Application of dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase
By complexing the targeted sphingolipid C-4 hydroxylase encoding gene dsRNA with nanolayered double hydroxides, LDH-dsCsSUR2 preparations, the problem of low delivery efficiency and high cost of RNA pesticides in the prevention and treatment of anthrax is solved, and efficient and targeted anthrax prevention and treatment effects are achieved.
Patent Information
- Application Number
- CN202510662176.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2045-05-22
AI Technical Summary
When preventing and treating anthrax, exposed dsRNA is easily degraded by environmental enzymes, has low delivery efficiency and high cost, resulting in short-term efficacy and poor prevention and treatment effects.
The targeted sphingolipid C-4 hydroxylase encoding gene dsRNA is used to complex with nanolayered double hydroxides to form an LDH-dsCsSUR2 preparation. By spraying it on crop leaves or fruits, the delivery efficiency and prevention and treatment effect of dsRNA are improved.
The prevention and treatment effect of anthrax was significantly improved, the area of lesions treated with naked dsRNA decreased by 49.17%, and the area of lesions treated with LDH-dsCsSUR2 decreased by 94.23%, which significantly improved the targeting and efficiency of the prevention and treatment of anthrax.
Smart Images

Figure CN120192969B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of RNA biological control, and particularly relates to the application of dsRNA targeting sphingolipid C-4 hydroxylase encoding gene. Background Art
[0002] Anthrax spp. Colletotrichum The fungus Colletotrichum genus is widely recognized as one of the ten most important fungal plant pathogens worldwide. The anthracnose disease it causes severely damages a wide range of agricultural, cash, and horticultural crops, leading to leaf dieback, fruit rot, and yield losses. According to statistics, anthracnose infection significantly reduces the quality of exported fruit from tropical, subtropical, and Mediterranean regions, resulting in annual post-harvest economic losses of up to 60%-80%.
[0003] RNA pesticides are novel biopesticides developed based on RNA interference technology. Their essence is to specifically bind to the mRNA transcribed from specific genes in target organisms. Through the naturally occurring RNAi pathway within the target organism, they cause transcript degradation or translational inhibition, thereby disrupting the normal growth of the target organism and harming the host plant, ultimately achieving the goal of pest control and plant protection. RNA pesticides, classified as biopesticides, offer numerous advantages over traditional chemical pesticides. First, double-stranded RNA (dsRNA) possesses strong specificity and efficient gene silencing capabilities without the need for genetic engineering. Second, depending on the target design, dsRNA can inhibit the growth of viruses, bacteria, and fungi, thereby controlling the diseases they cause. Furthermore, dsRNA can cross cell membranes and be delivered within the body. Finally, dsRNA is easily degraded in the environment, making it an environmentally friendly pesticide. Consequently, RNA pesticides offer significant advantages for pest control: high specificity, effective efficacy, resistance to resistance, non-toxicity, no residual residues, and low R&D costs, making them a leading edge approach to green pest control in agriculture.
[0004] However, the application of RNA pesticides is also accompanied by numerous challenges. For example, naked dsRNA is easily degraded by environmental enzymes and ultraviolet light, resulting in short-lived efficacy; pest epidermis hinders dsRNA absorption, resulting in low dsRNA delivery efficiency and affecting target gene silencing; and large-scale dsRNA synthesis is expensive. Therefore, developing highly effective and targeted RNA pesticides for anthrax control is an urgent challenge in this field. Summary of the Invention
[0005] The purpose of the present invention is to provide an application of dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene, which can effectively and targetedly prevent and control crop anthracnose.
[0006] The present invention provides an application of dsRNA targeting a sphingolipid C-4 hydroxylase encoding gene; the application includes: preventing and controlling anthracnose in crops and / or preparing products for preventing and controlling anthracnose in crops; the dsRNA targeting a sphingolipid C-4 hydroxylase encoding gene is transcribed from the target gene segment shown in SEQ ID. No. 1; the crops include: rubber trees and / or mangoes.
[0007] Preferably, the nucleotide sequence of the dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene is shown as SEQ ID. No. 2.
[0008] Preferably, the anthrax pathogens include: Siamese anthrax bacteria and / or Asian anthrax bacteria.
[0009] Preferably, the product comprises: a preparation containing dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase.
[0010] The present invention provides an LDH-dsCsSUR2 preparation, which comprises: dsRNA targeting a sphingolipid C-4 hydroxylase encoding gene and nano-layered double hydroxide;
[0011] The nano-layered double hydroxide is magnesium / aluminum layered double hydroxide.
[0012] The present invention provides a method for preventing and controlling anthracnose of crops, comprising the following steps:
[0013] Applying the dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene shown in SEQ ID. No. 2 or the LDH-dsCsSUR2 formulation described in the above technical solution to crops;
[0014] The crops include: rubber trees and / or mangoes.
[0015] Preferably, the application method includes: spraying;
[0016] When the crop to be sprayed is a rubber tree, the spraying position is the rubber tree leaves;
[0017] When the crop to be sprayed is mango, the spraying site is the mango fruit.
[0018] Beneficial effects:
[0019] The present invention provides applications of a dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase; such applications include preventing and controlling anthracnose in crops and / or preparing products for preventing and controlling anthracnose in crops. The dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase is transcribed from the target gene segment shown in SEQ ID No. 1. This gene segment is a target gene segment for preventing and controlling anthracnose in crops and can be used to prevent and control anthracnose in crops or to prepare products for preventing and controlling anthracnose in crops.
[0020] Based on the above technical advantages, the present invention also provides a LDH-dsCsSUR2 preparation. The present invention combines dsRNA with nanomaterials and uses highly pathogenic anthrax bacteria Colletotrichumsiamense HN08 was used as the experimental material. First, the target gene segment dsRNA was obtained through in vitro dsRNA synthesis technology. Then, it was compounded with the nanomaterial layered double hydroxide (LDH) to obtain a dsRNA nanocomposite for crop control. The dsRNA nanocomposite was sprayed on rubber tree leaves or mango fruits, and anthracnose fungi were inoculated on the rubber tree leaves. Colletotrichum siamense HN08, inoculated with Colletotrichum asiaticum on mango fruit Colletotrichum asianu 02-3, measure the area of lesions, and obtain a combination of target gene dsRNA and nano-LDH that is effective in preventing and controlling anthracnose of rubber tree leaves and mango fruit, which can effectively prevent and control anthracnose of crops in a targeted and efficient manner. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0022] Figure 1 The electrophoresis diagram of the transcription product provided by the present invention;
[0023] Figure 2 This is a diagram showing the effect of preventing and controlling rubber anthrax provided by the present invention;
[0024] Figure 3 This is a diagram showing the effect of preventing and controlling mango anthracnose provided by the present invention. DETAILED DESCRIPTION
[0025] In the present invention, unless otherwise specified, the materials, reagents and equipment used are all conventionally selected.
[0026] The present invention provides a target gene segment for preventing and controlling anthracnose of crops, wherein the target gene segment is anthracnose fungus. CsSUR2The target gene segment is selected from the N-terminal sequence of the gene coding region, and its nucleotide sequence is shown in SEQ ID. No. 1, specifically: 5'-CTTCCGGCCTACACATTGAGGCCCAAGCCGGAACTCATTCCTGGCATTCCAGACAGCTACCTTAACATCTTCGGCCCGATCGTCGTCTACTGGTGCTTGTCAATGTTCTTCCACCTCATTGACACCTACGACGTCTGGCCCCAGTACCGCCTTCACACCCCCGAGGAGATCACCAAGCGCAACCACGTCTCGCGCTACGAGGTCGCCCGCGATGTCCTGATCCAGCAGCTGATCCAGATCGCCATGTCCGTCTTCCTCGAGGTTATTGACGACGAGCAG-3'.
[0027] The present invention provides anthrax bacteria CsSUR2 The dsCsSUR2 for controlling crop anthracnose obtained by transcription of the target gene segment is shown in SEQ ID. No. 2; the nucleotide sequence of the dsCsSUR2 is shown in SEQ ID. No. 2, specifically: 5'-CUGCUCGUCGUCAAUAACCUCGAGGAAGACGGACAUGGCGAUCUGGAUCAGCUGCUGGAUCAGGACAUCGCGGGCGACCUCGUAGCGCGAGACGUGGUUGCGCUUGGUGAUCUCCUCGGGGGUGUGAAGGCGGUACUGGGGCCAGACGUCGUAGGUGUCAAUGAGGUGGAAGAACAUUGACAAGCACCAGUAGACGACGAUCGGGCCGAAGAUGUUAAGGUAGCUGUCUGGAAUGCCAGGAAUGAGUUCCGGCUUGGGCCUCAAUGUGUAGGCCGGAAG-3'; the dsRNA sequence shown in SEQ ID. No. 2 is reverse complementary to the nucleotide sequence shown in SEQ ID. No. 1. For example, in the nucleotide sequence shown in SEQ ID. No. 2, T represents U in the sequence listing.
[0028] The layered double hydroxides described in the present invention include magnesium / aluminum layered double hydroxide, zinc / aluminum layered double hydroxide, nickel / iron layered double hydroxide, and nickel / aluminum layered double hydroxide. The layered double hydroxide described in the following examples is magnesium / aluminum layered double hydroxide (MgAl-LDH two-dimensional layered double metal hydroxide), which was purchased from Nanjing Xianfeng Nanomaterial Technology Co., Ltd.
[0029] In order to further illustrate the present invention, the solutions provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0030] Example 1
[0031] 1. Previous studies have shown that anthrax sphingolipid C-4 hydroxylase CsSUR2 Gene( CsSUR2 The gene (accession number PV023913 on NCBI) is an important pathogenic factor of anthrax and may have the potential to be a target for the prevention and control of anthrax. CsSUR2 A pair of specific primers, dsCsSUR2-F (SEQ ID. No. 3) and dsCsSUR2-R (SEQ ID. No. 4), were designed. Using the DNA extracted from the highly pathogenic wild-type strain HN08 as a template, a DNA fragment (SEQ ID. No. 1) was amplified for subsequent dsCsSUR2 synthesis. The specific primer sequences are shown in Table 1:
[0032] Table 1 Primer information
[0033]
[0034] 2. dsRNA was synthesized in vitro using the Nanjing Vazyme Biotech Co., Ltd. T7 RNAi Transcription Kit. T7 RNA polymerase recognizes a DNA template with a T7 promoter and uses four NTPs as substrates to transcribe dsCsSUR2 in vitro. The specific method is as follows:
[0035] a. Prepare the reaction system as shown in Table 2.
[0036] Table 2 Reaction system
[0037]
[0038] b. Incubate in a PCR machine at 37°C for 6 h to obtain the transcript dsCsSUR2 (SEQ ID No. 2).
[0039] c. Dilute 100 U / μL RNase T1 to 10 U / μL using RNase T1 Dilution Buffer. Incubate the transcripts to digest excess template DNA and single-stranded RNA. See Table 3 for the incubation system.
[0040] Note: RNase T1 specifically degrades single-stranded RNA and the three G bases at the 5' end. The diluted RNase T1 must be used as soon as possible and should not be stored.
[0041] Table 3 Incubation system
[0042]
[0043] Note: After mixing, gently pipette to mix thoroughly and briefly centrifuge the reagent to the bottom of the tube.
[0044] d. Incubate at 37°C for 30 min to obtain pure dsCsSUR2 (SEQ ID. No. 2).
[0045] e. Electrophoresis detection of the transcription product (ie, dsCsSUR2 shown in SEQ ID. No. 2) showed the following results: Figure 1 As shown (in Figure 1 In FIG, a is a schematic diagram showing the location of dsCsSUR2 on the CsSUR2 protein; b is an electrophoresis diagram of the transcription product, in which lane M is a DNA DL2000 marker; lane 1 is the electrophoresis result of dsCsSUR2).
[0046] f. Product Purification
[0047] RNA was purified using magnetic beads.
[0048] (1) Remove the RNA Clean Beads from 4°C and allow them to equilibrate at room temperature for 30 minutes. Mix thoroughly by inverting or vortexing before use.
[0049] (2) Add 80 μL of magnetic bead solution to the transcript and pipette up and down more than 10 times to mix the solution thoroughly.
[0050] (3) Incubate at room temperature for 8 min to allow RNA to fully bind to the magnetic beads.
[0051] (4) Place the PCR tube on a magnetic rack for approximately 5 minutes. After the solution has clarified, carefully remove the supernatant, taking care not to disturb the magnetic beads when aspirating the supernatant.
[0052] (5) Keeping the PCR tube on the magnetic stand, add 200 μL of freshly prepared 80% ethanol, taking care not to disturb the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant. Repeat this step once.
[0053] (6) Open the lid and air-dry the magnetic beads for 5-10 minutes. Dry until there is no moisture on the surface of the beads. Excessive drying will affect RNA elution.
[0054] (7) Remove the PCR tube from the magnetic stand, add 40 μL of RNase-free H2O, use a pipette to remove the magnetic beads from the tube wall, mix thoroughly, and incubate at room temperature for 3 min.
[0055] (8) Place the PCR tube on a magnetic rack. Once the solution has clarified, carefully transfer the supernatant to a new RNase-free EP tube, avoiding the magnetic beads. To prevent the magnetic beads from affecting subsequent experiments, reserve 1-2 μL of solution when transferring the product to prevent the magnetic beads from being absorbed.
[0056] (9) Detect the A260 absorbance of the product to determine its concentration, and store the purified product (i.e., dsCsSUR2) at −20°C.
[0057] 3. Preparation of Anthrax Inoculum: Activate the rubber anthracnose strain HN08 and the mango anthracnose strain 02-3 in the culture tubes on PDA solid medium. Scrape fresh mycelium from the edges of the activated strains and incubate on PDA solid medium at 28°C for 5 days. Prepare appropriate-sized HN08 and 02-3 inoculum cakes for later use.
[0058] 4. Nanomaterial layered double hydroxide (LDH) loaded with dsCsSUR2
[0059] The nanomaterial LDH (i.e., magnesium / aluminum layered double hydroxide) was dissolved in DEPC water to obtain an LDH working solution (50 μg / mL). The dsRNA was diluted with the LDH working solution to form an LDH-dsRNA mixture (the final dsRNA concentration in the mixture was 200 ng / μL). The diluted LDH-dsRNA mixture was placed in a 55°C water bath for 1 min, quickly transferred to a high-speed vortex oscillator for 2 min, and allowed to stand for 2 min. At this time, the dsRNA was adsorbed on the surface of the LDH to form stable LDH-dsRNA nanoparticles.
[0060] 5. Application of LDH-dsCsSUR2 in the prevention and control of rubber anthracnose
[0061] The two groups of dsRNA (naked dsRNA) were: (1) water as a control; (2) dsCsSUR2 (diluted with water, concentration of 200 ng / μL);
[0062] The two groups sprayed with LDH-dsRNA were: (1) blank nanomaterial (50 μg / mL LDH) as control treatment; (2) LDH-dsCsSUR2 nanomaterial treatment.
[0063] Thirty healthy, light green rubber tree leaves were treated in each group, and the experiment was repeated three times. A needle was pricked symmetrically on either side of each leaf vein to create wounds. 10 μL of dsCsSUR2 and 10 μL of control water, 10 μL of LDH-dsCsSUR2 and 10 μL of control LDH were dripped onto the puncture sites. Two days after treatment, the puncture sites were inoculated with a 0.5 cm diameter cake of the anthrax pathogen HN08. Three days after inoculation, the lesion area in each treatment was counted. Results are shown in Table 1. Figure 2 (exist Figure 2 (a) The phenotype of leaf lesions after droplet exposure to bare dsCsSUR2; b) The area of leaf lesions after droplet exposure to bare dsCsSUR2; c) The phenotype of leaf lesions after spraying LDH-dsCsSUR2; d) The area of leaf lesions after spraying LDH-dsCsSUR2.
[0064] Combine Figure 2 As can be seen, the lesion area in the naked dsRNA treatment decreased by 49.17% compared to the water control treatment, and the lesion area in the LDH-dsCsSUR2 treatment decreased by 94.23% compared to the LDH control treatment. This indicates that applying naked dsCsSUR2 or LDH-dsCsSUR2 can effectively reduce the infection of anthracnose fungi on rubber leaves, providing a good protective effect, but LDH can improve the prevention effect.
[0065] 6. Application of LDH-dsCsSUR2 in the prevention and control of mango anthracnose
[0066] The preventive test of dsCsSUR2 and LDH-dsCsSUR2 nanoformulations against Colletotrichum mangoe was analyzed, and four treatment groups were designed;
[0067] The first group was dripped with naked dseGFP (dsRNA synthesized with the green fluorescent protein encoding gene sequence, prepared in the same way as dsCsSUR2 treatment) as control 1;
[0068] The second group was dripped with LDH-dseGFP as control 2;
[0069] The third group was dripped with naked dsCsSUR2;
[0070] The fourth group was treated with LDH-dsCsSUR2.
[0071] Mangoes with similar growth and size were selected for inoculation. Six inoculations were performed on each mango fruit, and the experiment was repeated five times.
[0072] The mango fruit surface was pricked with needles to create wounds. 20 μL dsCsSUR2 and 20 μL control dseGFP, 20 μL LDH-dsCsSUR2 and 20 μL control LDH-dseGFP were dripped onto the puncture site, respectively. Two days after treatment, a bacterial cake of Asian anthracnose pathogen 02-3 (0.5 cm in diameter) was inoculated. The results are shown in the figure. Figure 3 (exist Figure 3 In the figure, panel a shows the phenotype of mango anthracnose lesions in each treatment; panel b shows the area of mango anthracnose lesions in each treatment).
[0073] Combine Figure 3 The results showed no significant difference between the naked dseGFP and LDH-dseGFP controls, but the lesion area in the naked dsCsSUR2 treatment decreased by 45.28% compared to the control 1 treatment, and the lesion area in the LDH-dsCsSUR2 treatment decreased by 72.31% compared to the control 2 treatment. This indicates that applying naked dsCsSUR2 or LDH-dsCsSUR2 can effectively reduce the infection of anthracnose fungi in mango fruit, providing a good protective effect, but LDH can improve the prevention effect.
[0074] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Application of dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase; The application is: preventing and controlling anthracnose in crops and / or preparing products for preventing and controlling anthracnose in crops; The dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene is transcribed from the target gene segment shown in SEQ ID. No. 1; The crops are: rubber trees and / or mangoes; The nucleotide sequence of the dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene is shown in SEQ ID. No.
2.
2. The use according to claim 1, characterized in that The pathogenic bacteria of anthrax include: Siamese anthrax bacteria and / or Asian anthrax bacteria.
3. The use according to claim 1, characterized in that The product includes a preparation containing dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene.
4. An LDH-dsCsSUR2 preparation, characterized in that The LDH-dsCsSUR2 preparation includes: dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene and nano-layered double hydroxide; The nano-layered double hydroxide is: magnesium / aluminum layered double hydroxide; The nucleotide sequence of the dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene is shown in SEQ ID. No.
2.
5. A method for preventing and controlling anthracnose of crops, characterized in that: The steps include: Applying the dsRNA targeting the sphingolipid C-4 hydroxylase encoding gene shown in SEQ ID. No. 2 or the LDH-dsCsSUR2 formulation according to claim 4 to crops; The crops are: rubber trees and / or mangoes.
6. The method according to claim 5, characterized in that The application methods include: spraying; When the crop to be sprayed is a rubber tree, the spraying position is the rubber tree leaves; When the crop to be sprayed is mango, the spraying site is the mango fruit.
Citation Information
Patent Citations
LDH-dsRNA nano preparation for preventing and treating crop anthracnose and application of LDH-dsRNA nano preparation
CN118109462A
Particles comprising double stranded RNA and use of same in agriculture
WO2023248220A1