangement order of the three genes after the promoter is dpe-lxr-araA, which is preserved in the laboratory) was transformed into the strains W-Δ2 and W-Δ3-CRP*, and the strains W-Δ2-DLA and W-Δ3-CRP*-DLA were obtained respectively.

[0089] 3. Flask fermentation of ptsG knockout and CRP mutant strains

[0090] The strains W-Δ2-DLA and W-Δ3-CRP*-DLA were inoculated into LB liquid test tubes containing Amp (100 μg / mL) resistance. After culturing at 37 °C and 220 rpm for 12 hours, they were transferred to a fermentation medium supplemented with Amp (100 μg / mL) resistance at an inoculation amount of 2%. After culturing at 30 °C and 220 rpm for 3 hours, L-arabinose (final concentration 10 g / L) and glucose (final concentration 10 g / L) were added, and the culture was continued under this condition for 24 hours. The fermentation results are shown in Figure 2 . The strain W-Δ2-DLA was difficult to utilize arabinose simultaneously in the presence of glucose, and the final xylitol yield was only 0.87 g / L; while the mutant strains generally alleviated the inhibitory effect of glucose on arabinose. One of the triple-site mutant strains W-Δ3-CRP*-DLA (the mutant sites are I112L, T127I, A144T), combining CRP protein mutation and ptsG gene knockout, significantly alleviated the inhibitory effect of glucose on arabinose, and the xylitol yield reached 6.29 g / L. In subsequent other examples, unless otherwise specified, the mutation of CRP (i.e., CRP* in subsequent examples) refers to the simultaneous mutation of the three sites I112L, T127I, and A144T.

[0091] The glucose concentration was increased, and the fermentation of the triple-site mutant strain W-Δ3-CRP*-DLA was continued. The results Figure 3 are shown. When the glucose concentration was increased to 12.5 g / L and 15 g / L, it was obvious that the inhibitory effect of glucose on arabinose was not completely eliminated, and with the increase of the glucose concentration, the inhibitory effect was stronger.

[0092] Example 3: Overexpression of the regulatory protein AraC.

[0093] The L-arabinose operon regulatory protein (AraC) is a transcriptional regulatory factor widely present in bacteria. AraC can regulate the expression of arabinose transport-related proteins AraFGH and AraE. Overexpression of AraC promotes the transport efficiency of arabinose by the cells and further eliminates the repression effect of glucose on arabinose.

[0094] The promoter before the araC gene (gene sequence see Gene ID: 944780) in the host bacterium genome was replaced with the strong promoter P using the CRISPR / Cas9 method 43 . The N20 sequence is cgccgtgcaaataatcaatg. Plasmids pEcgRNA-araC-N20 and pEcgRNA-araC-N20-Up-Down were constructed respectively. See Example 1 for specific operations. After overexpressing AraC, strain W-A-Δ3-CRP* was obtained. The plasmid pBAD24-DLA was transformed into this host bacterium to obtain strain W-A-Δ3-CRP*-DLA. The shake flask fermentation results under different glucose concentrations are shown in Figure 4 . After overexpressing AraC, increasing the glucose concentration to 15 g / L no longer inhibits the utilization of arabinose

[0095] Example 4: Construction of genetically engineered strain W3110-ΔaraBAD-ΔlyxK-ΔptsG-ΔxylB

[0096] 1. Construction of strain W3110-ΔaraBAD-ΔlyxK-ΔptsG-ΔxylB

[0097] Using strain W-A-Δ3-CRP* as the starting strain, according to the operations in Example 1, the xylB gene (gene sequence see Gene ID: 948133) was knocked out. The N20 sequence is aacaagacccggaacagtgg. Plasmids pEcgRNA-xylB-N20 and pEcgRNA-xylB-N20-Up-Down were constructed respectively. After knocking out xylB, strain W3110-ΔaraBAD-ΔlyxK-ΔptsG-ΔxylB was obtained and named W-A-Δ4-CRP*

[0098] 2. Shake flask fermentation after knocking out the xylB gene

[0099] According to the electroporation method in Example 1, the plasmid pBAD24-DLA was transformed into strain W-A-Δ4-CRP* to obtain strain W-A-Δ4-CRP*-DLA. Using L-arabinose (final concentration 10 g / L) and glucose (final concentration 10 g / L) as co-substrates for shake flask fermentation, the fermentation results are shown in Figure 5 . After knocking out xylB, the influx of the intermediate L-xylulose into the metabolic branch was reduced. The arabinose consumption of strain W-A-Δ4-CRP*-DLA was 7.5 g / L and the xylitol production was 7.40 g / L after 24 h of fermentation. Compared with strain W-A-Δ3-CRP*-DLA, the xylitol production capacity was further improved

[0100] Example 5: Construction of genetically engineered bacteria containing catalytic modules with different gene arrangement orders

[0101] Study whether the arrangement order of three genes after the promoter in the ATX pathway affects xylitol production. The template used is the pBAD24-DLA plasmid.

[0102] 1. Construction of plasmids with five different gene arrangement orders such as pBAD24-ADL

[0103] Using the pBAD24-DLA plasmid as a template, pbad24-F and pbad24-R as primers to amplify the plasmid backbone. After verifying the correct band by nucleic acid electrophoresis, recover the gel for standby. Continue to amplify the fragments of the three enzymes with the primers in Table 1 respectively and recover the gel. Perform seamless cloning of the plasmid backbone and the fragments of the three enzymes, transform the BL21 competent cells, pick the transformant colonies for PCR verification and then send for sequencing and extract the plasmids. Five plasmids, namely pBAD24-ADL, pBAD24-ALD, pBAD24-LAD, pBAD24-DAL, and pBAD24-LDA, are obtained respectively. The plasmid maps are shown in Figure 6 .

[0104] 2. Construction of genetically engineered bacteria containing the above different plasmids

[0105] Obtain the electrocompetent cells of W-A-Δ4-CRP* according to the method for preparing electrocompetent cells in Example 1, and obtain the strains W-A-Δ4-CRP*(pBAD24-DLA), W-A-Δ4-CRP*(pBAD24-ADL), W-A-Δ4-CRP*(pBAD24-ALD), W-A-Δ4-CRP*(pBAD24-LAD), W-A-Δ4-CRP*(pBAD24-DAL), and W-A-Δ4-CRP*(pBAD24-LDA) containing the above five different plasmids according to the electrotransformation method in Example 1.

[0106] 3. Shake flask fermentation of genetically engineered bacteria containing plasmids with different gene arrangement orders

[0107] Refer to the method in Example 2 for the shake flask fermentation experiment. The fermentation results are shown in Figure 7 . When the three genes are arranged in the order of araA-dpe-lxr; dpe-araA-lxr; lxr-dpe-araA after the promoter, all can convert L-arabinose into xylitol. Among them, when arranged in the order of dpe-araA-lxr, the highest yield is obtained, consuming 8.77 g / L of L-arabinose and obtaining a xylitol yield of 8.65 g / L.

[0108] Example 6: Construction of genetically engineered bacteria containing different promoter catalytic modules

[0109] The promoter in the catalytic module was replaced with constitutive promoters and inducible promoters of different strengths to construct a small promoter library, including P Trc , P J23100 , P J23107 , P J23109 , P J23119 , P 43 , P 59 , P repB , and P rrnB P1 . Among them, P Trc and P 43 are promoters preserved in the laboratory. The sequences of P 59 , P repB , P rrnB P1 were synthesized by Youkang Biotechnology Co., Ltd. in Zhejiang. P J23100 , P J23107 , P J23109 , P J23119 are a series of constitutive promoters with different strengths. The promoter sequences are shown in Table 2.

[0110] Table 2

[0111]

[0112]

[0113] The arabinose-inducible promoter of the catalytic module was replaced with the promoters in the above table respectively to construct a new pBAD24 plasmid, and all plasmids containing different promoters were transformed into the strain W-Δ4. The shake-flask fermentation results of different promoters are shown in Figure 8 . The P J23119 promoter and the P Trc promoter both have effects similar to those of the arabinose-inducible promoter. The xylitol production of the P Trc promoter is 8.00 g / L, and the xylitol production of the P J23119 promoter is 7.89 g / L.

[0114] Example 7: Construction of genetically engineered bacteria containing catalytic modules with different RBS sequences

[0115] In Example 4, through the screening and comparison of different promoters, the arabinose-inducible promoter had the best effect and no additional inducer needed to be added. Therefore, based on the arabinose-inducible promoter, the RBS sequences before each gene were replaced and screened. The initial RBS sequence before each gene was aggagg. Four RBS sequences with different strengths were found on IGEM (http: / / parts.igem.org): BBa_B0029, BBa_B0030, BBa_B0032, BBa_B0034. The sequences are shown in Table 3 for details.

[0116] Table 3

[0117] RBS Sequence(5’-3’) BBa_B0029 ttcacacaggaaacc BBa_B0030 attaaagaggagaaa BBa_B0032 tcacacaggaaag BBa_B0034 aaagaggagaaa

[0118] Because the length of the RBS sequence is short, it can be designed in the primers to amplify the gene fragments with the corresponding RBS sequences respectively, and then seamless cloning can be carried out according to Example 1 to obtain plasmids with different RBS sequences. For the three genes after the promoter, the RBS sequences are replaced with strong, weak, and medium-strength sequences for combination respectively. Using pBAD24-dal as the amplification template, plasmids pBAD24-(34D-32A-29L), pBAD24-(34D-32A-30L), pBAD24-(34D-30A-29L), and pBAD24-(29D-32A-30L) are constructed respectively. Among them, the numbers and letters in the parentheses of the plasmid names in this example represent the relationship between the corresponding RBS sequences and the genes. Taking 34D-32A-29L as an example, it indicates that the RBS sequence carried before the D-allulose-3-epimerase gene dpe (abbreviated as D in plasmid naming) is BBa_B0034 (abbreviated as 34 in plasmid naming), the RBS sequence carried before the L-arabinose isomerase gene araA (abbreviated as A in plasmid naming) is BBa_B0032 (abbreviated as 32 in plasmid naming), and the RBS sequence carried before the L-xylulose reductase gene lxr (abbreviated as L in plasmid naming) is BBa_B0029 (abbreviated as 29 in plasmid naming). The corresponding BBa_B0030 sequence is abbreviated as 30 in plasmid naming. According to the method in Example 1, the above plasmids are transformed into W-A-Δ4-CRP* respectively to obtain the strain W-A-Δ4-CRP*(34D-32A-29L), named W-A-Δ4-CRP*-RBS1; the strain W-A-Δ4-CRP*(34D-32A-30L), named W-A-Δ4-CRP*-RBS2; the strain W-A-Δ4-CRP*(34D-30A-29L), named W-A-Δ4-CRP*-RBS3; the strain W-A-Δ4-CRP*(29D-32A-30L), named W-A-Δ4-CRP*-RBS4.

[0119] According to the method in Example 2, the above strains with different RBS sequences are subjected to shake-flask fermentation, with the strain W-A-Δ4-CRP*-DAL as the control. The fermentation results are shown in Figure 9 . The highest xylitol yield of the strain W-A-Δ4-CRP*-RBS3 is 8.95 g / L.

[0120] Example 8: Construction of multi-copy genetically engineered bacteria.

[0121] Using the MUCICAT multi-target gene editing tool, multiple copies of the catalytic module (with an arabinose-inducible promoter, and the gene arrangement order being dpe-araA-lxr, and the RBS sequence selected as 34D-30A-29L) were made at the IS5 locus (there are 18 copies in total on the Escherichia coli W3110 genome) of the strain W-A-Δ4-CRP*, resulting in genetically engineered bacteria with different copy numbers. The specific steps are as follows:

[0122] A. Construct the ptrDonor-DAL plasmid

[0123] Using the ptrDonor plasmid as a template, the linearized vector fragment was amplified with P5-F / R as primers; using the pBAD24-DAL plasmid as a template, the catalytic module was amplified with 5-F / R as primers. After the amplified fragments were verified by nucleic acid electrophoresis, they were gel-extracted and subjected to seamless cloning. After transformation and plating on a Cm (25 μg / mL) resistant LB plate, single colony transformants were picked and verified, and then the plasmid was extracted to obtain the ptrDonor-DAL plasmid. The specific steps can refer to the plasmid construction method in Example 1.

[0124] B. Construct the pQCasTns(Ptr)-IS5 plasmid

[0125] Using the pQCasTns(Ptr) plasmid as a template, the linearized vector pQCasTns(Ptr) was amplified with P-IS5-F / R as primers, digested, and then subjected to nucleic acid gel electrophoresis and gel extraction; a 32bp crRNA-IS5 was designed, and the primers IS5-F / R were annealed and self-ligated to form a fragment. The vector and the base fragment were subjected to seamless cloning. After transformation and plating on a Kana (50 μg / mL) resistant LB plate, single colony transformants were picked and verified, and then the plasmid was extracted to obtain the pQCasTns(Ptr)-IS5 plasmid.

[0126] C. Prepare electrocompetent cells of W-Δ4

[0127] For the detailed steps, see Example 1.

[0128] D. Electroporation transformation

[0129] The prepared electrocompetent cells of W-Δ4 were transformed with the ptrDonor-DAL plasmid by electroporation using an electroporator to obtain the strain W-Δ4-ptrDonor.

[0130] E. Prepare electrocompetent cells of W-Δ4-ptrDonor and transform with the pQCasTns(Ptr)-IS5 plasmid. After screening with a Kana (50 μg / mL) + Cm (25 μg / mL) plate, the strain W-Δ4-ptrDonor-IS5 was obtained. The steps are the same as those in C and D.

[0131] F. Pre-induction

[0132] Select multiple monoclonal transformants W-Δ4-ptrDonor-IS5, streak them onto a plate containing Kana (50 μg / mL) + Cm (25 μg / mL) + Atc (100 μg / mL), and place them in an incubator at 30 °C for overnight induction culture.

[0133] G. Re-induction

[0134] After the plate has grown, increase the concentration of anhydrotetracycline, transfer and streak onto a plate containing Kana (50 μg / mL) + Cm (25 μg / mL) + Atc (1000 μg / mL) for induction. Pick monoclonal transformants and dissolve them in sterile water. Use this as a template and perform colony PCR with verification primers to verify the copy number.

[0135] H. Plasmid loss

[0136] Pick the strain into which the gene has been inserted, transfer it to a test tube. After the OD 600 is greater than 0.3, prepare electrocompetent cells, transform with 50 μg of pfree-zeo plasmid, recover at 30 °C for 2 hours. Take 50 μL of the bacterial solution and inoculate it into a 10 mL LB liquid test tube (2 g / L rhamnose + 200 ng / mL ATc + 50 μg / mL zeocin), culture at 30 °C for 24 hours, streak onto an LB non-resistant plate, and pick transformants to spot onto LB-Kana, LB-cm, and LB-zeo plates respectively to verify the plasmid loss effect.

[0137] Perform colony PCR again to verify the copy number of the inserted gene, pick colonies and shake in an LB test tube overnight to preserve the bacteria.

[0138] According to the results of nucleic acid electrophoresis verification, strains with 4 - 12 copies of the catalytic module inserted were obtained, named W-A-Δ4-CRP*-4IS5, W-A-Δ4-CRP*-5IS5, W-A-Δ4-CRP*-6IS5, W-A-Δ4-CRP*-7IS5, W-A-Δ4-CRP*-8IS5, W-A-Δ4-CRP*-9IS5, W-A-Δ4-CRP*-10IS5, W-A-Δ4-CRP*-11IS5, and W-A-Δ4-CRP*-12IS5 respectively. Using L-arabinose at different concentrations as the substrate, flask fermentation was carried out on strain W-A-Δ4-CRP*-11IS5, and the fermentation results are shown in Figure 10 When strain W-A-Δ4-CRP*-11IS5 uses 10 g / L L-arabinose as the substrate, all L-arabinose is completely converted into xylitol. Using 28 g / L arabinose as the substrate, 26.48 g / L of L-arabinose is consumed, and 25.19 g / L of xylitol is produced, with a relative yield of 0.95 g / g. The fermentation process is shown in Figure 11 .

[0139] Example 9: Construction of genetically engineered bacteria with multiple copies at different genomic loci.

[0140] There are also different multiple-copy loci on the genome of Escherichia coli W3110, including IS1 (with a total of 7 copies), IS3 (with a total of 5 copies), and IS186 (with a total of 3 copies). According to the method in Example 6, the catalytic module was inserted at the above-mentioned multiple-copy loci respectively to obtain strains W-Δ4-7IS1, W-Δ4-5IS3, and W-Δ4-3IS186. Using 10 g / L L-arabinose as the substrate, the above three strains were fermented in shake flasks, and the xylitol yields were 7.26 g / L, 5.11 g / L, and 4.31 g / L respectively.

[0141] Example 10: Verification of fermentor for genetically engineered bacteria with multiple copies.

[0142] Pick the strain W-A-Δ4-CRP*-11IS5 activated on the LB solid medium and inoculate it into a sterilized 250 mL shake flask containing 30 mL of LB medium. Culture at 37 °C and 220 rpm for 8 h. Pipette 1 mL of the bacterial liquid in the shake flask and inoculate it into a 1000 mL Erlenmeyer flask containing 100 mL of sterilized LB medium. Culture at 37 °C and 220 rpm for 8 h. The composition of the fermentation medium is shown in Table 4.

[0143] Table 4

[0144] Component Concentration (g / L) Yeast extract 20.0 NaCl 0.5 <![CDATA[KH2PO4]]> 3.0 <![CDATA[Na2HPO4·12H2O]]> 15.13 <![CDATA[MgCl2]]> 0.095 Polyether antifoaming agent NA

[0145] After the medium was sterilized and cooled to 30 °C, turn on the stirrer and set the initial rotation speed to 400 rpm; add sterilized glucose to the medium at one time to make the glucose concentration in the medium 10 - 20 g / L; set the initial aeration rate to 1.0 vvm; transfer the seed liquid to the medium by the fire ring inoculation method. Gradually increase the rotation speed as the dissolved oxygen drops to keep the dissolved oxygen in the range of 0 - 30%. After culturing for 4 - 6 h, start to feed L-arabinose, and the initial L-arabinose concentration is 40 - 50 g / L. Subsequently, control the L-arabinose concentration at about 30 - 40 g / L and the glucose concentration in the range of 10 - 20 g / L. Control the pH in the range of 6.8 - 7.2. Take samples and detect every 4 h. The fermentation process is as Figure 12 shown. After 44 h of fermentation, the xylitol concentration in the fermentation broth is 64.07 g / L, the residual arabinose is 5.05 g / L, there is no residual glucose, the space-time efficiency of xylitol production is 1.46 g / L / h, and the mass conversion rate of arabinose to xylitol reaches 0.95 g / g.

[0146] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the patent for the present invention. For those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention.

Claims

1. A recombinant Escherichia coli for efficiently utilizing L-arabinose to produce xylitol without adding glycerol, characterized in that: The recombinant Escherichia coli is based on the Escherichia coli (W3110-ΔaraBAD-ΔlyxK) in which the araBAD operon and the L-xylulose kinase gene lyxK are knocked out, and the glucose-specific transporter gene ptsG and the D-xylulose kinase gene xylB in the genome are knocked out; the amino acids of the global regulatory factor CRP protein are mutated; and the arabinose regulatory protein AraC is overexpressed; The recombinant Escherichia coli also contains or integrates an arabinose-xylitol synthesis catalytic module, which includes the sequences of the L-arabinose isomerase gene araA, the D-psicose-3-isomerase gene dpe, and the L-xylulose reductase gene lxr; the NCBI accession number of the L-arabinose isomerase gene is M15263, the NCBI accession number of the D-psicose-3-isomerase gene is AE008210, and the NCBI accession number of the L-xylulose reductase gene is AJ583159.

2. The recombinant Escherichia coli according to claim 1, characterized in that In the catalytic module, the L-arabinose isomerase gene araA, the D-psicose-3-isomerase gene dpe, and the L-xylulose reductase gene lxr are expressed in tandem in a polycistronic form under the control of the arabinose inducible promoter P BAD after.

3. The recombinant Escherichia coli according to claim 1, characterized in that In the catalytic module, the L-arabinose isomerase gene araA, the D-psicose-3-isomerase gene dpe, and the L-xylulose reductase gene lxr are expressed in tandem in a polycistronic form under the inducible promoter P Trc or constitutive promoter P J23119 after.

4. The recombinant Escherichia coli according to claim 1, characterized in that The arrangement order of the L-arabinose isomerase gene araA, the D-psicose-3-isomerase gene dpe, and the L-xylulose reductase gene lxr after the promoter is one of: araA-dpe-lxr, dpe-araA-lxr, and lxr-dpe-araA.

5. The recombinant Escherichia coli according to claim 1, characterized in that In the catalytic module, the RBS sequence carried before the L-arabinose isomerase gene araA is BBa_B0030, the RBS sequence carried before the D-psicose-3-isomerase gene dpe is BBa_B0034, and the RBS sequence carried before the L-xylulose reductase gene lxr is BBa_B0029.

6. The recombinant Escherichia coli according to claim 1, characterized in that The amino acid mutation of the global regulatory factor CRP protein is specifically: single-point or multi-point mutation of the amino acids at positions 112, 127, 128, and 144 of the global regulatory factor CRP protein, wherein the isoleucine (I) at position 112 is mutated to leucine (L); the threonine (T) at position 127 is mutated to isoleucine (I) or leucine (L); the serine (S) at position 128 is mutated to proline (P) or glycine (G); and the alanine (A) at position 144 is mutated to threonine (T).

7. The recombinant Escherichia coli according to claim 1, characterized in that The catalytic module is integrated into the IS5 site of the E. coli W3110 genome at a copy number of 4-12.

8. The recombinant Escherichia coli according to claim 1, characterized in that The catalytic module is integrated into the IS1, IS3, and IS186 sites of the Escherichia coli W3110 genome in 3-7 copies.

9. Use of the recombinant Escherichia coli according to any one of claims 1 to 8 in the fermentation production of xylitol.

10. A method for producing xylitol by efficiently utilizing L-arabinose without adding glycerol, characterized in that: The recombinant Escherichia coli according to any one of claims 1 to 8 is inoculated into a fermentation liquid containing L-arabinose and glucose, and xylitol is obtained after fermentation.

Images